Gene expression enhancing element capable of improving gene transcription level and application thereof

Abstract

The invention discloses a gene expression enhancing element capable of improving a gene transcription level and an application of the gene expression enhancing element. It is found that a delta satellite region from sweet potato mosaic virus (SPLCV) SBG51 comprises a new DNA sequence capable of remarkably enhancing expression of a reporter gene, the gene expression enhancing effect of the delta satellite region does not change polyadenylation of mRNA, the delta satellite region is independent of a promoter and a terminator, and the space-time mode of the promoter is kept. The invention further finds that AT-rich sequences (such as ATAAA or TTAAA or tandem repeat sequences containing a plurality of ATAAA or TTAAA) are key elements of the above effects, even synthetic AT-rich sequences (AT-rich-1 and AT-rich-2) of 29bp are sufficient to increase the expression of the reporter gene GFP by about 3 times, and the gene expression enhancement effect of the AT-rich sequences is well expressed in both plants and yeast cells. Therefore, the invention can be applied to the aspects of improving the activity of the target gene according to the required level, providing high-level and long-lasting protein production and the like.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biochemistry and molecular biology, and particularly relates to a gene expression enhancer element capable of improving the transcription level of a gene and application thereof. BACKGROUND

[0002] Improving the expression level of a target gene has always been an important aspect of modern molecular biology technology and synthetic biology. A gene expression module is usually composed of three essential elements: a promoter, a gene coding region, and a terminator, wherein the promoter and the terminator can both regulate the expression amount of the gene. In addition, the nuclear matrix binding region also participates in the regulation of gene expression.

[0003] Plant viruses are one of the main sources of mining regulatory elements of plant expression systems. For example, the most famous 35S promoter and 35S terminator in plants are derived from Cauliflower Mosaic Virus (CaMV). The genome of a plant virus is usually very small, so its gene expression regulatory elements are generally very simple and short, which is conducive to the editing and design of gene expression modules. Therefore, mining gene enhancer elements in plant viruses has great development potential. SUMMARY

[0004] In a first aspect, the present application aims to provide a gene expression enhancer element capable of improving the transcription level of a target gene.

[0005] The gene expression enhancer element is any one of the following expression enhancer sequences:

[0006] (1) ATAAA;

[0007] (2) TTAAA;

[0008] (3) a tandem sequence containing several sequences as shown in (1) and / or (2);

[0009] (4) a sequence having at least 80% or more sequence identity with the sequences as shown in (1), (2), and (3), for example, a sequence having 8

[0010] 5% or more, 90% or more, 95% or more, 98% or more sequence identity.

[0011] The several is 2 or more, preferably 3 or more, more preferably 5 or more, for example, 5-50, 5-30, 5-20, 10-20, etc.

[0012] The tandem sequence contains a tandem sequence of ATAAA, or a tandem sequence of TTAAA, or a tandem sequence of ATAAA and TTAAA.

[0013] The tandem of ATAAA comprises two or more tandem of ATAAA, preferably three tandem of ATAAA, more preferably five or more tandem of ATAAA, such as five tandem of ATAAA, seven tandem of ATAAA, ten tandem of ATAAA, twenty tandem of ATAAA, etc.

[0014] The tandem of TTAAA comprises two or more tandem of TTAAA, preferably three tandem of TTAAA, more preferably five or more tandem of TTAAA, such as five tandem of TTAAA, seven tandem of TTAAA, ten tandem of TTAAA, twenty tandem of TTAAA, etc.

[0015] The tandem of ATAAA and TTAAA comprises one or more ATAAA and one or more TTAAA in any number, order, etc. combination, such as one TTAAA and one ATAAA in tandem and repeating such combination (or one ATAAA and one TTAAA in tandem and repeating such combination), such as one TTAAA and multiple ATAAA in tandem, and further in tandem with one or more TTAAA, optionally, in tandem with one or more ATAAA, and so on in this interval order, such as any combination of the above forms. It should be understood that ATAAA and TTAAA can be arbitrarily replaced in the above tandem.

[0016] The tandem is a direct tandem.

[0017] The tandem is a tandem with any one or more of A / C / T / G in interval.

[0018] The multiple bases can comprise multiple A, or multiple C, or multiple T, or multiple G, or any combination of two or more of A / C / T / G.

[0019] In the present application, "multiple" means two or more, unless otherwise specified.

[0020] In the present application, "gene expression enhancement" means that the transcription level or translation level or protein expression level of a gene can be increased, which increase can comprise 10% or more, or 50% or more, or 100% or more, or 2-fold or more, or 3-fold or more, or 5-fold or more, or 8-fold or more, or 10-fold or more, or 15-fold or more, or 20-fold or more, or 25-fold or more, or 30-fold or more, or 40-fold or more, or 50-fold or more. "Gene expression enhancement element" means a DNA sequence that can increase the transcription level or translation level of a gene, or an RNA sequence or protein sequence that can obtain the DNA sequence.

[0021] In some preferred embodiments, the gene expression enhancing element is a sequence comprising 2 or more ATAAA, preferably 3 or more ATAAA, more preferably 5 or more ATAAA, such as a sequence comprising 5 ATAAA (AT-rich-1), such as a sequence comprising 7 ATAAA, such as a sequence comprising 10 ATAAA, such as a sequence comprising 20 ATAAA. The 2 or more ATAAA sequences can be separated by any one or more bases of A / C / T / G, it being understood that any one or more bases of A / C / T / G can be a plurality of bases of one of the bases, such as a plurality of A, a plurality of C, a plurality of T, a plurality of G, and of course, any one or more bases of A / C / T / G can be a plurality of bases of two or more of the bases.

[0022] In some preferred embodiments, the gene expression enhancing element is a sequence comprising 2 or more TTAAA, preferably 3 or more TTAAA, more preferably 5 or more TTAAA, such as a sequence comprising 5 TTAAA (AT-rich-2), such as a sequence comprising 7 TTAAA, such as a sequence comprising 10 TTAAA, such as a sequence comprising 20 TTAAA. The 2 or more TTAAA sequences can be separated by any one or more bases of A / C / T / G, it being understood that any one or more bases of A / C / T / G can be a plurality of bases of one of the bases, such as a plurality of A, a plurality of C, a plurality of T, a plurality of G, and of course, any one or more bases of A / C / T / G can be a plurality of bases of two or more of the bases.

[0023] In some preferred embodiments, the gene expression enhancing element is a sequence comprising two or more ATAAA and TTAAA, for example, the tandem of ATAAA and TTAAA includes any number, order, etc. of combinations of one or more ATAAA and one or more TTAAA, including, for example, a tandem of one TTAAA and one ATAAA and repeating one or more such combinations (e.g., a tandem of one TTAAA and one ATAAA and repeating five such combinations, as in AT-rich-4), and further including, for example, a tandem of one TTAAA and multiple ATAAA and optionally, further in tandem with one or more TTAAA (e.g., a tandem of one TTAAA and five ATAAA and, further in tandem with one TTAAA, as in AT-rich-3 or 123 bp), and further optionally, further in tandem with one or more ATAAA and repeating in this alternating order (e.g., a tandem of one TTAAA and five ATAAA and, further in tandem with two TTAAA, further in tandem with one ATAAA, further in tandem with one TTAAA, as in 364 bp), and further including, for example, any combination of the above. It should be understood that ATAAA and TTAAA can be arbitrarily replaced in the above combinations. The sequences can be separated by any one or more of A / C / T / G, and it should be understood that any one or more of A / C / T / G can be multiple of that base, e.g., multiple A, multiple C, multiple T, multiple G, and of course, any one or more of A / C / T / G can be multiple of two or more of those bases.

[0024] Preferably, the gene expression enhancing element is one of the following nucleotide sequences:

[0025] 123 bp:

[0026] TTAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCACTATACATACAGAACATATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAA

[0027] AT-rich-1 : ATAAACATAAACATAAACATAAACATAAA

[0028] AT-rich-2: TTAAACTTAAACTTAAACTTAAACTTAAA

[0029] AT-rich-3: TTAAACATAAACATAAACATAAACATAAACATAAACTTAAA

[0030] AT-rich-4: TTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAA;

[0031] 364bp:

[0032] TTAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCACTATACATACAGAACATATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAAATAATAGAAAATATAATTTCAAAATTCAAAAAAGTTACTGCAGTAAATATTTATTTACTTCAGTAAAAATAATCGGGTGAAATTTATTTCACTTGAGATGAATTGTCCACCAATGTCTCCAATTGAATCGGTGGACATTGGTGACATTAATTTTATGACGATAATACCCCTCATTTAAAACTAACAGGCGCGTCGCAGTGCGCTGATAAAGCTGTCGGAACTACTTTCCCAAATCTTAAAA;

[0033] sequences identical to ATAAA and TTAAA in the above sequences (e.g. replacing all or part of the spacer bases C in AT-rich-1, AT-rich-2, AT-rich-3, AT-rich-4 with any one or more of the spacer bases A / T / G);

[0034] or

[0035] sequences having at least 80% or more sequence identity to the above sequences, e.g. 85% or more, 90% or more, 95% or more, 98% or more sequence identity.

[0036] For example, in some preferred embodiments, the gene expression enhancing element can also be one of the following nucleotide sequences:

[0037] AT-rich-1-m: ATAAAGATAAAGATAAAGATAAAGATAAA

[0038] AT-rich-2-m: TTAAAGTTAAAGTTAAAGTTAAAGTTAAA

[0039] AT-rich-3-m: TTAAAGATAAAGATAAAGATAAAGATAAAGTTAAA

[0040] AT-rich-4-m: TTAAAGATAAAGTTAAAGATAAAGTTAAAGATAAAGTTAAAGATAAAGTTAAAGATAAA.

[0041] Such sequences are obtained by replacing all of the spacer bases C in AT-rich- 1, AT-rich-2, AT-rich-3, AT-rich-4 with spacer bases G.

[0042] Likewise, replacing some of the spacer bases C in AT-rich-1, AT-rich-2, AT-rich-3, AT-rich-4 with spacer bases G; or replacing all or some of the spacer bases C in AT-rich-1, AT-rich-2, AT-rich-3, AT-rich-4 with A or T; or replacing all or some of the spacer bases C in AT-rich-1, AT-rich-2, AT-rich-3, AT-rich-4 with one or more of A / T / G; such sequences can also function as gene expression enhancer elements to enhance gene expression.

[0043] It should be understood that, as can be seen from the examples of the present application, the selection of the spacer bases in the tandem ATAAA and / or TTA AA, and the length of the bases, do not adversely affect the enhancing effect of the expression enhancer sequences on gene expression.

[0044] It should be understood that, in the present application, the gene expression enhancer elements, in addition to the enhancer sequences, can also comprise any other sequences upstream and downstream of the enhancer sequences. As can be seen from the examples of the present application, the length or the selection of the bases of any other sequences upstream and downstream of the enhancer sequences do not adversely affect the enhancing effect of the gene expression enhancer elements on gene expression.

[0045] In some embodiments, the gene expression enhancer elements comprise the above-mentioned enhancer sequences, and other sequences.

[0046] Preferably, the gene expression enhancer elements are one of the following nucleotide sequences:

[0047] 262bp:

[0048] CTCGATGAACAGCGTAGGGGGTGGCCCGGAGGGGTTACGAAGCGTGTTCATTGACCGTGTTGTTGTCTCATAAGTCTTGAATAATTATTTTTAATAATTATTCATGTTAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCACTATACATACAGAACATATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAAATAATAGAAAATATAATTTCAAAATTCAAAAAA

[0049] SBG51 sequence or a part thereof, the SBG51 sequence is shown as SEQ ID NO. 1;

[0050] a sequence identical to ATAAA and TTAAA in the above sequences;

[0051] or

[0052] a sequence having at least 80% sequence identity, for example, 85%, 90%, 95%, 98% sequence identity to the above sequences.

[0053] Preferably, the SBG51 part comprises:

[0054] position 383 - position 642 of the SBG51 sequence (SCR region);

[0055] or position 110 - position 328 of the SBG51 sequence (A-Rich region).

[0056] In a second aspect, the present application provides a gene expression module for enhancing gene expression, which is obtained by inserting one or more expression enhancing elements of the first aspect of the present application downstream of the terminator of a gene expression module.

[0057] The gene expression module comprises one or more promoters, one or more coding sequences, and one or more terminators.

[0058] The gene expression module for enhancing gene expression comprises one or more promoters, one or more coding sequences, one or more terminators, and one or more expression enhancing elements of the first aspect of the present application downstream of the terminator.

[0059] In the present application, it has been confirmed that the expression enhancer element exerts a gene expression enhancing effect independently of the promoter and terminator, and the expression enhancer element can exert a gene expression enhancing effect in cooperation with various promoters, such as promoters from plants, viruses, etc., for example, the 35s promoter from the plant virus cauliflower mosaic virus (CaMV), the Arabidopsis UBQ10 promoter (ubiquitin 10 gene promoter), the Arabidopsis FLOWERING LOCUS T (FT) promoter, the Arabidopsis TOO MANY MOUTHS (TMM) promoter, the yeast mini promoter (pHISmini), all of which have been confirmed in the present application to cooperate well. In addition to these, other promoters, such as the actin promoter, which is a constitutive promoter in plants, the simian virus 40 early (SV40) promoter, the cytomegalovirus (CMV) promoter, etc., in animals, can all cooperate with the expression enhancer element in the present application to exert an effect.

[0060] Likewise, the expression enhancer element in the present application can also cooperate with various terminators, such as terminators from plants, viruses, etc., to exert a gene expression enhancing effect. For example, the most commonly used terminators, the NOS terminator of the nopaline synthase gene of Agrobacterium tumefaciens and the OCS terminator of the octopine synthase gene, the terminator of the HIS3 gene (TminiHIS3), all of which have been confirmed in the present application to cooperate well. In addition to these, other terminators, such as the Arabidopsis heat shock protein 18.2 (HSP) terminator, the tobacco extension protein gene terminator, etc., can all cooperate with the expression enhancer element in the present application to exert an effect.

[0061] In the present application, the gene expression module exerts an effect in eukaryotes, including plants, fungi, preferably the fungi are preferably yeast or Trichoderma, for example, in Arabidopsis, tobacco, corn, rice, petunia, oilseed rape, lettuce, soybean, poplar leaves, tomato fruits, etc.

[0062] In the present application, the gene expression module exerts a gene expression enhancing effect in the gene expression of eukaryotic genomes.

[0063] In the present application, the gene expression module exerts a gene expression enhancing effect when integrated into the genome.

[0064] In a third aspect, the present application provides an expression vector comprising one or more of the above-mentioned gene expression modules.

[0065] The expression vector can be an expression vector that can be expressed in fungal or plant, mammalian cells, preferably the fungi are preferably yeast or Trichoderma.

[0066] In a fourth aspect, the present application provides a method for enhancing gene expression, which is to insert the above-mentioned gene expression enhancing element downstream of the terminator of the expression cassette and transfer it into the host.

[0067] The host can be various plants, animals and microbial cells. The microorganism is preferably a fungus, preferably the fungus is preferably a yeast or a Trichoderma. The animal is preferably a mammal. The plants include Arabidopsis, tobacco, corn, rice, corn, petunia, rape, lettuce, soybean, poplar leaves, tomato fruits.

[0068] In a fifth aspect, the present application provides the use of the above-mentioned gene expression enhancer element or gene expression module or expression vector in Agrobacterium-mediated transient expression of tobacco.

[0069] In a sixth aspect, the present application provides the use of the above-mentioned gene expression enhancer element or gene expression module or expression vector in enhancing gene expression.

[0070] In a seventh aspect, the present application provides the use of the above-mentioned gene expression enhancer element or gene expression module or expression vector in gene function research.

[0071] In an eighth aspect, the present application provides the use of the above-mentioned gene expression enhancer element or gene expression module or expression vector in species improvement.

[0072] In a ninth aspect, the present application provides the use of the above-mentioned gene expression enhancer element or gene expression module or expression vector in the preparation of a gene or protein drug.

[0073] The present application finds the gene expression enhancer elements "ATAAA" and "TTAAA", which are inserted into the downstream of the terminator of the gene expression module of the binary vector in a certain number of tandem repeats, so as to obtain a super-expression vector, and significantly enhance the gene expression.

[0074] The gene expression enhancer element provided by the present application can achieve the following beneficial effects:

[0075] (1) Realize sustained and long-acting gene expression enhancement;

[0076] (2) The effect of gene enhancement is significantly efficient, which can achieve more than 3 times of expression increase, and even 30 times of expression increase;

[0077] (3) It also has a significant enhancement effect on low expression level genes or proteins;

[0078] (4) Wide applicability, independent gene expression enhancement effect with promoters and terminators, can cooperate with various promoters and terminators to achieve the effect;

[0079] (5) In the case of realizing the effect of gene expression enhancement, the space and time mode of the promoter is also maintained.

[0080] The gene expression enhancer element provided by the present application can be used for:

[0081] (1) Study the function of genes: By increasing the expression of genes, the function of genes, especially low-expression genes, can be further studied. For low-expression genes, their function is often difficult to study due to their low expression. By enhancing their expression, especially in this application, the expression can be increased by more than 30 times, which can realize the function research of these low-expression genes.

[0082] (2) For recombinant protein production: By increasing the expression efficiency of genes, the yield of recombinant proteins is increased, and the production efficiency and quality of recombinant proteins are improved, which brings significant economic and social benefits to industrial production. For example, in the food industry, cellulase obtained by gene recombination technology can be used for food processing, and the yield and quality of cellulase can be improved by the gene expression enhancer of the application, so as to better decompose cellulose in food and increase the taste and nutritional value of food. In the textile industry, recombinant proteins also play an important role, especially in dye production. Through the gene expression enhancer, the performance of dyes can be optimized, and the quality of textiles can be improved.

[0083] (3) For the production of therapeutic proteins and vaccines in the field of biology and medicine: On the one hand, the research progress of gene expression regulation mechanism provides a new way for disease treatment in the field of biology and medicine. By understanding and controlling the process of gene expression, scientists can develop more effective treatment methods by in-depth study of gene expression and regulation mechanism. On the other hand, by increasing the expression level of genes and the synthesis amount of functional gene products, the production efficiency of therapeutic proteins and vaccines in the field of medicine is realized. For example, by enhancing the expression of specific genes, the yield and quality of biological drugs such as therapeutic proteins and vaccines can be increased, which is crucial for the production of vaccines and other therapeutic proteins. This not only provides a new way for disease treatment, but also opens up new possibilities for future medical research and development.

[0084] (4) Improved breeding: Under the condition of basically not changing the organization and space-time specificity, the expression amount of target genes is increased to different degrees, so as to realize the purpose of molecular genetic improvement of crops.

[0085] (5) The expression amount of genes can be enhanced, the editing efficiency of genes can be enhanced, the expression amount of gene transcription proteins can be enhanced, the transcription effect of promoters or target sequences can be improved, the silencing of genes can be enhanced, or target genes can be knocked out, so as to increase the activity of target genes to the required level, and a new way is provided for optimizing expression vectors and accurately controlling gene expression in synthetic biology, botany / medicine (such as research on anti-inflammatory, antibacterial, and antitumor drugs) / protein or enzyme research. BRIEF DESCRIPTION OF DRAWINGS

[0086] Figure 1 Gene expression enhancement effects of four gene expression enhancing elements

[0087] Figure 2 Enhanced gene expression at 123bp, 262bp, and 364bp in the SBG51 sequence.

[0088] Figure 3 Gene expression enhancement effect of SBG51 sequence

[0089] Figure 4 SBG51 full sequence

[0090] Figure 5 Gene expression enhancement effects of gene expression enhancing elements composed of certain parts of the SBG51 sequence (SCR region and A-rich region).

[0091] Figure 6 The gene expression enhancing element described in this application enhances the gene expression of the low-expressed protein AtPHOT1.

[0092] Figure 7 The SBG51 sequence maintains the spatiotemporal specificity of gene expression modules.

[0093] Figure 8 The gene expression enhancement effect of the gene expression enhancing element (SBG51) at different insertion sites in this application.

[0094] Figure 9 The gene expression enhancement effect of the gene expression enhancing element (123 bp) at different insertion sites in this application.

[0095] Figure 10 The gene expression enhancement effect of the gene expression enhancing element (AT-rich-4) in this application in various plants.

[0096] Figure 11 The gene expression enhancement effect of the gene expression enhancing element (AT-rich-4) in yeast as described in this application.

[0097] Figure 12 The gene expression enhancing element (AT-rich-4) of this application enhances gene expression in animal cells.

[0098] Figure 13 The gene expression enhancement effect of the gene expression enhancing elements (α-AT, β-AT-1 and β-AT-2) in tobacco as described in this application. Detailed implementation method:

[0099] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0100] Gene expression enhancement effect of four gene expression enhancement elements

[0101] The 35S promoter (GenBank: MT611510.1), the GFP reporter gene (GenBank: E17099.1) and the octopine terminator (Ocs-T: Ocs terminator, GenBank: V00088.1, 1439-1629) were combined to form a 35S-GFP-OcsT expression module (abbreviated as 35S-GFP).

[0102] Four gene expression enhancement elements (AT-rich-1, AT-rich-2, AT-rich-3 and AT-rich-4) were obtained by concatenating different numbers of “ATAAA” or “TTAAA” elements, and they were inserted into the Hind III enzyme cutting site downstream of the 35S-GFP-OcsT expression module to obtain overexpression vectors (p35S-GFP-AT-rich-1, p35S-GFP-AT-rich-2, p35S-GFP-AT-rich-3 and p35S-GFP-AT-rich-4). Figure 1 a and b) Through conventional Agrobacterium-mediated tobacco transient expression experiments, GFP fluorescence was observed with a handheld ultraviolet lamp at 2 days (2 dpi, day post-inoculation) and 4 days after Agrobacterium infection. Compared with the 35S-GFP-OcsT control group (without inserting gene expression enhancement elements), all AT-rich fragments can enhance GFP fluorescence at different levels, including transcription and protein levels (a) and (b). Figure 1 c-e).

[0103] It can be seen that AT-rich-1 (ATAAACATAAACATAAACATAAACATAAA) and AT-rich-2 (TTAAACTTAAACTTAAACTTAAACTTAAA) contain 5 repeated AT-rich elements, and the GFP transcription in the sample is 3.5 times higher than that of the control ( Figure 1 d). The GFP transcription rate of the AT-rich-3 sample containing 7 repeated AT elements (TTAAACATAAACATAAACATAAACATAAACATAAACTTAAA) is 6.0 times higher, and the GFP transcription rate of the AT-rich-4 sample containing 10 repeated AT-rich elements (TTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACAT AAACTTAAA) is 7.0 times higher ( Figure 1 d).

[0104] The results show that the gene expression enhancer elements composed of "ATAAA" and "TTAAA" in series (AT-rich-1 and AT-rich-2) or "ATAAA" and "TTAAA" in spaced series (AT-rich-3 and AT-rich-4) exhibit a significant gene transcription enhancement effect of more than 3 times, and more AT elements can show stronger gene transcription enhancement effect, and the number of repeated "ATAAA" and "TTAAA" elements can control the level of gene transcription enhancement.

[0105] Example 2 Gene expression enhancement effect of more three gene expression enhancer elements (123 bp, 262 bp and 364 bp)

[0106] The 262 bp region (CTCGATGAACAGCGTAGGGGGTGGCCCGGAGGGGTTACGAAGCGGTTCATTGACCGTGTTGTTGTCTCATAAGTCTTGAATAATTATTTTTAATAATTATTCATGTTAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCACTATACATACAGAACATATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAAATAATAGAAAATATAATTTCAAAATTCAAAAAA) and the 123 bp region (TTAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCACTATACATACAGAACATATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAA) in the SBG51 sequence contain seven "ATAAA" or "TTAAA" elements Figure 2a), in addition, the 364 bp region (TTAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCACTATACATACAGAACA TATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAAATAATAGAAAATATAATTTCAAAATTCAAAAAAGTTACTGCAGTAAATATTTATTTACTTCAGTAAAAATAATCGGGTGAAATTTATTTCACTTGAGATGAATTGTCCACCAATGTCTCCAATTGAATCGGTGGACATTGGTGACATTAATTTTATGACGATAATACCCCTCATTTAAAACTAACAGGCGCGTCGCAGTGCGCTGATAAAGCTGTCGGAACTACTTTCCCAAATCTTAAAA) contains 10 "ATAAA" or "TTAAA" elements Figure 2 a). Three DNA fragments were inserted into the Hindlll site downstream of the 35S-GFP-OcsT expression module to obtain 35S-GFP-262 bp, 35S-GFP-123 bp and 35S-GFP-364 bp overexpression vectors, respectively Figure 2 b). By conventional Agrobacterium-mediated tobacco transient expression experiments, 35S-GFP-262 bp, 35S-GFP-123 bp and 35S-GFP-364 bp fully enhanced the GFP transcription and protein level, which were observed by hand-held UV lamp at 2 days (2 dpi, day post-inoculation) and 4 days after Agrobacterium infection Figure 2 c-e). The 364 bp region containing 10 elements showed the strongest effect among the three gene expression enhancer elements Figure 2 c-e).

[0107] The above results show that the gene expression enhancer element including multiple "ATAAA" and "TTAAA" tandem repeats can exert a gene expression enhancement effect, even if the spacer sequence includes more than tens of base sequences, or other sequences are included in front of the gene expression enhancement sequence, such a gene expression enhancement element can still exert a gene expression enhancement effect.

[0108] Example 3 Gene expression enhancement effect of more three gene expression enhancer elements (SCR region and A-rich region, SBG51 all)

[0109] As Figure 3As shown in Figure a, we inserted the UBQ10-GFP-Nos T (hereinafter referred to as GFP) expression module, composed of the Arabidopsis thaliana UBQ10 promoter (GenBank: ON111458.1), GFP reporter gene (GenBank: E17099.1), and nopaline terminator (GenBank: MK078637.1), into the binary vector pCAMBIA1300 to obtain the plant expression vector GFP (Zhang Y., Lyu, S., Hu, Z., Yang, X., Zhu, H. and Deng, S. (2023) Identification and functional characterization of the SUMO system in sweet potato under salt and drought stress. Plant Science 330, 111645). At the HindIII restriction site downstream of the GFP vector expression module, we inserted... Figure 4 The SBG51 sequence (nucleotide sequence shown in SEQ ID NO.1) was used to obtain the SBG51-GFP overexpression vector. Using a standard Agrobacterium-mediated transient expression assay in tobacco, GF P fluorescence was observed using a handheld UV lamp at 2 days (2 dpi, day post-inoculation) and 4 days after Agrobacterium infection. Compared to the control GFP vector (without the SBG51 sequence inserted), the GFP fluorescence pattern of the SBG51-GFP sample was significantly enhanced. Figure 3 b). qPCR analysis revealed that, 2 days after infection (2 dpi), compared to the control GFP sample, the transcription of the GFP gene in the SBG51-GFP sample was significantly increased by 6.6 times. Figure 3 c). Due to post-transcriptional gene silencing (PTGS), the protein in the control GFP sample, as detected by Western blotting, had completely disappeared 6 days after infection (6 dpi), while the fluorescence of the SBG51-GFP sample was still detectable 8 days after infection (8 dpi). Figure 3 d).

[0110] The SBG51 sequence contains 662 bases. Positions 643-12 form a stem-loop structure; positions 110-328 are an A-rich region; positions 354-379 form a secondary stem-loop structure; and positions 383-642 constitute the SC R region. Figure 5As shown, the SBG51 vector was shortened in a similar way, and the DNA sequences necessary for the expression enhancement effect in the SBG51 vector were analyzed Figure 5 a). In the SBG51-Δ1-GFP construct, the stem loop, satellite conserved region (SCR) and secondary stem loop were deleted, but the A-rich region was retained. In the SBG51-Δ2-GFP construct, the A-rich region and the secondary stem loop were deleted, but the stem loop and SCR were retained. In the SBG51-Δ3-GFP construct, only the stem loop and the sequence between the MCS and the A-rich region were retained. Interestingly, GFP fluorescence, gene expression and protein levels showed that SBG51-Δ1-GFP and SBG51-Δ2-GFP had similar effects on gene expression as SBG51-GFP, but SBG51-Δ3-GFP had only a slight effect Figure 5 b-d). This result indicates that both the SCR region and the A-rich region have expression enhancement effects, but the stem loop is not necessary.

[0111] Example 4 also has an enhancement effect on low expression proteins

[0112] The AtPHOT1 gene is 2988 bp long and translates into a protein of 996 amino acids. This large molecular weight protein is usually expressed at a very low level in the tobacco transient expression system.

[0113] As Figure 6 shown, we inserted AtPHOT1 (Arabidopsis thaliana photoreceptor protein gene, GenBank: AY040062.1) into the upstream of the GFP gene in the GFP expression module (same as the plant expression vector GFP carrier in Example 3) and the SBG51-GFP expression module (same as the SBG51-GFP overexpression vector in Example 3) as shown in Figure 3 a, respectively, to obtain expression vectors that can express AtPHOT1-GFP fusion proteins, namely UBQ10-AtPHOT1-GFP and SBG51-UBQ10-AtPHOT1-GFP. Through conventional Agrobacterium-mediated tobacco transient expression experiments, the AtPHOT1-GFP protein level was detected at 2 days (2 dpi), 6 days (6 dpi) and 8 days (8 dpi) after Agrobacterium infection. Without the expression enhancement of the SBG51 sequence, AtPHOT1 was difficult to detect in the tobacco transient expression system, while SBG51 could significantly enhance the AtPHOT1-GFP protein level Figure 6 ).

[0114] This example shows that the gene expression enhancement element of the application can significantly enhance the expression level of large molecular weight, low expression proteins.

[0115] Example 5 Different promoters and terminators do not affect the effect of the gene expression enhancing element of the present application

[0116] Based on Example 2, we still used the SBG51 sequence as the gene expression enhancing element, and replaced the Arabidopsis UBQ10 promoter (GenBank: ON111458.1) and nopaline terminator (GenBank: MK078637.1). The specific process is as follows: Figure 3 e, we inserted the 35S promoter (GenBank: MT611510.1), GFP reporter gene (GenBank: E17099.1) and octopine terminator (Ocs-T: Ocs terminator, GenBank: V00088.1, 1439-1629) into the binary vector pCAMBIA1300 to obtain the plant expression vector 35S-GFP vector. The SBG51 sequence (nucleotide sequence as shown in SEQ ID NO. 1) was inserted into the Hind III enzyme cutting site downstream of the expression module of the 35S-GFP vector as shown in Figure 4 The SBG51-35S-GFP overexpression vector was obtained. Through the conventional Agrobacterium-mediated tobacco transient expression experiment, the GFP fluorescence was observed with a handheld ultraviolet lamp at 2 days (2 dpi, day post-inoculation) and 4 days after Agrobacterium infection. Compared with the control 35S-GFP vector, the GFP fluorescence of the SBG51-35S-GFP sample was significantly enhanced Figure 3 f) Compared with 35S-GFP, the gene transcription of SBG51-35S-GFP was enhanced by 30.6 times Figure 3 g), SBG51-35S-GFP also accumulated more GFP protein Figure 3 h).

[0117] From the results of this example, it can be seen that the DNA sequence based on SBG51 works well with UBQ10 promoter, 35S promoter, NOS terminator and OCS terminator. This shows that the gene enhancing element of the present application is independent of the promoter and terminator, and can cooperate with various promoters and terminators to play the gene enhancing effect.

[0118] Example 6 Gene expression enhancing element does not affect the space and time expression pattern of the promoter itself

[0119] As shown in Figure 7As shown in Figure a, we replaced the UBQ10 promoter in the plant expression vector GFP in Example 3 with the promoter of the Arabidopsis FT gene (nucleotide sequence as shown in SEQ ID NO.2, Adrian J., Farrona S., Reimer JJ, Albani MC, Coupland G. and Turck F. cis-Regulatory elements and chromatin state coordinately control temporal and spatial expression of FLOWERING LOCUS T in Arabidopsis. Plant Cell 2010 22(5):1425-1440.) and the promoter of the TMM gene (nucleotide sequence as shown in SEQ ID NO.3, Nadeau JA and Sack FD Control of stomatal distribution on the Arabidopsis leaf surface. Science 2002 296(5573):1697-1700.) to obtain pFT-GFP-NosT (hereinafter referred to as pFT-GFP) and pTMM-GFP-NosT, respectively. T (hereinafter referred to as pTMM-GFP). FT promoter activity exhibits circadian rhythms, while the TMM promoter is expressed only in stomatal cells. Figure 7 As shown, at the Hind III restriction site downstream of the expression module, an insertion is made as follows: Figure 4 The SBG51 sequence shown (nucleotide sequence as shown in SEQ ID NO. 1) was used to obtain SBG51-pFT-GFP and SBG51-pTMM-GFP overexpression vectors, respectively. Transgenic Arabidopsis thaliana was constructed using these vectors via conventional Agrobacterium-mediated transformation. GFP gene transcription in six independent lines of each genotype was analyzed by qPCR. Although there were significant differences in gene expression among different lines, the SBG51 overexpression vector generally increased GFP transcription by 2–3 times compared to the control genotype. Figure 7 b). Furthermore, in SBG51-pFT-GFP transgenic plants, the temporal expression pattern controlled by the FT promoter was maintained ( Figure 7 c). SBG51-pTM M-GFP transgenic plants showed stronger fluorescence only in stomata than pTM M-GFP. Figure 7 d).

[0120] This example demonstrates that the SBG51 sequence can significantly enhance gene expression in stably transformed plants by stable transformation method, while maintaining the specificity of the spatial and temporal expression patterns of these promoters.

[0121] And it can also be seen from this example that replacing the promoter with the promoter of the FT gene of Arabidopsis thaliana and the promoter of the TMM gene does not affect the gene expression enhancing element of SBG51 of the present application, which also indicates that the gene enhancing element of the present application is independent of the promoter and terminator, and can cooperate with various promoters and terminators to achieve gene enhancement effect.

[0122] Example 7 Gene expression enhancing element works downstream of the terminator

[0123] We inserted a multiple cloning site (MCS: Multiple cloning site) into SBG51 to obtain SBG51-MCS, and inserted it into the binary vector pCAMBIA1300 to obtain the p1300-SBG51-MCS vector. There are four unique restriction enzyme sites (EcoRI, Kpnl / Xbal, BstEII and HindIII) in the p1300-SBG51-MCS vector. We inserted the UBQ10 promoter (UBQ10-p: UBQ10 promoter, GenBank: ON111458.1), GFP reporter gene (GFP, GenBank: E17099.1) and Nos terminator (Nos-T: Nos terminator GenBank: MK078637.1) into the above four sites to obtain the UBQ10-GFP-NosT expression module, respectively, and then inserted it into the p1300-SBG51-MCS vector to obtain SBG51-GFP-1, SBG51-GFP-2, SBG51-GFP-3, SBG51-GFP-4 Figure 8 a) Among them, SBG51-GFP-2 is the SBG51-GFP overexpression vector used in Figure 3 Conventional Agrobacterium-mediated tobacco transient expression experiments were performed, and GFP fluorescence was observed using a handheld UV lamp at 2 days (2 dpi) and 4 days (4 dpi) after Agrobacterium infection. qPCR was used to detect the expression level of GFP gene, and WB was used to detect the protein level of GFP. SBG51-GFP-1 and SBG51-GFP-2 vectors have gene expression enhancement effect, but SBG51-GFP-3 and SBG51-GFP-4 vectors have no effect Figure 8 b, c, d).

[0124] In addition, we inserted a 35S-GFP-OcsT expression module (hereinafter referred to as 35S-GFP) consisting of a 35S promoter (35S-p: 35S promoter, GenBank: MT611510.1), a GFP reporter gene (GFP, GenBank: E17099.1), and an Ocs terminator (Ocs-T: Ocs terminator, GenBank: V00088.1, 1439-1629) into a binary vector pCAMBIA1300 to obtain a plant expression vector 35S-GFP vector. We inserted a 123 bp region (TTAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCACTATACATACAGAACATATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAA) in SBG51 into the HindIII site downstream of the Ocs terminator and the SalI site upstream of the Ocs terminator, respectively, to obtain 35S-GFP-OcsT-123bp and 35S-GFP-123bp-OcsT expression vectors Figure 9 a) By conventional Agrobacterium-mediated tobacco transient expression experiments, GFP fluorescence was observed using a handheld ultraviolet lamp at 2 days (2 dpi) and 4 days (4 dpi) after Agrobacterium infection, and the expression level of the GFP gene was detected using qPCR, and the GFP protein level was detected using WB. When the 123 bp region was inserted between the GFP and the Ocs terminator, it had no positive effect on gene expression, but rather had an adverse effect Figure 9 b-d).

[0125] This example shows that the gene expression enhancer of the application acts on the promoter upstream and the terminator upstream of the expression module, and neither has an effect of enhancing gene expression. The gene expression enhancer of the application acts downstream of the terminator of the expression module, and plays an effect of enhancing gene expression.

[0126] Example 8 The gene expression enhancer can play an enhancing effect in various plants

[0127] RUBY reporter 3939 bp (GenBank: OQ653532.1, 253-4191), is a coupling of CYP76AD1, DOD A and GT three genes into an open reading frame, encoding large three enzymes catalyze the synthesis of betalains (He Y., Zhang, T., Sun, H., Zhan, H. and Zhao, Y. (2020) A reporter for noninvasively monitoring gene expression and plant transformation. Hortic Res 7, 152.). We inserted 35S-RUBY-OcsT expression module (35S promoter: 35S promoter, GenBank: MT611510.1; RUBY reporter: GenBank: OQ653532.1, 253-4191; Ocs terminator: Ocs terminator, GenBank: V00088.1, 1439-1629) into binary vector pCAMBIA1300 to obtain plant expression vector 35S-RUBY vector Figure 10 a, b). We inserted AT-rich-4 sequence into HindIII enzyme cutting site downstream of 35S-RUBY-OcsT expression module to obtain overexpression vector. Through conventional Agrobacterium-mediated transient expression experiment, we expressed RUBY gene in tobacco leaves, poplar leaves and tomato fruits respectively, and observed the accumulation of betalains in leaves and fruits. The results showed that AT-rich-4 sequence can significantly enhance the expression of RUBY, and make more betalains accumulate in leaves and fruits Figure 10 c-e).

[0128] This example shows that the gene expression enhancing element of the present application can enhance gene expression in various different plants including tobacco (Nicotiana benthamiana) leaves, poplar leaves and tomato fruits.

[0129] Example 9 The gene expression enhancing element can also play an enhancing effect in yeast

[0130] As Figure 11As shown, an AT-rich-4 (TTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAA) fragment was inserted into the BamHI site downstream of the expression module of the pHISi vector (from Clontech, K1603-1 yeast one-hybrid kit) to obtain an overexpression vector. The vector was integrated into the genome of yeast strain Y1HGold (from Clontech, 630491 yeast one-hybrid kit) using a conventional PEG-LiAc transformation method. Yeast growth was observed on media containing 0 mM, 5 mM, 15 mM, and 45 mM of 3-amino-1,2,4-triazole (3-AT) to assess the expression level of the HIS3 gene.

[0131] like Figure 11 As shown, the AT-rich-4 gene expression enhancing element of this application significantly enhances the expression of the HIS3 gene, thereby enabling yeast to grow well on high-concentration 3-AT medium.

[0132] As can be seen from this embodiment, the gene expression enhancing element of this application can also exert a gene enhancement effect in the yeast system. Furthermore, it can also be seen that the gene expression enhancing element of this application does not affect the gene enhancement effect when other promoters and terminators are replaced.

[0133] Example 10: Gene expression enhancing elements can also exert an enhancing effect in mammals.

[0134] like Figure 12 As shown, an AT-rich-4 (TTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAA) fragment was inserted into the BbsI site downstream of the expression module in the piggyBac CMV-GFP-FRT vector (Addgene, Plasmid#92078) to obtain an overexpression vector. The expression module was transfected into mammalian cells (human kidney epithelial cell line HEK293) using the PiggyBac vector system via conventional transfection methods and integrated into the genome. GFP expression levels were assessed by examining GFP intensity using flow cytometry. Figure 12 As shown in c, the gene expression enhancement element of the AT-rich-4 fragment rich in “ATA AA” and “TTAAA” elements can significantly enhance the expression of the GFP gene, thereby exhibiting higher GFP fluorescence intensity.

[0135] As can be seen from this embodiment, the gene expression enhancing element of this application can also exert a gene expression enhancing effect in mammals.

[0136] Example 11:

[0137] The 35S promoter (GenBank: MT611510.1), GFP reporter gene (GenBank: E17099.1) and octopine terminator (Ocs-T: Ocs terminator, GenBank: V00088.1, 1439-1629) were combined into a 35S-GFP-OcsT expression module (abbreviated as 35S-GFP-OcsT). We named the sequence of 1028-1361 bp region of the alpha satellite of Cotton leaf curl Multan virus (GenBank: MW816854.1) as a-AT, the sequence of 763-1025 bp region of the beta satellite of Tomato yellow leaf curl China virus (GenBank: AJ421621.1) as β-AT-1, and the reverse complement sequence of 169-209 region as β-AT-2. All of a-AT, β-AT-1 and β-AT-2 are rich in “ATAAA” or “TTAAA” elements.

[0138] We inserted the 35S-GFP-OcsT expression module into the binary vector pCAMBIA1300 to obtain an overexpression vector, and obtained the plant expression vector 35S-OcsT vector. We inserted a-AT, β-AT-1 and β-AT-2 into the HindIII enzyme cutting site downstream of the 35S-OcsT expression module, respectively, to obtain 35S-GFP-a-AT, 35S-GFP-β-AT-1, 35S-GFP-β-AT-2 (abbreviated as 35S-GFP-AT) expression vectors. Figure 13 a) Through conventional Agrobacterium-mediated tobacco transient expression experiments, GFP fluorescence was observed with a handheld ultraviolet lamp at 2 days post-inoculation (2 dpi) of Agrobacterium infection. Compared with the 35S-OcsT vector control group (without inserting gene expression enhancer elements, i.e. - in the figure), all AT-rich fragments can enhance GFP fluorescence at different levels, including transcription and protein levels (b-d). Figure 13 b-d).

Claims

1. A gene expression enhancing element, characterized by, The gene expression enhancer is any one of the following sequences: (1) ATAAA; (2) TTAAA; (3) tandem repeats of at least two ATAAA sequences; preferably three ATAAA sequences, more preferably five or more ATAAA sequences, such as five tandem ATAAA sequences, seven tandem ATAAA sequences, ten tandem ATAAA sequences, twenty tandem ATAAA sequences; (4) tandem repeats of at least two TTAAA sequences; preferably three or more TTAAA sequences, more preferably five or more TTAAA sequences, seven or more TTAAA sequences, ten or more TTAAA sequences; (5) a sequence formed by combining AT sequences with AA and TT sequences, respectively; (6) a sequence formed by combining TA sequences with AA and TT sequences, respectively; (7) a tandem repeat sequence containing at least two sequences as shown in (5) or (6); preferably three or more, more preferably five or more, such as five to fifty, five to thirty, five to twenty, ten to twenty; (8) a tandem repeat sequence containing at least two sequences as shown in (1) and / or (2); preferably three or more, more preferably five or more, such as five to fifty, five to thirty, five to twenty, ten to twenty; (9) an SBG51 sequence, an SCR region of an SBG51 sequence, an A-rich region of an SBG51 sequence, or an SBG51 fragment without a stem loop; wherein the SBG51 nucleotide sequence is shown in SEQ ID NO. 1, wherein the 643rd-12thposition is a stem loop, the 110th-328thposition is an A-rich region, and the 383rd-642ndposition is an SCR region; (10) the gene expression enhancer is a nucleotide sequence as shown below: TTAAAAAATAAAAAAATAAAACATAAA, and / or ATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAA, and / or TTAAAACTAACAGGCGCGTCGCAGTGCGCTGATAAAGCTGTCGGAACTACTTTCCCAAATCTTAAAA; (11) the gene expression enhancer is one of the following nucleotide sequences: A, AT-rich-1: ATAAACATAAACATAAACATAAACATAAA; B, AT-rich-2: TTAAACTTAAACTTAAACTTAAACTTAAA; C, AT-rich-3: TTAAACATAAACATAAACATAAACATAAACATAAACTTAAA; D, AT-rich-4: TTAAACATAAACTTAAACATAAACTTAAACATAAACTTAAACATAAAC TTAAACATAAA; E: at least 2, preferably 3-10, more preferably 5 or 7, consecutive nucleotide sequences comprising nucleotide sequences A, B, C and / or D, or the complement thereof; F, TAAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCACTATACATACAGAAC ATATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAA AGAAATTAAAA; G, sequence G comprising nucleotide sequence F, or the complement thereof; preferably, the sequence G is CTCGATGAACAG CGTAGGGGGTGGCCCGGAGGGGTTACGAAGCGTGTTCATTGACCGTGTTGTTGTCTCATAAGTCTTGAATAATTATTTTTAATAATTATTCATGTTAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCACTATACATACAGAACATATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAAATAATAGAAAATATAATTTCAAAATTCAAAAAA; H, sequence H comprising nucleotide sequence G, or the complement thereof; preferably, the sequence H is TAAAAAAATAAAAAAATAAAACATAAAGATGTCCAATCACTATACATACAGAACATATTGAAAAAAAAGAGGGAGCGCAGCGGAGAATAAAACAACAGAAATAAATGGAAAAAGAAATTAAAAATAATAGAAAATATAATTTCAAAATTCAAAAAAGTTACTGCAGTAAATATTTATTTACTTCAGTAAAAATAATCGGGTGAAATTTATTTCACTTGAGATGAATTGTCCACCAATGTCTCCAATTGAATCGGTGGACATTGGTGACATTAATTTTATGACGATAATACCCCTCATTTAAAACTAACAGGCGCGTCGCAGTGCGCTGATAAAGCTGTCGGAACTACTTTCCCAAATCTTAAAA; I, SBG51 sequence SBG51 sequence or a part thereof, the SBG51 sequence is shown as SEQ ID NO. 1; preferably, the SBG51 part comprises: 383-642 of the SBG51 sequence; or 110-328 of the SBG51 sequence; J, SBG51 sequence SBG51 sequence or a part thereof, the SBG51 sequence is shown as SEQ ID NO. 1; preferably, the SBG51 part comprises: 383-642 of the SBG51 sequence; or 110-328 of the SBG51 sequence; J. a region comprising an A-rich nucleotide sequence and / or an AT-rich nucleotide sequence and / or an AA-rich nucleotide sequence and / or a nucleotide sequence fragment without a stem loop in the nucleotide sequences A-I; preferably, the region comprising an A-rich nucleotide sequence and / or an AT-rich nucleotide sequence and / or an AA-rich nucleotide sequence has an adenine plus thymine content of at least 50% and a thymine content of at least 30%; K. the spacer base C in the sequences A-D, i.e. the sequences AT-rich-1, AT-rich-2, AT-rich-3, AT-rich-4, is replaced by at least one of the spacer bases A / T / G, in whole or in part; (12) a sequence having a sequence identity of at least 80% or more, for example 85% or more, 90% or more, 95% or more, 98% or more, to the sequences shown in (1) to (11).

2. The gene expression enhancing element according to claim 1, wherein The tandem repeats are tandem repeats of any one or more of the bases A / C / T / G; preferably, the plurality of bases can comprise any combination of one or at least two of the following: a plurality of A, a plurality of C, a plurality of T, a plurality of G, or a plurality of A / C / T / G.

3. A gene expression module for enhancing gene expression, characterized in that, is to insert the gene expression enhancer element of any one of claims 1-2 downstream of the terminator of the gene expression module, to obtain a gene expression module that enhances gene expression.

4. A gene expression module for enhancing gene expression, characterized in that, comprises: one or more promoters, a coding sequence of a target gene or a plurality of coding sequences of target genes fused together; one or more terminators; inserting the gene expression enhancer element of any one of claims 1-2 downstream of the terminator of the gene regulatory sequence.

5. The gene expression enhancement module of claim 3 or 4, wherein the promoter and / or the terminator is optionally from a plant, a virus; preferably, the promoter is selected from at least one of the following: a 35s promoter from plant virus Cauliflower mosaic virus (CaMV), an Arabidopsis UBQ10 promoter (ubiquitin 10 gene promoter), an Arabidopsis FLOWERING LOCUS T (FT) promoter, an Arabidopsis TOO MANY MOUTHS (TMM) promoter, a yeast mini promoter (pHISmini), a constitutive promoter in plants actin promoter, a monkey virus 40 early (SV40) promoter in animals, a cytomegalovirus (CMV) promoter; preferably, the terminator is selected from at least one of the following: a NOS terminator of the nopaline synthase gene of Agrobacterium tumefaciens, an OCS terminator of the octopine synthase gene, a terminator of the HIS3 gene (TminiHIS3), an Arabidopsis heat shock protein 18.2 (HSP) terminator, a terminator of the tobacco extensin gene.

6. Use of the gene expression enhancement module of claim 3 or 4 in eukaryotes, including plants, fungi, preferably the fungi are preferably yeast or Trichoderma, and preferably the plants include Arabidopsis, tobacco, maize, rice, corn, petunia, oilseed rape, lettuce, soybean, poplar leaves, tomato fruits; preferably, the gene expression module exerts a gene expression enhancement effect in gene expression in eukaryotic genomes; ​ ​ Preferably, the gene expression module exerts a gene expression enhancement effect when integrated into the genome.

7. A gene expression vector for enhancing gene expression, characterized by, The expression vector comprises one or more gene expression modules according to any one of claims 4-5; preferably, the expression vector is an expression vector for expression in fungal or mammalian cells, preferably the fungus is yeast or Trichoderma.

8. A method of enhancing gene expression, characterized by, The gene expression enhancement element according to any one of claims 1-2 is inserted downstream of the terminator of the expression vector and introduced into a host, preferably the host is a plant, an animal, and a microbial cell; preferably, the microbial cell is a fungus, preferably the fungus is yeast or Trichoderma; the animal is a mammal; the plant includes Arabidopsis thaliana, tobacco, corn, rice, corn, petunia, rape, lettuce, soybean, poplar leaves, tomato fruits.

9. The gene expression enhancement element according to any one of claims 1-2 or the gene expression module according to any one of claims 3-5 or the expression vector according to claim 7 is used in optimizing expression vectors and / or accurately controlling gene expression in synthetic biology, plant / medical / protein or enzymatic research, preferably Agrobacterium-mediated tobacco transient expression, enhancing gene expression, species improvement, and in the preparation of gene or protein drugs; preferably, the gene expression enhancement element or the gene expression module or the expression vector can enhance the expression of the nucleic acid sequence to be expressed or promote the expression of the nucleic acid sequence to be expressed by enhancing the silencing of the gene or improve the transcription effect of the promoter, for example, enhance the expression amount of the gene, enhance the expression of the gene sequence, enhance the editing efficiency of the gene, improve the expression amount of the protein, and the medical application is preferably in anti-inflammatory, antibacterial, and antitumor drugs.

10. A transgenic organism cell or use of a transgenic organism cell, said transgenic organism cell comprising the gene expression enhancer element of any one of claims 1-2 or the gene expression module of any one of claims 3-5 or the expression vector of claim 7, wherein, The transgenic microbial cell can be selected from fungi, preferably the fungus is yeast or Trichoderma, Escherichia coli, or Agrobacterium, or a mammal; wherein the transgenic biological cell is used for producing food, animal feed, seeds, propagation materials, drugs, or chemicals. The gene expression module is inserted into the genome of the host cell, preferably the host cell is a plant, an animal, and a microbial cell; preferably, the microbial cell is a fungus, preferably the fungus is yeast or Trichoderma; the animal is a mammal; the plant includes Arabidopsis thaliana, tobacco, corn, rice, corn, petunia, rape, lettuce, soybean, poplar leaves, tomato fruits.

Images