Preparation method and application of rahnella aquatica OmpA gene prokaryotic expression and polyclonal antibody

Abstract

The invention discloses a preparation method and application of carassius auratus rahn aquatic OmpA gene cloning and prokaryotic expression as well as a polyclonal antibody. The preparation method comprises the following steps: culture and DNA amplification of rahn aquatic, design of an OmpA primer, gene cloning and prokaryotic expression, back multi-point subcutaneous injection of an immune rabbit, heart blood sampling and preparation of the polyclonal antibody. The invention further provides OmpA protein prokaryotic expression and protein purification, preparation of OmpA polyclonal antiserum and application of fish bodies. According to the invention, a rahnella aquatilis OmpA gene is cloned, a specific Hind III and EcoR1 double-enzyme digestion primer sequence OmpA-1F / OmpA-1R is designed, a prokaryotic expression vector pET32a-OmpA is constructed, high-immunogenicity OmpA protein is obtained through purification, OmpA specific multi-antibody serum is prepared, and the OmpA specific multi-antibody serum can be used for preparing the multi-antibody serum. The OmpA polyclonal antibody can be used for detecting and positioning the expression application of rahnella aquatica OmpA protein in crucian carp bodies through bidirectional agar diffusion, an immunoblotting method and an immunohistochemical method, and provides a reference basis for research and development and application of rahnella aquatica subunit vaccines and a molecular diagnosis technology as well as immune prevention and control of infectious diseases of the rahnella aquatica subunit vaccines and the molecular diagnosis technology.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to the cloning and prokaryotic expression of the OmpA gene in *Laenia aquaticis*, and the preparation and application of polyclonal antibodies. Background Technology

[0002] Rahnella aquatilis is a newly emerging pathogenic bacterium in fish, causing septicemia in humans and various aquatic animals. Crucian carp (Carassius auratus) is an important economically farmed fish in my country. With the rapid development of intensive aquaculture, its resistance has decreased, leading to frequent outbreaks of bacterial septicemia. Rahnella aquatilis infection in crucian carp can cause clinical symptoms such as skin and internal organ bleeding, ascites, enteritis, and septicemia, resulting in significant economic losses to the aquaculture industry. Currently, molecular identification and diagnostic techniques for Rahnella aquatilis are still very limited, and research reports on the pathogenic and immune mechanisms of this bacterium infecting fish are extremely scarce. Recently, our research group previously discovered that the KCL-5 pathogenic strain of Rahnella aquatilis from crucian carp has a certain influence on its growth curve under different pH levels. OmpA is a phage receptor. Infections caused by antibiotic-resistant Escherichia coli pose a threat to human and animal health worldwide. Phage therapy has made significant progress in treating drug-resistant infections. E. coli strains expressing more AmpC (an important β-lactamase for ampicillin resistance) exhibit higher OmpA levels, leading to phage adsorption and lysis proliferation. Phages possess the inherent ability to infect cells using several protein receptors as attachment mechanisms. OmpA surface loops mediate Sf6 phage infection of Shigella. As long as there is homology in loops 2 and 4, phage Sf6 can effectively interact with the OmpA of other bacteria.

[0003] Bacterial OmpA proteins have multiple functions. OmpA is crucial for adhesion, invasion, and pathogenicity. Pathogens interact with host epidermal cells via adhesins and infiltrates, then release virulence factors that cause damage to the host. OmpA plays a vital role in stabilizing cell envelope structure by providing the physical link between OM and peptidoglycan. Mutations in OmpA significantly reduce Sakazakii internalization and replication. Differences in the OmpA sequence among ExPEC subtypes suggest that OmpA may influence alterations in virulence and host specificity. OmpA is involved in biofilm formation. After knocking out or mutating the OmpA gene, mutant strains formed fewer biofilms than wild-type strains. OmpA induces apoptosis, and it induces host cells to produce IL-1β and IL-18, leading to caspase-1 activation and stimulating cellular pyrolysis, resulting in host cell death. It is also associated with stress resistance and drug resistance. When bacteria encounter adverse environments, they naturally upregulate the expression of the OmpA gene. Under acidic stress, OmpA expression in *E. sakazakii* was upregulated by 1.55 μL. Under alkaline conditions, OmpA expression in enterotoxigenic *E. coli* was also upregulated.

[0004] *Laenia aquatica* is a Gram-negative facultative anaerobic bacterium belonging to the family Enterobacteriaceae and the genus *Laenia*. It is widely distributed in freshwater and soil and can cause disease in fish, mammals, and humans. Currently, there are no preventative measures against diseases caused by *Laenia aquatica*, making a vaccine to prevent infection urgently needed. Therefore, we expressed the virulence gene *OmpA* of *Laenia aquatica* in prokaryotes and prepared polyclonal antiserum, providing a reference for future research and application of subunit vaccines and molecular diagnostic technologies for *Laenia aquatica*. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by providing a method for cloning and prokaryotic expression of the OmpA gene in *Laenia crucian carp*, preparation of polyclonal antibodies (polyantiserum), and their applications. This invention utilizes bioinformatics methods to identify the molecular characteristics of the OmpA protein in *Laenia crucian carp*. Protein-protein interaction analysis revealed strong interactions between the OmpA protein and skp family proteins, periplasmic components of the Tol biopolymer transport system, proprotein transloses, and the Tol-pal system β-helical repeat protein TolB, thus revealing the function of the OmpA gene. Further, specific Hind III and EcoR1 double-enzyme digestion primer sequences OmpA-1F / OmpA-1R were designed, and the OmpA gene of *Laenia aquaticis* was successfully expressed in a prokaryotic system, obtaining a highly pure pET32a-OmpA recombinant protein. Rabbit-derived polyclonal antibodies were obtained by subcutaneous immunization of New Zealand rabbits at multiple points on the back. After three immunizations of rabbits over 53 days, heart blood was collected from the immunized rabbits, and antiserum was separated to obtain rabbit-derived polyclonal antibodies. In vitro and in vivo immunoblotting detection, immunohistochemical analysis, two-way agar diffusion, and OmpA molecular diagnostic techniques were applied to crucian carp.

[0006] To address the aforementioned technical problems, the sampling method of this invention is as follows: a method for cloning and prokaryotic expression of the OMP gene of *Laenia natans* from crucian carp and preparation of polyclonal antibody serum, wherein the method is as follows: S1. Bacterial strains and culture conditions: The aquatic Rahnella aquatilis strain KCL-5 used in this study was isolated, identified, and preserved by our research group from diseased crucian carp. Before use, the strain was cryopreserved in 20% glycerol (-80℃) and thawed twice on Luria-Bertani medium (LB). Single colonies of this strain were then inoculated into LB liquid medium and cultured at 25℃ for 12 h as inoculum for acid-base stress tests.

[0007] LB liquid culture medium with pH values ​​of 5, 7 (control group) and 9 was prepared respectively. The bacteria were inoculated at 2% and cultured at 25℃ and 200rpm until the logarithmic growth phase. The culture was centrifuged at 10000×g for 10min at 4℃, washed with PBS, and finally sent to the company for sequencing.

[0008] S2. Cloning of the OMP gene in *Laenia aquaticis*: DNA was extracted from *Laenia aquaticis* according to the instructions of the bacterial DNA extraction kit. This DNA was then used as a template for PCR amplification of the target gene. The PCR product was detected by 1% agarose gel electrophoresis and then recovered from the gel. The selected gel recovery was double-digested and ligated into the pET32a(+) plasmid to construct the recombinant plasmid pET32a-OmpA, which was then transformed into DH5α competent cells. Positive clones were selected and sent to a sequencing company for sequencing.

[0009] After successful sequencing, the selected positive clones were cultured overnight, and plasmids were extracted using a plasmid DNA extraction kit. The plasmids were then re-transformed into BL21(DE3) chemically active cells, and positive clones were selected and sent to the sequencing company for sequencing.

[0010] The expression of OmpA recombinant protein was detected in overnight cultured BL21(DE3) cells using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie brilliant blue staining. After expression identification, cells were destroyed by sonication to identify the expression form of OmpA recombinant protein.

[0011] The His-Tag-labeled OmpA recombinant protein was further purified using the His-tag protein purification method.

[0012] S3. Preparation method of OMP protein polyantiserum: To achieve the above objective, the present invention provides a method for preparing crucian carp aquatic Ranunculosis OMP protein polyantiserum, which can be obtained by immunizing animals with recombinant OmpA protein.

[0013] When New Zealand rabbits were immunized, a polyclonal antibody against the OMP protein of *Laenia aquatica* from crucian carp was obtained, with a serum titer reaching 1:8. The antibody specificity of OmpA was detected by Western blotting. This invention provides a polyclonal antibody against the OMP protein of *Laenia aquatica* from crucian carp. Immunohistochemical results show that the prepared OmpA antibody can be used to target the expression levels of *Laenia aquatica* in different tissues of fish.

[0014] Compared with existing technologies, this invention has the following advantages: It successfully expressed the OMP gene of *Laenia aquaticis* in a prokaryotic system, obtained the OmpA protein through prokaryotic expression, and obtained a recombinant protein with high purity. Rabbit-derived polyclonal antibodies were obtained by immunizing New Zealand rabbits, and polyclonal antiserum against the OmpA protein was successfully prepared. Further experiments showed that the OmpA polyclonal antiserum can be used to detect and locate the expression of *Laenia aquaticis* OmpA protein in crucian carp using Western blotting and immunohistochemistry, providing a reference for the research and development of subunit vaccines and molecular diagnostic technologies for *Laenia aquaticis*. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1Growth curves of *Laenia aquaticis* under different pH conditions: The results showed that KCL-5 promoted growth at pH 5, but growth was significantly inhibited and slowed at pH 9. The growth trend was almost consistent at pH 6-8.

[0017] Figure 2 . OmpA domain Figure 3 .OmpA three-level structure diagram Figure 4 Amplification of the target gene and construction of the vector. (A) PCR results, M: 2000 DNA marker, 1: PCR product (B) PCR identification of bacterial culture (C) Double enzyme digestion Figure 5 Recombinant plasmid sequencing Figure 6 . OmpA Expression of recombinant proteins. (A) Expression induced by different IPTG concentrations. OmpA Recombinant protein; M: protein molecular weight standard (15-120kDa), 1: uninduced control, 2-5: IPTG at final concentrations of 0.3, 0.5, 0.8, and 1 mM, 6-8: IPTG at a final concentration of 0.1 mM; (B) Expression results at different induction times, M: protein molecular weight standard (15-120kDa), 1: uninduced control, 2-8: expression results after induction for 1, 2, 3, 4, 5, 6, and 7 h. Figure 7 Expression of supernatant and precipitate after ultrasonic disruption: 1: centrifuged supernatant; 2: centrifuged precipitate. Figure 8 Purified target protein; M: protein molecular weight standard (15-120kDa), 1-6: purified target protein Figure 9 Two-dimensional agar diffusion method for testing antibody titer Figure 10 It is an immunoblotting method for detecting antibodies. OmpA Specificity of polyclonal antiserum. M: Protein molecular weight standard (15-120kDa), 1: pET32a- OmpA protein.

[0018] Figure 11 Immunohistochemistry (×200) was used to detect *Laenia aquaticis* in the gills, liver, kidneys, and intestines of crucian carp. OmpA Location of the protein. A: Slices of gill tissue from diseased crucian carp were compared with anti-protein... OmpA Protein polyserum incubation, TMB staining, brown-yellow signal is OmpA Location of protein expression; B: liver; C: kidney; D: intestine.

[0019] Figure 12 PCR products of the outer membrane protein OmpA gene were analyzed by agarose gel electrophoresis. Figure 13 A. Standard curve for SYBR Green real-time quantitative PCR detection of *Laenia aquaticis*; B. Amplification curve of sensitivity detection results for SYBR Green real-time quantitative PCR of *Laenia aquaticis*. Figure 1-8 The plasmid concentrations were 2.3 × 10¹⁰ to 2.3 × 10³ copies / µL; C. Amplification curves of 20 replicates of SYBR Green real-time quantitative PCR for *Laenia aquaticis*; D. Amplification curves of specific detection results of SYBR Green real-time quantitative PCR for *Laenia aquaticis*. Figure 1 1: Aquatic Laryn bacillus; 2: Heterosaccharophila aeromonas, Providencia reticularis, Alfakronella, Aeromonas hydrophila, Yersinia rumeni, Vibrio vulnificus, Aeromonas versicolor and blank control.

[0020] Figure 14 Optimization of the inner and outer primer ratio system for LAMP detection Note: A. Lane M, standard material 2000; lanes 1-7: 1:1, 1:2, 1:4, 1:6, 1:8, 1:10, negative control. Lanes 1-6 are positive, lane 7 is negative. B. PCR tubes 1-7: 1:1, 1:2, 1:4, 1:6, 1:8, 1:10, negative control. PCR tubes 1-3 and 7 are pink, PCR tubes 4-6 are orange-yellow. PCR tubes 4-6 showing orange-yellow indicates a positive reaction. The optimal primer ratio was determined to be 1:8. Detailed Implementation

[0021] To make the technology of the present invention clearer, the following examples will provide further explanation of the present invention.

[0022] The experiment was conducted at the Tianjin Key Laboratory of Aquatic Ecology and Aquaculture, Tianjin Agricultural College. The bacterial strain was isolated and extracted from the intestines of crucian carp randomly purchased from a Tianjin vegetable market. The experimental rabbits were purchased from Keda Aquaculture Center in Wuqing District, Tianjin. Other experimental materials were obtained from commercial channels.

[0023] Example 1. Cloning and prokaryotic expression of the OMP gene of *Laenia natans* from crucian carp and preparation of polyclonal antibody serum. The specific steps are as follows: Test strain: Aquatic Rahn's bacterium, isolated and preserved in our laboratory.

[0024] Reagents: DNA Marker DL2000 (Takara Bio Engineering (Dalian) Co., Ltd.), PCR Master Mix (Beijing Tiangen Biotech Co., Ltd.), pET32a(+) plasmid (Beijing Solarbio Biotechnology Co., Ltd.), Hind III and EcoR1 (both purchased from Takara), T4 DNA ligase (NEB), DH5α competent cells and BL21 competent cells (both purchased from Beijing Solarbio Biotechnology Co., Ltd.).

[0025] Example 2. Bacterial strains and culture conditions The aquatic Raenella KCL-5 strain used in this study was isolated, identified, and preserved by our research group from diseased crucian carp. Before use, the strain was cryopreserved in 20% glycerol (-80℃) and revived twice on Luria-Bertani medium (LB). Single colonies of this strain were then inoculated into LB liquid medium and cultured at 25℃ for 12 h as inoculum for acid-base stress tests.

[0026] S1. Acid-base stress culture LB liquid culture media with pH values ​​of 5, 7 (control group) and 9 were prepared respectively. The bacteria were inoculated at 2% and cultured at 25℃ and 200rpm until the logarithmic growth phase. The bacteria were centrifuged at 10000×g for 10min at 4℃, washed with PBS, and finally sent to Shanghai Meiji Biotechnology Co., Ltd. for prokaryotic transcriptome sequencing.

[0027] S2. Growth curves of aquatic Rhesus bacillus KCL-5 under different pH conditions Aquatic Rhesus bacillus KCL-5 was cultured for 40 h at pH values ​​of 5, 6, 7, 8, and 9, and growth curves were plotted. Figure 1 As shown, KCL-5 has a promoting effect and grows well at pH 5, but its growth is significantly inhibited and slows down at pH 9. The growth trend is almost the same at pH 6-8.

[0028] Bioinformatics prediction of the OmpA gene Based on the complete nucleotide sequence of *Laenia aquaticis* previously sequenced by our research group, we used bioinformatics methods to further analyze *Laenia aquaticis*. OmpA The transmembrane region (TMHMM2.0), structural domains (SMART http: / / smart.embl-heidelberg.de / ), and tertiary structure (SWISS-MODEL) of the protein were predicted. OmpA Proteins contain two domains, namely OmpA _membrane and OmpA Three-level structure description OmpA The protein is a transmembrane protein. After prediction is completed ( Figure 2 ), confirmed OmpA The target protein region was identified, and corresponding primers were designed using Primer 5.0 (Table 1).

[0029] Table 1. OmpA primers Primer name Sequence (5'>3') Product size (bp) Annealing temperature(℃) -F CCG GAATTC ATGAAAAAGACAGCTATCGC -R CCC AAGCTT TTAAGCCTGTGGCTGAGT 1077 64 Example 3. Based on the method for cloning and prokaryotic expression of the OMP gene of *Laenia natans* from crucian carp and the preparation of polyclonal antibody serum according to Example 1, the method is as follows: S1, pET32a- OmpA Clonal transformation and identification DNA extraction method: DNA was extracted from *Laenia aquaticis* using the CTAB / NaCl method. A single colony of *Laenia aquaticis* strain KCL-5 was inoculated into 5 ml LB and cultured overnight at 30°C. 1 ml of seed culture was inoculated into 100 ml of 2% LB and cultured at 37°C and 220 rpm for 16 hours. The culture was centrifuged at 5000 rpm for 10 minutes, and the supernatant was discarded. After washing with 10 ml TE buffer, the bacterial cells were dissolved in 10 ml TE buffer, mixed well, and stored at -20°C for later use. 3.5 ml of the bacterial suspension was taken, 184 μl of 10% SDS was added, mixed well, 37 μl of 10 mg / ml proteinase K was added, mixed well, and incubated at 37°C for 1 hour. 740 μl of 5 mol / L NaCl was added, and then... Add 512 μl CTAB / NaCl, mix well, and incubate at 65 °C for 10 minutes; add an equal volume of chloroform / isoamyl alcohol, mix well, centrifuge at 10000 rpm for 5 minutes, and retain the supernatant; add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) to the supernatant, mix well, centrifuge at 10000 rpm for 5 minutes, and retain the supernatant; add 0.6 times the amount of isopropanol, mix well, centrifuge at 10000 rpm for 5 minutes, collect the DNA precipitate, and wash the DNA precipitate with 70% ethanol by centrifugation; dissolve the DNA in 1 ml TE, add RNase A to a final concentration of 20 μg / ml, and store at 4 °C.

[0030] S2, OmpA Results of protein gene amplification and construction of cloning and expression vectors. Step 1: DNA Extraction Method for Strains: DNA was extracted from *Laenia aquaticis* using the CTAB / NaCl method. A single colony of *Laenia aquaticis* strain KCL-5 was inoculated into 5 ml of LB broth and incubated overnight at 30°C. 1 ml of seed culture was inoculated into 100 ml of 2% LB broth and incubated at 37°C and 220 rpm for 16 hours. The culture was centrifuged at 5000 rpm for 10 minutes, and the supernatant was discarded. After washing with 10 ml of TE buffer, the bacterial cells were dissolved in 10 ml of TE buffer, mixed well, and stored at -20°C for later use. 3.5 ml of the bacterial suspension was taken, 184 μl of 10% SDS was added, mixed well, 37 μl of 10 mg / ml proteinase K was added, mixed well, and incubated at 37°C for 1 hour. 740 μl of 5 mol / L NaCl was added, and then... Add 512 μl CTAB / NaCl, mix well, and incubate at 65 °C for 10 minutes; add an equal volume of chloroform / isoamyl alcohol, mix well, centrifuge at 10000 rpm for 5 minutes, and retain the supernatant; add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) to the supernatant, mix well, centrifuge at 10000 rpm for 5 minutes, and retain the supernatant; add 0.6 times the amount of isopropanol, mix well, centrifuge at 10000 rpm for 5 minutes, collect the DNA precipitate, and wash the DNA precipitate with 70% ethanol by centrifugation; dissolve the DNA in 1 ml TE, add RNase A to a final concentration of 20 μg / ml, and store at 4 °C.

[0031] Step 2: Amplification of the target gene: Using the DNA extracted in Step 1 as a template, PCR amplification of the target gene was performed. The reaction system included: 0.5 μL each of forward and reverse primers, 12.5 μL of 2*PCR mix, 2 μL of template, and DEPC water to a final volume of 25 μL. The reaction procedure is shown in Table 2. The amplification results are as follows: Figure 4 As shown in Figure A.

[0032] Table 2 Reaction Procedure temperature time Loop count 94℃ 3min 94℃ 30s 63.5℃ 30s 72℃ 1 minute 10 seconds 30 cycles 72℃ 5min Step 3: Cloning, Transformation, and Identification: After PCR product detection by 1% agarose gel electrophoresis, the product was recovered from the gel, double-digested, and ligated into the pET32a(+) plasmid to construct the recombinant plasmid pET32a- OmpA The cells were transformed into DH5α competent cells, and after transformation, bacterial culture PCR was performed for verification (positive clones were selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing).

[0033] Based on the OmpA gene sequence of *Laenia aquaticis*, corresponding upstream and downstream primers were designed to amplify the target OmpA gene. After PCR amplification, Figure 4 As shown in Figure A, the expected product (1077 bp) was successfully obtained. The purified PCR product was double-digested, ligated into the pET32a(+) vector, transformed into DH5α competent cells, and identified by colony PCR. Figure 4 B) Double enzyme digestion identification ( Figure 4 C) and sequencing identification ( Figure 5 Afterwards, the recombinant plasmid was extracted and transformed into BL21 expression cells. The OmpA expression vector was successfully constructed and verified by colony PCR and gene sequencing. Blast results showed that the target sequence had 100% homology with the OmpA gene of *Laenia aquaticis*.

[0034] in, OmpA The gene sequence is: 1 ATGAAAAAGACAGCTATCGCATTAGCAGTGGCACTGGCAGGTTTCGCTACCGTAGCGCAAGCCGCCCCTAAAGAT 76 AACACCTGGTATACCGGTGGTAAATTGGGCTGGTCCCAATACCATGACACTGGTTTCGCAAACGCTTACAACGGT 151 ATCGGCAACGGCCCTACCCACGAAAGCCAACTGGGTGCAGGTGCGTTCTTGGGTTACCAAGCGAACCAATACCTG 226 GGCTTTGAAATGGGATATGACTGGCTTGGCCGTATGCCTTACAAAGGCAGCGTAAATAACGGCGCGTTCAAAGCA 301 CAAGCGTTCAGCTGGCTGCTAAACTGAGCTACCCGCTGACTGACGATCTGGACCTGTACACCCGTCTGGGTGGT 376 ATGGTTTTGGCGTGCAGATGCTAAAGGTAACTTCAACAACGGTGCTAATGGTCGCGTAAGTGATCATGACACTGGT 451 GTTTCTCCACTGGCAGCAGTTGGTGTTGAATACGGCAGTAACCAAAAACTGGGCTACCCGTCTGGATTACCAGTGG 526 GTTAACAACATTGGTGATGCGGCTACCGTTGGTGCACGTCCTGATAACGCAATGCTGTCTGTAGGTGTTTCTTAC 601 CGTTTCCGGTCAAGATGAAGCAGCTGCTCCAGTTGTTGCTCCAGCACCAGCTCCAGCTCCAGTTGTAGAGACTAAG 676 AAATTCACTCTGAAATCTGACGTTCTCTTCAACTTCAACAAAGCGACTCTGAAACCAGAAGGCCAACAGGCTCTG 751 GATCAGCTGTACAGCCAGTTGAGCTCTATCGATCCTAAAGACGGGTTCTGTTATCGTTCTGGGTTACACCGACCGT 826 ATCGGTTCAGAACAATACAACCAAAAACTGTCTGAGCAACGTGCTCAGAGCGTAGTAGATTACCTGGTATCTAAA 901 GGTATCCCTGCTAACAAGATCTCTGCACAAGGCCAGGGTAAATCTAACCCAGTTACCGGTTCTACCTGTGACTCC 976 GTTAAAGGCCGTGCTGCTCTGATCGACTGCCTGGCACCAGACCGTCGTGTAGAAATCGAAGTTAAAGGCTACAAA 1051 GATACTGTTACTCAGCCACAGGCTTAA S3, pET32a- OmpA Induced expression and identification After successful sequencing, positive clones are cultured overnight, plasmid DNA is extracted, and they are re-transformed into chemically active cells. Positive clones are then selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The steps for extracting plasmid DNA are as follows: Bacterial culture: A single colony of *Laenia aquaticis* KCL-5 strain is inoculated into LB liquid medium and cultured at 25℃ for 12 h. A suitable medium is then selected. Bacterial harvest: The strain is cultured at 25℃ and 200 rpm until the logarithmic growth phase. It is then centrifuged at 10000×g for 10 min at 4℃, and the supernatant is collected, retaining the bacterial pellet. Bacterial cell disruption: The bacterial pellet is resuspended in PBS buffer and homogenized. Lysing enzymes such as lysin and modified proteinase K are added to disrupt the bacterial cell wall and cell membrane. Cell membrane lysis: SDS lysis buffer is added to rupture the cell membrane. Cell nucleic acid separation: A high-salt solution is added to precipitate proteins with acetone, and plasmid DNA is precipitated with ethanol to separate the cell nucleic acid from other impurities. Plasmid DNA purification: The lysed cell solution is loaded onto a silica gel column using a centrifugation and washing process to remove impurities. The purified plasmid DNA is then eluted. DNA precipitation: The purified plasmid DNA is precipitated with ethanol, and the precipitate is removed by centrifugation. Plasmid DNA lysis: The extracted plasmid DNA was dissolved in an appropriate PBS buffer and then subjected to quality analysis and concentration testing.

[0035] S4. Induced expression of recombinant proteins and identification of expression forms The expression of OmpA recombinant protein was detected in overnight cultured BL21(DE3) cells using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie brilliant blue staining. After expression identification, cells were destroyed by sonication to identify the expression form of OmpA recombinant protein.

[0036] Expression was induced with different final concentrations of IPTG. OmpA Recombinant protein, results ( Figure 6 A) indicates that the relative molecular mass of the target protein is close to the predicted size (57 kD), and 0.1 mM IPTG can induce a large expression of the target protein. Different induction times show that ( Figure 6 (B) The expression level of the target protein was almost the same from 1 to 7 hours; furthermore, the identification results showed that... Figure 7 As shown OmpA Recombinant proteins are primarily expressed in the form of inclusion bodies.

[0037] S5, Protein Purification His-Tag labeled OmpA recombinant protein was further purified using His-tagged protein purification. The steps of this method are as follows: Equilibration buffer: 50 mM phosphate buffer at pH 7.4 with 0.5 M NaCl containing 20 mM imidazole; Elution buffer: 50 mM phosphate buffer at pH 7.4 with 0.5 M NaCl containing 500 mM imidazole; Take 1 ml of pre-packed nickel agarose gel FF or nickel NTA agarose gel FF column, equilibrate with 10 ml of equilibration buffer, then take 10 ml of the broken supernatant and load it at 0.5 ml / min, then collect in 2 ml / tubes; wash away unadsorbed sample with 15 ml of equilibration buffer at a flow rate of 1-2 ml / min, collect in 2 ml / tubes; wash away unadsorbed sample with 5 ml of elution buffer at a flow rate of 1-2 ml / min, collect in 2 ml / tubes; equilibrate the column again with 5 ml of equilibration buffer, fill with 20% ethanol, and block for future use; sample the proteins eluted from each concentration gradient and perform SDS-PAGE; based on the SDS-PAGE electrophoresis image, if protein is present, collect the protein and dialyze it; if there is no band in the supernatant but a band in the precipitate, precipitate under denaturing conditions for purification.

[0038] The His-Tag labeled material was further purified using the method described above. OmpA Recombinant protein.

[0039] After inducing culture with 0.1 mM IPTG for 2 h, BL21(DE3) engineered bacteria were collected by centrifugation and then resuspended in pre-cooled PBS. Subsequently, the bacteria were lysed by sonication, followed by centrifugation, and the target protein was purified according to the above method. Finally, elution with elution buffer yielded a single protein. OmpA Recombinant protein ( Figure 8 ).

[0040] S6, Aquatic Laenella OmpA Preparation and identification of polyantiserum Emulsified with Freund's complete adjuvant and purified by equal volume prior to immunization OmpA Protein (1 mg / mL). Then, subcutaneously inject 1 mL into each New Zealand white rabbit weighing 1.5-2 kg. OmpA A mixture of protein and Freund's complete adjuvant. Inoculate with equal amounts of... OmpA A mixture of recombinant protein and Freund's incomplete adjuvant was administered as a second immunization 14 days later, followed by a third immunization 28 days later. The final immunization was detected using a double-sided agar diffusion assay 10 days after the last immunization. OmpA Antibody titer: When the titer reaches 1:16, collect blood from the heart of the immunized rabbit and separate the antiserum.

[0041] The purified protein was dialyzed against 6, 4, 2, and 0 M urea, then concentrated with sucrose, and the protein concentration was determined to be 1 mg / mL. The protein was then emulsified with adjuvant and used to immunize rabbits, successfully preparing polyclonal antibody serum. The intermediate well of the two-dimensional agar amplification method was... OmpA Fusion protein, with surrounding pores containing polyclonal antibody serum. (From...) Figure 9 The titer of polyclonal antibody serum obtained by the two-dimensional agar amplification method was 1:2. 4 .

[0042] S7, Western blotting analysis Detection using Western blot method OmpA Antibody specificity. After induction. OmpA Total protein was transferred to a polyvinylidene fluoride (PVDF) membrane after 12% SDS-PAGE. The PVDF membrane was blocked with 5% skim milk at 37°C for 2 h, then washed four times with TBST for 7 min each time. The PVDF membrane was then coated with an anti-inflammatory solution diluted 1:300. OmpA The antiserum was incubated overnight at 4°C, then washed four times with TBST, and incubated for 50 min at 37°C with HRP-conjugated goat anti-rabbit IgG diluted 1:5000. The PVDF membrane was then washed again, and protein bands were visualized using TMB.

[0043] Detection of antibodies using immunoblotting OmpA The specificity of polyclonal antibodies. For example... Figure 10 As shown, the prepared anti OmpA Polyantiserum against OmpA Proteins have high specificity.

[0044] Immunohistochemical analysis of S8-type aquatic Laenella bacteria-infected crucian carp Crucian carp tissue infected with *Laenia natans* was paraffin-embedded and sectioned. After antigen retrieval, the dewaxed tissue sections were mounted with blocking goat serum at 37°C for 30 min. The tissue sections were washed three times with PBS and then... OmpA Antiserum (1:20 dilution) was incubated overnight at 4°C. After washing three times with PBS and drying, tissue sections were incubated with HRP-conjugated goat anti-rabbit IgG (1:500 dilution) at 37°C for 30 min. The tissue sections were washed three times with PBS, stained with TMB working solution at room temperature in the dark for 10 min, washed with distilled water to terminate the reaction, washed three times with PBS, dried, counterstained with hematoxylin for 15 min, washed with distilled water, fixed with graded alcohols, cleared with xylene, and finally mounted with resin. The tissue sections were examined and photographed under a microscope.

[0045] Immunohistochemical results showed that ( Figure 11 ), the prepared OmpA Antibodies can be used to target the invasion of aquatic Ranunculosis in different tissues of fish. Brownish-yellow positive signals were observed in the gills, liver, kidneys, and intestines of crucian carp, indicating that the gills, liver, kidneys, and intestines are the main sites of invasion by aquatic Ranunculosis.

[0046] Example 4: Establishment of real-time PCR and LAMP methods for the OMP gene of *Laenia natans* in crucian carp. The specific operation steps are as follows: This study established a qPCR detection method for *Laenia aquaticis* using the OmpA gene as the target gene, and a LAMP detection method for *Laenia aquaticis* using the OmpA gene as the target gene. These methods not only feature good reproducibility, high sensitivity, and strong specificity, but also offer advantages such as rapid identification, simple operation, and accurate results, providing a technical basis for establishing a highly specific and sensitive detection method for *Laenia aquaticis*.

[0047] S1. Test strain: Aquatic Rahn's bacterium, isolated and preserved in our laboratory.

[0048] Main reagents and instruments: Main reagents: 2×Universal Blue SYBR Green qPCR Master Mix (Wuhan Saiweier Biotechnology Co., Ltd.), WarmStart® Colorimetric LAMP2X Master Mix (New England Biolabs (NEB)). Reaction reagents: Bst DNA polymerase, dNTPs, buffer, visualization dye detection solution, Mg2+, 10 μmol / L forward outer primer F3, 10 μmol / L reverse outer primer B3, 10 μmol / L forward inner primer FIP and 10 μmol / L reverse inner primer BIP, 10 μmol / L forward inner primer LF and 10 μmol / L reverse inner primer LB; ddH2O.

[0049] S2. The experimental procedure is as follows: Real-time PCR detection method: 1. OmpA gene primer design Based on the OmpA gene sequence (gene 1595) of *Laenia aquaticis* in GenBank (NCBI), specific primers were designed using NCBI's blast-primer for constructing recombinant plasmids and performing quantitative real-time PCR amplification. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0050] 2. Preparation of standard templates Primers OmpA-1F / 1R and OmpA-2F / 2R were used, with KCL-5 as the DNA template, for PCR amplification. The reaction consisted of 30 cycles: pre-denaturation at 95℃ for 2 min, followed by annealing at 55℃ for 40 s, 58℃ for 30 s, and 72℃ for 1 min, with a final extension at 72℃ for 10 min. The product was purified and ligated into the pMD-18T vector. Transformation into DH5α was performed, and positive bacteria detected by PCR were cultured and sequenced. The recombinant plasmid was extracted and its concentration was determined using a kit. The DNA copy number was calculated using the formula: Molecular copy number (copies / μL) = (Plasmid concentration (ng / μL × 10⁻⁶) / (Copymid concentration (ng / μL × 10⁻⁶)). -9 ) / target DNA length×660)×6.02×10 23 (copies / μL). The standards used to establish the standard curve in this study were serially diluted 10-fold. The recombinant plasmid was extracted and measured using a micro-volume UV spectrophotometer (Model 1-300 ultra-micro spectrophotometer, IMPLEN, Germany).

[0051] 3. Establishment and optimization of SYBR Green real-time PCR conditions Using 2x Universal Blue SYBR Green qPCR Master Mix, 0.5 µL each of upstream and downstream primers, 12.5 µL of SYBR Green enzyme, 9.5 µL of DEPC water, and 2 µL of template were added to a 25 µL reaction mixture. qPCR amplification was performed using a CFX96 instrument. TM Real-Time System. This study employed multiple methods to optimize primers, including primer dosage, concentration, reaction time, and temperature, aiming to obtain the lowest Cq value and eliminate non-specific amplification. Primer systems with volumes of 0.5 µL, 1 µL, and 1.5 µL were selected to screen for the optimal primer system. Annealing temperatures of 50℃, 52℃, 53.9℃, 56.3℃, 58.3℃, 60℃, 62℃, 64℃, 66.4℃, 67℃, 68.4℃, 69.5℃, and 70℃ were selected to screen for the optimal annealing temperature.

[0052] 4. Establishment of Standard Curve Recombinant plasmids based on the OmpA gene were serially diluted 10-fold. The templates for each concentration gradient of the standards after each dilution were 6.8 × 10⁻⁶. 1 ~6.8×10 8 copies / μL, 2.3×10 1 ~2.3×10 8 copies / μL, 3.5×10 1 ~3.5×10 8 The concentration was calculated as copies / μL, with three replicates for each dilution. qPCR amplification was performed under the previously selected optimal conditions, and the resulting standard curve was analyzed.

[0053] 5. Sensitivity, repeatability, and specificity tests of the SYBR Green real-time PCR detection method. First, sensitivity testing was performed. Recombinant plasmids based on the OmpA gene were serially diluted at 10-fold ratios. The standard templates at each dilution concentration were 6.8×100–6.8×10¹² copies / μL, 2.3×100–2.3×10¹² copies / μL, and 3.5×100–3.5×10¹² copies / μL. Negative control samples in this study were all prepared using DEPC water. qPCR amplification was performed under the previously selected optimal conditions. The results were analyzed to determine the linear relationship between the Cq value and the copy number of the detected sample, as well as their correlation coefficients, ultimately yielding the minimum detectable limit. Simultaneously, primers VgrG-2F / 2R, OmpA-2F / 2R, and OmpW-2F / 2R were used for conventional PCR to obtain the minimum detectable limit, and the sensitivity results of the two methods were compared. Repeatability testing was conducted on a single positive sample, with multiple loadings under the same conditions. The S2 and LAMP detection methods were established, and the steps are as follows: 1. Primer design LAMP primers were designed for the specific detection of *Laenia aquaticis* in this study. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0054] 2. LAMP amplification KCL-5 DNA was extracted and then added as template DNA to the fluorescent LAMP detection kit for LAMP amplification. The reaction system of the fluorescent LAMP detection kit was incubated in a 65°C water bath for 1 hour. The reaction system consisted of: 12.5 µL color-changing premix, 4.4 µL primers (0.2 µL F3, 0.2 µL B3 (10 µM), 1.6 µL BIP, 1.6 µL LFIP (10 µM), 0.4 µL LF, 0.4 µL LB (10 µM), 1 µL KCL-5 DNA template, and 7.1 µL ddH2O). The reaction was carried out at 65°C for 50 minutes and terminated at 85°C for 10 minutes. Visual inspection was used to determine the result: a positive result was indicated by an orange-yellow color in the fluorescent dye, while a negative result was indicated by a pink color. Electrophoresis was used to further examine the products.

[0055] First, solid cultures inoculated with *Laenia aquaticis* were cultured at 28°C for 18 hours using standard methods. Single colonies were then selected and cultured in liquid culture for further incubation. DNA was extracted from the bacterial culture using a DNA extraction kit, and its concentration and quality were determined.

[0056] 3. Optimize the ratio of inner and outer primers. Based on the reaction system provided by the LAMP detection kit, this study designed different ratios of inner and outer primers, specifically adjusting the concentration ratio of the outer primer composed of primers F3 and B3, and the inner primer composed of primers FIP and BIP. The inner and outer primer ratios were 1:1, 1:2, 1:4, 1:6, 1:8, and 1:10, respectively. A negative control was included. The circular primer composed of primers LF and LP was not involved in the concentration ratio changes. The optimal primer concentration ratio was determined by comparing the amplification results repeatedly. Figure 14 ).

[0057] 4. LAMP-specific detection This study used eight different bacteria to perform specific detection experiments on the constructed LAMP assay: *Aeromonas heterotrophus*, *Providencera retinae*, *Alfaxone*, *Aeromonas hydrophila*, *Yersinia rumeni*, *Vibrio vulnificus*, *Aeromonas vesiculosus*, and *Rahn's bacterium*. DNA was extracted from each bacterium and used as a template for this study, followed by LAMP amplification under the optimal conditions selected in the previous screening.

[0058] 5. LAMP sensitivity test The extracted plasmid DNA concentration was determined to be 760 ng / uL. It was then serially diluted, with each dilution being 10 folds. The diluted DNA at different concentrations was amplified under the optimal conditions selected in the previous screening, and its sensitivity was detected by combining reaction color and electrophoresis.

[0059] Example 3: Establishment of a qPCR detection method for the OMPA gene of *Laenia natans* in crucian carp. The specific operation steps are as follows: Amplification and cloning of S1 and OmpA genes Using standard PCR primers OmpA-1F and OmpA-1R, with *Laenia aquaticis* DNA as the template, amplified a fragment of approximately 356 bp. This fragment was cloned into pMD-18T, and sequencing results were as expected. The recombinant plasmid was extracted and its concentration was determined to be 760 ng / µL using a micro-UV spectrophotometer, with an A260 / A280 ratio of 2.15. Figure 9 ).

[0060] S2. Establishment and optimization of conditions for SYBR Green real-time quantitative PCR PCR amplification was performed using qPCR primers OmpA-2F and OmpA-2R, with recombinant plasmid DNA as the template, to test the specificity and availability of the primers. Electrophoresis results showed a product with a fragment size of approximately 150 bp. Figure 12The primers matched the expected fragment, indicating that they were suitable for the next qPCR experiment. After optimizing the primer dosage, concentration, reaction time, and temperature, the optimal 25 µL system was determined: 0.5 µL each of upstream and downstream primers, 9.5 µL of DEPC water, 2 µL of DNA template, and 12.5 µL of 2×SYBR Green qPCR Master Mix. The quantitative PCR amplification program was as follows: Step 1, 95℃ for 3 min; Step 2, 40 cycles: 95℃ for 10 s, 64℃ for 1 min (collecting FAM fluorescence signal); 70℃ for 2 min, 65℃ for 0.5 s, 95℃ for 5 s (collecting FAM fluorescence signal).

[0061] S3. Establishment of the standard curve After optimizing the qPCR conditions, the final eight dilution concentrations used were 2.3 × 10⁸. 10 ~2.3×10 3 A standard curve was constructed using copies / µL. In the standard curve plot, the X-axis represents the plasmid copy number, and the Y-axis represents the Cq value. The standard curve (y = -3.556x + 29.297) showed an amplification efficiency of 91.1%, R0. 2 A correlation coefficient of 0.999 indicates a copy number of 10-1. 10 ~10 3 Within the range, qPCR showed a good linear relationship ( Figure 13 A).

[0062] S4. Results of sensitivity, repeatability, and specificity tests for quantitative real-time PCR. After serial dilution of the recombinant plasmid standard by 10-fold, the concentrations obtained were 2.3 × 10⁻⁶. 3 ~2.3×10 10 Copies / µL of standard samples were used to amplify the samples using qPCR. Results showed that quantitative real-time PCR amplified recombinant plasmids down to a minimum detection limit of 2.3 × 10⁻⁶. 3 copies / µL of Aquatic Ranuncula DNA molecular copy number Figure 13 B).

[0063] The repeatability test involved selecting a positive sample and performing qPCR detection based on the best conditions from the initial screening. This was repeated 20 times. The results showed that the Cq values ​​of the 20 repeated amplification curves were basically consistent (range 12.68~13.01), and the amplification lines near the threshold line largely overlapped. Figure 13 C) The coefficient of variation for this result is 0.85%. The standard deviation is 0.110.

[0064] Using DNA from strains of *Laenia aquaticis*, *Aeromonas heterotrophus*, *Providensia rubella*, *Alfaxone*, *Aeromonas hydrophila*, *Yersinia rumenii*, *Vibrio vulnificus*, and *Aeromonas vesiculosus* as templates, the qPCR method established in this study was used for detection. The results showed that *Laenia aquaticis* was positive for the template, exhibiting a high fluorescence signal and a typical amplification curve. The negative control and the other seven strains were not detected. Figure 13 D).

[0065] Based on the above experimental results, the current research has achieved [the desired result] through prokaryotic expression. OmpA Protein, successfully prepared with anti OmpA Polyclonal antibody serum for the protein. Results showed that... OmpA Polyclonal antiserum can be used to detect and locate aquatic Laenella bacteria in crucian carp using Western blotting and immunohistochemistry. OmpA Protein expression. Our results indicate that the prokaryotic expression system can achieve sufficient protein expression. OmpA Recombinant proteins. Based on recombinant proteins, corresponding polyclonal antibody sera were prepared, laying the foundation for the development of subunit vaccines against *Laenia aquaticis*.

[0066] In summary, this study provides OmpA This provides an effective approach for the expression, purification, and concentration of recombinant proteins. Furthermore, recombinant proteins have been successfully used to prepare anti-inflammatory drugs. OmpA Polyclonal antiserum for proteins. On the one hand, our research may provide methods and suggestions for the preparation of other antibodies. On the other hand, this polyclonal antiserum is useful for detecting *Laenia aquaticis*. OmpA This study provides an effective method for determining the expression location and level of proteins under various pathophysiological conditions, and offers a reference for the future research and development of aquatic Ranuncula subunit vaccines and molecular diagnostic technologies.

Claims

1. A clone for the OmpA gene of Raenella aquatilis characterized in that: According to the sequence of OmpA gene of Aeromonas hydrophila, the corresponding upstream and downstream primers were designed to amplify the target gene of OmpA. The nucleotide sequence of the upstream primer was CCGGAATTCATGAAAAAGACAGCTATCGC (OmpA-F1), and the nucleotide sequence of the downstream primer was CCCAAGCTTTTAAGCCTGTGGCTGAGT (OmpA-R1).

2. The cloned and prokaryotically expressed Francisella piscicida OmpA gene of claim 1, wherein: Cloning, expression and sequence analysis of the outer membrane protein OmpA gene of Rahnella aquatilis, DNA of Rahnella aquatilis was extracted, and the target gene was amplified by PCR using the DNA as a template. The PCR product was detected by 1% agarose gel electrophoresis and recovered. Specific primers were designed, and EcoR1 and Hind III enzyme cutting sites were added to the 5' end of the specific primers. The nucleotide sequences of the two enzyme cutting sites are: the nucleotide sequence of the 5' end of the upstream primer, i.e., the nucleotide sequence of the specific primer CCG GAATTC The nucleotide sequence of the downstream primer is CCC AAGCTT TTAAGCCTGTGGCTGAGT(OmpA-R2).

3. The cloned and prokaryotically expressed Francisella piscicida OmpA gene of claim 2, wherein: The induced expression and identification of pET32a-OmpA were performed. The PCR product of claim 1 was double-digested and ligated to the pET32a(+) plasmid to construct the recombinant expression vector pET32a-OmpA, which was transformed into competent cells DH5α. The positive clones were picked and sequenced. After successful sequencing, the positive clones were cultured overnight, and the plasmid DNA was extracted. The recombinant expression vector was re-transformed into BL21(DE3) chemically competent cells, and the positive clones were picked and sequenced.

4. The cloning and prokaryotic expression of the OmpA gene of *Laenia aquaticis* according to claim 3, characterized in that: The construction method of the OmpA protein gene cloning vector and expression vector was as follows: according to the sequence of OmpA gene of Aeromonas hydrophila, the upstream and downstream primers were designed to amplify the target gene of OmpA. After PCR amplification, the expected product (1077 bp) was successfully obtained. The Blast result showed that the homology of the target sequence with the OmpA gene of Aeromonas hydrophila was 100%.

5. The cloning and prokaryotic expression of the OmpA gene of *Laenia aquaticis* according to claim 4, characterized in that: The identification method of the recombinant protein expression form was as follows: 2% of the overnight cultured BL21(DE3) cell broth was inoculated into 5 5mL LB(Amp), and cultured at 37℃ and 200rpm until the OD600 was 0.

6. 1mL of the broth was taken as the uninduced control. The BL21(DE3) cells were induced by adding isopropyl β-D-thiogalactoside (IPTG) with a final concentration of 0.1, 0.3, 0.5, 0.8, and 1mM, respectively, to express in the LB / Amp culture medium at 37℃ for 4h. Then, the induced cells were centrifuged at 12000rpm and 4℃ for 5min, and the centrifuged product was washed twice with pre-cooled PBS. Then, the product was treated with 6× protein loading buffer at 100℃ for 10min, and the expression of OmpA recombinant protein was detected by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie brilliant blue staining. A fixed IPTG concentration was used to induce different times, such as 1, 2, 3, 4, 5, 6, and 7h, to explore the optimal induction time. The identification method of the recombinant protein expression form was as follows: 2% of the overnight cultured BL21(DE3) cell broth was inoculated into 5 5mL LB(Amp), and cultured at 37℃ and 200rpm until the OD600 was 0.

6. 1mL of the broth was taken as the uninduced control. The BL21(DE3) cells were induced by adding isopropyl β-D-thiogalactoside (IPTG) with a final concentration of 0.1, 0.3, 0.5, 0.8, and 1mM, respectively, to express in the LB / Amp culture medium at 37℃ for 4h. Then, the induced cells were centrifuged at 12000rpm and 4℃ for 5min, and the centrifuged product was washed twice with pre-cooled PBS. Then, the product was treated with 6× protein loading buffer at 100℃ for 10min, and the expression of OmpA recombinant protein was detected by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie brilliant blue staining. A fixed IPTG concentration was used to induce different times, such as 1, 2, 3, 4, 5, 6, and 7h, to explore the optimal induction time.

6. The cloned and prokaryotically expressed Francisella piscicida OmpA gene of claim 5, wherein: The preparation and identification method of the polyclonal antibody serum of the OmpA of the Aeromonas hydrophila is as follows: (1) expression of the recombinant protein and identification of the expression form The OmpA recombinant protein is induced to express by using different IPTG final concentrations, and the results show that the relative molecular mass of the target protein is close to the predicted size (57 kD), and 0.1 mM of IPTG can induce the target protein to express in large amount. Different induction time results show that the expression amount of the target protein is almost the same in 1-7 h; in addition, the identification results show that the OmpA recombinant protein is mainly expressed in the form of inclusion body. (2) protein purification The BL21 (DE3) engineering bacteria are collected by using the centrifugal method after the culture is induced by using 0.1 mM of IPTG for 2 h, and then the bacteria are suspended by using pre-cooled PBS. Subsequently, the bacteria are lysed by using ultrasonic wave, and then centrifuged, and the target protein is purified according to the instructions of the protein purification kit, and finally eluted by using the elution buffer, so that the single OmpA recombinant protein is obtained. (3) preparation and identification of the serum The purified protein is dialyzed by using 6, 4, 2, 0 M urea, concentrated by using sucrose, and the protein concentration is determined to be 1 mg / mL. Then the protein and the adjuvant are emulsified, and the rabbit is immunized by using the multi-point subcutaneous injection at the back, and the heart blood is collected to successfully prepare the polyclonal antibody serum. The middle hole of the double-direction agar diffusion is the OmpA fusion protein, and the surrounding holes are the titer of the polyclonal antibody serum.

7. The use of the aqueous Francisella tularensis OmpA gene polyclonal serum according to claim 6, characterized in that: The immunoblotting detection, immunohistochemical analysis, double-direction agar diffusion and OmpA molecular diagnostic technology application of the tissue infected by the Aeromonas hydrophila of the crucian carp are carried out.

Images