Related psbE gene for regulating pollen development and application thereof

Abstract

The invention relates to the technical field of agricultural biology, in particular to a related gene psbE for regulating pollen development and application thereof. According to the invention, a wheat photo-thermo-sensitive male sterile line BS366 is taken as an experimental material, a related gene psbE for regulating anther development is obtained and is introduced into arabidopsis thaliana, and a result shows that anther development is abnormal. The long-chain non-coding RNA for regulating anther development has very important theoretical and practical significance for improving plant varieties and shortening the crop harvesting period.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of agricultural biotechnology, in particular to a pollen development related gene psbE and its application. BACKGROUND

[0002] The alpha subunit protein of cytochrome b559 encoded by psbE gene is indirectly related to plant fertility. First, from the perspective of the interrelationship between photosynthesis and plant growth and development, photosystem II, as the core complex of photosynthesis, plays an irreplaceable role in the process of water photolysis and plastoquinone reduction. As an important component of photosystem II, cytochrome b559 not only participates in the protection and assembly of the complex, but also plays a key role in the process of cyclic electron transport, effectively preventing photosystem II from being damaged due to photoinhibition. Since photosynthesis provides the necessary energy and material basis for plant growth and development, and plant reproductive development, especially fertility-related processes, are highly dependent on sufficient energy and material supply, therefore, abnormal function of photosystem II may indirectly affect plant fertility by affecting the overall energy metabolism and material synthesis of the plant. Second, from the perspective of the regulation mechanism of plant fertility, plant fertility is complexly regulated by multiple factors such as gene expression, hormone balance, and metabolic pathways. The expression and function of photosystem II related proteins may affect the hormone balance and metabolic pathways in the plant, and thus regulate fertility. Previous studies have shown that changes in the expression of photosynthesis-related genes may affect the synthesis and signal transduction of plant hormones, and plant hormones play an important regulatory role in anther development, pollen formation, and fertilization, etc. Therefore, cytochrome b559 may indirectly affect the fertility performance of plants through these regulatory mechanisms. However, the function of the gene in fertility has not been clearly determined, and the present application aims to regulate the function of the gene in fertility. SUMMARY

[0003] The present application aims to provide a pollen development related gene.

[0004] The present application further aims to provide the application of the above-mentioned pollen development related gene.

[0005] The present application further aims to provide a recombinant expression vector comprising the above-mentioned pollen development related gene.

[0006] The present application further aims to provide a recombinant strain comprising the above-mentioned pollen development related gene.

[0007] The present application aims to provide the application of psbE for regulating pollen development.

[0008] The pollen development related gene psbE provided by the application is derived from a wheat photoperiodic male sterile line BS366, and the amino acid sequence is as shown in SEQ ID NO: 1.

[0009] ATGTCTGGAAGCACGGGAGAACGTTCTTTTGCTGATATTATTACCAGTATTCGATACTGGGTTATTCATAGCATTACTATACCTTCCCTATTCATTGCGGGTTGGTTATTTGTCAGTACGGGTTTAGCTTATGACGTGTTTGGAAGTCCTAGGCCAAACGAGTATTTCACGGAAAGCCGACAAGGAATTCCGTTAATAACCGACCGTTTTGATTCTTTAGAACAACTCGATGAATTTAGTAGATCCTTTTAG.

[0010] According to the specific embodiments of the application, the recombinant expression vector containing psbE is constructed by using existing plant expression vectors. The plant expression vectors include binary expression vector systems and vectors that can be used for plant microprojectile bombardment. The plant expression vectors can also comprise the 3' untranslated region of the foreign gene, i.e. a polyadenylation signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylation signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor, such as the Ti plasmid gene induced by Agrobacterium crown gall (such as the Nos gene of nopaline synthase) and the untranslated region of the 3' end of the plant gene transcription.

[0011] When constructing the plant recombinant expression vector, any kind of enhanced promoter or constitutive promoter can be added before the transcription initiation nucleotide, such as the cauliflower mosaic virus (CaMV) 35S promoter, the ubiquitin promoter of corn, which can be used alone or in combination with other plant promoters; in addition, enhancers can also be used, including translation enhancers or transcription enhancers, and these enhancer regions can be the ATG initiation codon or the adjacent region initiation codon, but must be the same reading frame as the coding sequence to ensure correct translation of the entire sequence.

[0012] The above-mentioned recombinant expression vector containing psbE is introduced into plant cells. The expression vector carrying the coding gene can be transformed into plant cells or tissues by using Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated transformation, and other conventional biological methods, and the transformed plant tissue is cultivated into a plant. The transformed plant host can be a monocotyledon or a dicotyledon, such as tobacco, wheat, Thinopyrum ponticum, Arabidopsis thaliana, rice, corn, cucumber, tomato, poplar, lawn grass, alfalfa, etc.

[0013] In order to facilitate the identification and screening of the transgenic plant cells or plants, the plant expression vector used can be processed, such as adding a gene (GUS gene, luciferase gene, etc.) encoding an enzyme or a luminescent compound that can produce a color change, a resistant antibiotic marker (hygromycin marker, kanamycin marker, etc.), and the like, which can be expressed in plants. For the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened under stress.

[0014] The gene psbE is screened from the anthers of wheat photoperiod-sensitive male sterile line BS366 under different fertility conditions, and experiments show that the gene may indirectly affect plant fertility through the following pathways: 1) photosynthesis provides energy and carbon skeleton for reproductive organ development, and abnormal function of psbE may lead to a decrease in photosynthetic efficiency, thereby affecting pollen germination and fertilization; 2) cytochrome b559 is involved in the structural stability of PSII and light damage repair, and its defects may cause oxidative stress to damage the tapetum or pollen structure; 3) the photosystem may be cooperatively regulated with the photoperiod signal pathway to regulate flowering time. The current research analyzes the fertility regulation function through mutant analysis, omics data mining and light oxidative stress response mechanism, and provides a theoretical basis for the coordinated improvement of crop light energy utilization and fertility. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 PCR amplified fragments of the psbE gene related to regulating flowering are shown;

[0016] Figure 2 PCR amplified screening positive sample results of the psbE gene related to regulating flowering are shown;

[0017] Figure 3 Inflorescences of Arabidopsis thaliana are infected with Agrobacterium to obtain T1 generation seeds of transgenic Arabidopsis thaliana;

[0018] Figure 4 T2 generation strain expression results of transgenic Arabidopsis thaliana are shown, wherein WT is wild-type Arabidopsis thaliana;

[0019] Figure 5 Pollen Alexander staining results of transgenic Arabidopsis thaliana are shown, wherein WT is wild-type Arabidopsis thaliana;

[0020] Figure 6 Pollen scanning electron microscope pictures of transgenic Arabidopsis thaliana are shown, wherein WT is wild-type Arabidopsis thaliana;

[0021] Figure 7 Microscopic observation of flower phenotypes of transgenic Arabidopsis thaliana is shown, wherein WT is wild-type Arabidopsis thaliana;

[0022] Figure 8Microscopic observation of DAB staining of small flowers of transgenic Arabidopsis thaliana, wherein WT is wild-type Arabidopsis thaliana;

[0023] Figure 9 Microscopic observation of NBT staining of small flowers of transgenic Arabidopsis thaliana, wherein WT is wild-type Arabidopsis thaliana;

[0024] Figure 10 Display of plant phenotype and fruit pod phenotype of transgenic Arabidopsis thaliana, wherein WT is wild-type Arabidopsis thaliana;

[0025] Figure 11 Display of seed setting rate investigation of transgenic Arabidopsis thaliana, wherein WT is wild-type Arabidopsis thaliana. DETAILED DESCRIPTION

[0026] In the following examples, the molecular biology experimental methods not specifically explained are carried out according to the specific methods listed in the book of Molecular Cloning Experiment Guide (third edition) by J. Sambrook or according to the instructions of the kit and product.

[0027] The following examples facilitate better understanding of the present application, but do not limit the present application.

[0028] Example 1: Cloning of psbE gene and sequence motif analysis

[0029] Leaves of wheat photoperiod-sensitive male sterile line BS366 were taken, and total RNA of anther was extracted by Trizol method. cDNA was obtained by reverse transcription using superscript II reverse transcriptase. Primer 1 was designed according to the coding region sequence of psbE gene. The reverse-transcribed cDNA was used as a template, and primer 1 was used for PCR amplification. The sequence of primer 1 is as follows:

[0030] Primer 1:

[0031] 5'-ATGTCTGGAAGCACGGGAGAACG-3',

[0032] 5'-CTAAAAGGATCTACTAAATTCATC-3'.

[0033] The PCR product was detected by 1% agarose gel electrophoresis, and a band with a molecular weight of about 252 bp was obtained, which was consistent with the expected result. The fragment was recovered by agarose gel recovery kit. The recovered fragment was ligated with pCR TM -Blunt, and the ligation product was transformed into E. coli DH5α competent cells. The positive clones were identified according to the pCR TMThe positive clones were screened by the hygromycin resistance marker on the Blunt vector, and the recombinant plasmid containing the recovered fragment was obtained. The nucleotide sequence determination was performed on the recombinant plasmid vector with the T7 and SP6 promoter sequences as primers, and the sequencing result showed that the open reading frame (ORF) of the amplified psbE gene was SEQ ID NO: 1. The recombinant vector containing the psbE gene with the sequence of SEQ ID NO: 2 was named as Blunt-LncRNA, and the cDNA cloning result thereof is shown in Figure 1 .

[0034] Example 2: Regulation of anther development by psbE

[0035] The test process is shown in Figure 3 .

[0036] 1. Construction of recombinant expression vector

[0037] Construction of pBWA(V)HS-dicotyledonous plant recombinant expression vector

[0038] The cDNA obtained by reverse transcription of total RNA of the leaf of the wheat photoperiod-sensitive male sterile line BS366 was used as a template, and specific primers containing BsaI / Eco31I linker sequences were used for PCR amplification; then the PCR product was BsaI / Eco31I digested, recovered, and inserted into the vector pBWA(V)HS-ccdbGLosgfp in the forward direction, to obtain the recombinant vector pBWA(V)HS-psbE.

[0039] The primer sequences are as follows:

[0040] 5'-GAGAGAACACGGGGGACTTTGCAACATGAGCATGTACGGGAGGGACC-3', 5'-CACTCCCTGAAGCGGCCGCTGTACATGGCTTCCATGGTGCTGGAGGC-3'.

[0041] 2. Obtaining and identifying of transgenic Arabidopsis

[0042] Obtaining of transgenic Arabidopsis

[0043] (1) The recombinant expression vector constructed above was transformed into Agrobacterium tumefaciens GV3101 by electroporation method. In the clean bench, 1 mL of the above bacterial solution was added into 200 mL of YEP medium (containing antibiotics 100 μg mL-1 Kan and 50 μg mL-1 Rif), and cultured at 28°C, 220 rpm overnight. The culture was cultured to OD 600= 1.0. Centrifuge at 4000 rpm for 15 min, collect the bacteria, dilute the bacteria with the flower soaking medium [1 / 2MS + 5% sucrose + 0.03% surfactant, pH 5.8] to OD 600 = 0.8 or so, and wait for use.

[0044] (2) Select healthy Arabidopsis plants in full bloom, cut off the pods and the flowers that have opened, lay the Arabidopsis plants to be transformed flat, immerse the flower buds in the Agrobacterium suspension for 1 min, then move the culture pot aside and place it upside down in a large tray to allow the excess liquid to flow out. Cover the treated Arabidopsis with a plastic cover, and after 24 h of dark culture, place it in a light condition at 23-25°C to allow it to grow normally. After 1 week, it can be immersed again. After 3-4 weeks, when the Arabidopsis pods begin to turn yellow, cut them off and dry them in a culture dish. When most of the Arabidopsis pods have turned yellow, collect all the seeds in a 1.5 mL centrifuge tube (a suitable amount of silica gel can be placed in the tube to facilitate drying). After the seeds are completely dry, place them in a new 1.5 mL centrifuge tube and store them at 4°C for a short period of time. If necessary, they can be stored in a -20°C freezer for a long period of time.

[0045] (3) Take part of the Arabidopsis seeds (200-300 seeds) to a sterilized 1.5 mL centrifuge tube on the super-clean bench, first treat the seeds with 70% alcohol for 2 times, 30 s each time; then suspend the seeds in anhydrous ethanol, and then pour them onto a sterilized filter paper; after the anhydrous ethanol evaporates, evenly sow the seeds on the seed germination medium (1 / 2MS + 30 g / L -1 sucrose + 5-6 g / L -1 agar + 100 μg / mL Kan, pH 5.8); seal the culture dish with Parafilm and place it at 4°C for 24 h, and then place it in a 16 h light / 8 h dark condition for 7-10 d, and then transplant it to a nutrient pot and place it in a culture room for 3-4 weeks before proceeding to the next step of identification. Use MS medium containing 50 mg / L hygromycin for 2 rounds of screening, 10-15 days for each round of screening, and obtain positive transgenic plants.

[0046] Use the hygromycin gene sequence to perform PCR on the screened positive transgenic plants for further identification and screening. The primers used for PCR are as follows:

[0047] F: 5' GAGCATATACGCCCGGAGTC 3',

[0048] R: 5' CAAGACCTGCCTGAAACCGA.

[0049] PCR identification of OE-psbE transgenic Arabidopsis plants can obtain a band of about 501 bp, as shown in Figure 2. The left lane is the marker, and the right lane is the PCR product of the transgenic Arabidopsis plants. ​Figure 2 As shown.

[0050] Meanwhile, the pBWA(V)HS empty vector was introduced into Arabidopsis WT, and 3 transgenic Arabidopsis lines were obtained as controls (the transgenic Arabidopsis lines obtained by screening are denoted as T0 generation).

[0051] 3. Identification of pollen development phenotype of transgenic psbE lines

[0052] The overexpression line psbE has high expression level at BS366 mononuclear late stage, and the expression level in Arabidopsis is higher than that of wild type ( Figure 4 ), and the anther activity is weaker than that of wild type, and the number is less than that of wild type ( Figure 5 ). The pollen morphology of the overexpression line under scanning electron microscope is abnormal ( Figure 6 ), the small flower morphology of the overexpression line psbE is not different from that of wild type Arabidopsis ( Figure 7 ), the active oxygen content of the overexpression line is higher than that of wild type ( Figure 8 、 Figure 9 ), the length of the siliques of the overexpression line is obviously shorter, and the number of siliques is less than that of wild type ( Figure 10 ), the number of seeds contained in the siliques of wild type is more, and the number of seeds of the overexpression line is obviously less due to the short and small siliques ( Figure 11 ), which seriously reduces the fertility of Arabidopsis.

[0053] The above examples are only used to illustrate the technical solutions of the present application, but not to limit the protection scope of the present application.

Claims

1. A pollen development regulating gene psbE, characterized in that, The nucleotide sequence of the pollen development related gene psbE is shown as SEQ ID NO:

1.

2. A recombinant expression vector comprising the pollen development related gene psbE of claim 1.

3. A recombinant strain comprising the pollen development related gene psbE of claim 1.

4. Use of the pollen development related gene psbE of claim 1.

5. Use according to claim 4, characterized in that, The psbE is used for regulating pollen development.

6. Use according to claim 5, characterized in that, The activity and fertility of pollen are affected by overexpressing the pollen development related gene psbE.

Images