RsLNC2361 gene for regulating and controlling synthesis of radish anthocyanin and application of RsLNC2361 gene

Abstract

The invention discloses an RsLNC2361 gene for regulating and controlling synthesis of radish anthocyanin and application of the RsLNC2361 gene, and belongs to the technical field of genetic engineering. According to the invention, the RsLNC2361 gene is cloned from the red-peel red-pulp radish of Zuan Dan. The gene is subjected to instantaneous overexpression in radish leaves, the accumulation content of anthocyanin in the radish leaves can be increased, the expression level of anthocyanin biosynthesis related genes can be remarkably improved, RsLNC2361 is silenced in radish root and flesh, and accumulation of anthocyanin in fleshy roots and the expression level of anthocyanin biosynthesis genes can be reduced. According to the invention, the radish breeding process is accelerated, a new radish variety with high anthocyanin content is directionally cultivated, and an important theoretical basis is provided for analyzing a molecular regulation mechanism of radish anthocyanin synthesis.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, and particularly relates to a RsLNC2361 gene for regulating synthesis of radish anthocyanin and application thereof. BACKGROUND

[0002] Radish (Raphanus sativus) belongs to the family Brassicaceae and is an annual or biennial crop. It is not only an important traditional vegetable in China, but also widely cultivated in the world. Radish has rich germplasm resources and a long history of cultivation. Through long-term natural selection and artificial selection, radish has formed types and varieties with different skin and flesh colors. Among them, radish varieties rich in anthocyanins are favored by consumers due to their bright color and high nutritional value (Liu et al., 2022). Anthocyanins are a class of water-soluble flavonoids widely existing in plants, and there are many types. More than 600 types of anthocyanins are known (Grotewold, 2006), and most of them are derived from six common anthocyanins, including pelargonidin, cyanidin, delphinidin, peonidin, petunidin and malvidin.

[0003] Long non-coding RNAs (lncRNAs) are non-coding RNAs with a length greater than 200 nt. These RNA molecules have unique secondary structures but do not have protein-coding functions (Liu et al., 2023). Studies have shown that lncRNAs can affect plant growth and development by regulating specific gene expression and participating in auxin synthesis. In Arabidopsis, antisense lncRNA asDOG1 is transcribed near the promoter of the germination delay gene DOG1, which significantly inhibits the expression of DOG1 gene through cis-regulation mechanism, thereby accelerating the seed germination process (Fedak et al., 2016). In tomato, knocking out lncRNA1459 related to fruit ripening was found to significantly down-regulate the expression levels of ethylene and carotenoid synthesis-related genes, thereby hindering ethylene production and lycopene synthesis, ultimately adversely affecting the ripening process of tomato fruit (Li et al., 2018). In upland cotton, silencing lncRNA XH123 related to cold stress response significantly increased the sensitivity of plants to low temperature stress, showing chloroplast structure damage and increased reactive oxygen species levels (Cao et al., 2021). Tan et al. found that overexpression of LINC15957 significantly increased anthocyanin accumulation and expression levels of anthocyanin biosynthesis-related genes in radish leaves, while silencing LINC15957 significantly reduced anthocyanin accumulation and expression levels of anthocyanin biosynthesis genes in fleshy roots (Tan et al., 2023). In addition, numerous studies have shown that many lncRNAs can act as targets of miRNAs to play key regulatory functions (Cagirici et al., 2017). For example, LNC1 and LNC2 were identified as target molecules of miR156a and miR828a, respectively: the former reduces the expression level of SPL9 gene, and the latter induces the expression of MYB114 gene, ultimately resulting in different regulatory effects of anthocyanin content (Zhang et al., 2018). In wheat research, it was found that miR9678 can target lncRNA WSGAR and produce phased RNA through cleavage, thereby playing a regulatory role in delaying seed germination (Guo et al., 2018). Through WGCNA analysis, miRNA-lncRNA-mRNA expression regulation network construction and gene function verification, it was confirmed that lncRNAs MLNC3.2 and MLNC4.6 are potential target genes of miRNA156a, which can promote the expression of SPL2-like and SPL33 and anthocyanin accumulation by preventing the degradation of miR156a under light-induced conditions (Yang, 2020). SUMMARY

[0004] The application aims to provide a RsLNC2361 gene for regulating synthesis of radish anthocyanin and application thereof, so as to solve the problems in the prior art.

[0005] To achieve the above-mentioned purpose, the application provides the following scheme.

[0006] The application provides application of the RsLNC2361 gene in any one of the following aspects:

[0007] (1) application in regulating synthesis of radish anthocyanin;

[0008] (2) application in radish breeding.

[0009] The nucleotide sequence of the RsLNC2361 gene is shown as SEQ ID NO: 1.

[0010] The application further provides application of a recombinant vector containing the RsLNC2361 gene in any one of the following aspects:

[0011] (1) application in regulating synthesis of radish anthocyanin;

[0012] (2) application in radish breeding.

[0013] The recombinant vector is constructed by connecting the RsLNC2361 gene and an expression vector, and the nucleotide sequence of the RsLNC2361 gene is shown as SEQ ID NO: 1.

[0014] The application further provides application of a host bacterium of the recombinant vector in any one of the following aspects:

[0015] (1) application in regulating synthesis of radish anthocyanin;

[0016] (2) application in radish breeding.

[0017] Preferably, the RsLNC2361 gene positively regulates synthesis of radish anthocyanin.

[0018] The application also provides a method for regulating synthesis of radish anthocyanidin, comprising the step of introducing RsLNC2361 gene into radish to regulate synthesis of radish anthocyanidin; wherein the nucleotide sequence of the RsLNC2361 gene is shown as SEQ ID NO:1.

[0019] Preferably, the RsLNC2361 gene positively regulates synthesis of radish anthocyanidin.

[0020] The application also provides a breeding method for increasing content of radish anthocyanidin, comprising the step of overexpressing RsLNC2361 gene in radish to increase content of radish anthocyanidin; wherein the nucleotide sequence of the RsLNC2361 gene is shown as SEQ ID NO:1.

[0021] The application also provides a breeding method for reducing content of radish anthocyanidin, comprising the step of silencing RsLNC2361 gene in radish to reduce content of radish anthocyanidin; wherein the nucleotide sequence of the RsLNC2361 gene is shown as SEQ ID NO:1.

[0022] The application also provides a breeding method for obtaining transgenic radish with high content of anthocyanidin, comprising the step of overexpressing RsLNC2361 gene in radish to obtain transgenic radish with high content of anthocyanidin; wherein the nucleotide sequence of the RsLNC2361 gene is shown as SEQ ID NO:1.

[0023] The application discloses the following technical effects:

[0024] The cloned gene RsLNC2361 belongs to long-chain non-coding RNA, research shows that overexpression of the gene can significantly improve the content of anthocyanidin in plants, and loss of function thereof will lead to a decrease in the content of anthocyanidin in plants. The research result of the application not only helps to speed up the breeding process of radish, and directionally cultivate new radish varieties with high content of anthocyanidin, but also provides an important theoretical basis for analyzing the molecular regulation mechanism of synthesis of radish anthocyanidin. BRIEF DESCRIPTION OF DRAWINGS

[0025] In order to more clearly illustrate the technical solutions of the embodiments of the application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings described in the following are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor.

[0026] Figure 1Phenotype analysis of control group and radish leaves transiently overexpressing RsLNC2361 gene; pFGC1008: empty vector control group; OE-LNCR2361-1: treatment group 1; OE-LNCR2361-2: treatment group 2;

[0027] Figure 2 Expression level of anthocyanin synthesis related genes in leaves transiently overexpressing RsLNC2361 gene;

[0028] Figure 3 Relative expression level of RsLNC2361 in leaves transiently overexpressing RsLNC2361 gene;

[0029] Figure 4 Anthocyanin content in control group and OE-RsLNC2361 tissues;

[0030] Figure 5 Phenotype analysis of control group and radish roots inoculated with RsLNC2361-pTY; pTY: empty vector control group; pTY-LNCR2361-1: treatment group 1; pTY-LNCR2361-2: treatment group 2;

[0031] Figure 6 Expression level of anthocyanin synthesis related genes in pTY-RsLNC2361;

[0032] Figure 7 Relative expression level of RsLNC2361 in pTY-RsLNC2361;

[0033] Figure 8 Anthocyanin content in control group and pTY-RsLNC2361 tissues. DETAILED DESCRIPTION

[0034] Various example embodiments of the present application will now be described in detail with reference to the drawings. Such description, however, is to be considered in all aspects as illustrative and not restrictive, understanding that the scope of the application will be determined by the appended claims.

[0035] It is to be understood that the terms used in the present specification are merely used to describe particular embodiments and are not intended to limit the present application otherwise. In addition, for numerical ranges in the present application, it is to be understood that each intermediate value between the upper limit and the lower limit of the range is specifically disclosed. In any stated value or stated range, each intermediate value, and any other stated value or intermediate value in the stated range is encompassed within the present application. The upper limit and the lower limit of these smaller ranges can be included or excluded independently from the range.

[0036] All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains unless otherwise specifically defined herein. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in this specification are herein incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference is not an admission that it is prior art with respect to the present application.

[0037] Many modifications and variations of the present application described in the specific embodiments of the application can be made by those skilled in the art without departing from the spirit or scope of the application. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only.

[0038] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed material or step.

[0039] Example 1 Radish RsLNC2361 gene cloning and expression vector construction

[0040] According to the sequence of RsLNC2361 and the characteristics of the overexpression vector, specific primers with pFGC1008 vector homologous arms were designed.

[0041] The cDNA of purple red skin and flesh radish was used as the template for PCR amplification. The reaction system and program were set according to the 2xHieff Canace Advance Fast PCR Master MIX instruction manual (YESEN, China). The PCR amplification program was 98℃ pre-denaturation for 40s; 98℃ denaturation for 15s, 62℃ annealing for 10s, 72℃ extension for 20s, 30 cycles; 72℃ extension for 5min; the total volume of PCR amplification was 20μL: 1μL of forward primer, 1μL of reverse primer, 4μL of template cDNA, 10μL of high-fidelity enzyme mix, 4μL of ddH2O; the PCR amplification product was stored at 4℃. The amplification primers were as follows:

[0042] Forward primer: TTACAATTACCATGGGGCGCGCC GATGGTGTCTGAGGTGACGCTAG (SEQ ID NO: 2);

[0043] Reverse primer: AACATCGTATGGGTAGGTACC CATACTATCTACTTTATTAAAACAGAAAT (SEQ ID NO: 3).

[0044] The PCR product was purified by agarose gel electrophoresis and sent to Shengong Bioengineering (Shanghai) Co., Ltd. for Sanger sequencing. The RsLNC2361 gene was cloned from the material purple skin and red flesh radish, and the full-length coding sequence was 536 bp.

[0045] The nucleotide sequence of RsLNC2361 gene (SEQ ID NO: 1):

[0046] GATGGTGTCTGAGGTGACGCTAGGTTACGATCCTGTGCCCCATTCAATGCAGCATAGGTGGTAGACGACTGTGAGGATTCGATGCTCTGGTTAACCCTATGGAAAACTGATGTCAATGGCACAGTAAAACCCGACCCAACTGGAATAGGAACAAAGGATGCCGGGATTCTCTGTATTCCTGAAGCAGAACCTGATTTGCTTTATGGGCGTGCGTTGACAAAGAATAATATAGGAGGGACAAAGCCAATTATTTTCAGACATTGTTTCCCACTCGTCAAATTCTAATAAGGTAAAGGAGAAGAAAGTATGATTGTCATGTTGTCATATTTCGGAGAGAGAATGACTGGATGTGGAGGAAATTCATGCGATTTTTTAGTTACAATTAGTCATATTTGGAAAACATTTATTAGGTGGAAAAGACAATGAATTATTTCGTGTAGTTTATTAAATAGTCAGTGGCCTTTAGGCGTAAATATTGTACAACTTGTAGGGTAAGTCTATATGTGTATTTCTGTTTTAATAAAGTAGATAGTATG.

[0047] The obtained RsLNC2361 gene was connected with a plant overexpression vector by homologous recombination, and the prepared reaction system was subjected to homologous recombination at 37°C for 30 min, and then transformed into E. coli DH5α competent cells. After screening of the target gene, single colonies were shaken, and positive clones were selected by bacterial liquid PCR and sent to a company for sequencing to form a recombinant plasmid pFGC1008-RsLNC2361. The reaction system and program were set according to the GENE STAR PCR Master MIX instruction manual, the PCR amplification program was 94°C pre-denaturation for 120 s; 94°C denaturation for 30 s, 62°C annealing for 30 s, 72°C extension for 20 s, 35 cycles; 72°C extension for 5 min; the total volume of PCR amplification was 20 μL, forward primer 1 μL, reverse primer 1 μL, bacterial liquid template 2 μL, 2×PCR StarMix 10 μL, and ddH2O 6 μL. The pFGC1008-RsLNC2361 vector plasmid was extracted, transformed into Agrobacterium tumefaciens GV3101, and screened by CRM and Rif antibiotics and the target gene to obtain positive clones of Agrobacterium.

[0048] Example 2: Radish RsLNC2361 transient overexpression of radish leaves

[0049] Resuspension preparation: the transformed Agrobacterium was shaken to turbidity, collected in a sterile 50 mL centrifuge tube, centrifuged for 8-10 min (10000 rpm), and the supernatant was discarded. First add 5 mL resuspension, vortex mix (avoid light), and measure the OD value of the ultramicro spectrophotometer to about 0.6, and place it in a 28°C, 90 rpm incubator for about 4 h of induction, and then use it. The material to be transformed was watered the day before transformation, and the two-leaf two-heart stage of the purple red skin red flesh radish leaves was selected; before injection, the surface of the leaves was clean and dry, 500 μL of the infection liquid was taken with a 1 mL sterile syringe, and the radish leaves were injected; the radish seedlings after injection were placed in a light incubator at 28°C in the dark for 2 d, and the injected radish plants were covered with plastic wrap, and then transferred to a normal artificial climate room for culture, and the color change at the injection site was observed closely after 10 d. 600

[0050] Example 3: Construction of a virus-induced gene silencing (VIGS) vector of radish RsLNC2361 gene

[0051] ​The VIGS vector of radish was constructed by Nanjing Kingsrui Biotechnology Co., Ltd. In the RsLNC2361 gene sequence, the bases TGA, TAA or TAG were selected, and the first three bases of the selected sequence were avoided to be GTA, and then 40 bp of the selected sequence was added, and its reverse complementary sequence (the sequence is: TGAAGCAGAACCTGATTTGCTTTATGGGCGTGCGTTGACATGTCAACGCACGCCCATAAAGCAAATCAGGTTCTGCTTCA) (SEQ ID NO: 4) was added. Then, the homologous sequence with a length of 15 bp corresponding to the two ends of the linearized vector was added to the two ends. Then, a double-stranded DNA fragment with a total length of 110 bp was synthesized. The synthesized oligonucleotide was connected to the linearized vector. The VIGS vector was transformed into E. coli competent DH5a for expansion. After blue-white spot screening, the bacteria were shaken, and the OMEGA plasmid extraction kit was used to extract the plasmid. The extracted plasmid was stored at -20°C. The RsLNC2361 gene in the 10-day-old red radish was silenced, and the extracted plasmid was injected into the root of the purple radish. The injected radish was kept at 25°C / 22°C in an artificial climate chamber with a light / dark cycle of 16 hours / 8 hours. The injection was performed once a week, and a total of three times. The phenotype was evaluated in the fourth week.

[0052] Example 4: Determination of anthocyanin content

[0053] The radish material was ground into powder in liquid nitrogen. 1 g of the ground powder sample was weighed into a 10 mL centrifuge tube, 8 mL of 0.05% pre-cooled hydrochloric acid-methanol solution was added, and the mixture was vortexed and placed in a 4°C refrigerator in the dark. After 12 h, the supernatant was transferred to a 25 mL volumetric flask, 8 mL of the same hydrochloric acid-methanol solution was added to the centrifuge tube, vortexed, and placed in a 4°C refrigerator for 6 h. The supernatant was transferred to a 25 mL volumetric flask, and this step was repeated once. The volume was adjusted with 0.05% pre-cooled hydrochloric acid-methanol solution. Two test tubes (each containing 1 mL of the extract) were prepared, and 4 mL of 0.4 mol / L citric acid / disodium hydrogen phosphate buffer (pH 5.0) and 0.4 mol / L KCl-HCl buffer (pH 1.0) were added, respectively, and mixed well. The mixture was allowed to stand at room temperature for 20 min. Using 0.05% hydrochloric acid-methanol solution as a control, the absorbance values at 530 nm and 700 nm were measured using a dual-wavelength UV spectrophotometer. Each sample was repeated three times.

[0054] Example 5: Expression pattern analysis of RsLNC2361 gene and anthocyanin synthesis-related genes

[0055] Total RNA was extracted and reverse transcribed according to the GeneStar reverse transcription kit. Real-time quantitative PCR (RT-qPCR) was performed using SYBR Green Master Mix (GeneStar, China) on a real-time fluorescence quantitative PCR instrument (China, Hangzhou). RsActin was used as an internal control. The relative expression level of the candidate gene was calculated using the formula 2 -△△Ct (Livak and Schmittgen, 2001). All reactions were performed in triplicate biological replicates. The expression levels of RsDFR, Rs3GT, RsTT8, RsC4H, RsANS, RsUFGT, RsCHS, RsF3H, and RsLNC2361 were detected. The primer sequences for real-time fluorescence quantitative PCR are shown in Table 1.

[0056] Table 1 Primer sequences for real-time fluorescence quantitative PCR

[0057]

[0058]

[0059] Reaction system (total volume 20 μL): forward primer 1 μL, reverse primer 1 μL, cDNA template 2 μL, 2x RealStar Fast SYBR qPCR Mix 10 μL, ddH2O 6 μL.

[0060] Reaction program: 95°C pre-denaturation for 120 s; 95°C denaturation for 15 s, 60°C annealing for 30 s, 40 cycles; 4°C holding.

[0061] Example 6 Overexpression of RsLNC2361 gene can promote the synthesis of anthocyanins

[0062] From Figure 1 It can be seen that after transient overexpression of RsLNC2361 in radish leaves, the leaf color of the comparison test group and the control group was found to have obvious redness at the injection site of the transgenic lines (as shown in Figure 1 RT-qPCR technology was used to analyze the relative expression levels of anthocyanin biosynthesis-related genes and the target gene. The results showed that when RsLNC2361 was overexpressed, the expression levels of RsDFR, Rs3GT, RsTT8, RsC4H, RsANS, RsUFGT, RsCHS, RsF3H, and RsLNC2361 itself were significantly improved (as shown in Figure 2 and Figure 3 After determining the anthocyanin content of the leaves, it was found that the anthocyanin content in the leaves overexpressing RsLNC2361 gene was significantly higher than that in the control group ( Figure 4). The above experimental results show that overexpression of RsLNC2361 can increase the content of anthocyanin in radish leaves and promote the accumulation of anthocyanin.

[0063] Example 7 Silencing RsLNC2361 reduces the accumulation of anthocyanin in radish fleshy roots

[0064] By constructing a VIGS silencing vector and injecting it into red-fleshed red-skinned radish, it was found that the injection site of the transgenic line showed a significant whitening phenomenon (as shown in FIG. 6) compared with the control group. The relative expression levels of anthocyanin biosynthesis-related genes and the target gene were analyzed by RT-qPCR technology. The results showed that when RsLNC2361 was silenced in the root flesh, the expression levels of RsDFR, Rs3GT, RsTT8, RsC4H, RsANS, RsUFGT, RsCHS, RsF3H and RsLNC2361 itself were significantly down-regulated (as shown in FIG. 7 and FIG. 8). Figure 5 Figure 6 Figure 7 Further determination of the anthocyanin content of the root flesh showed that the anthocyanin content of the experimental group was significantly lower than that of the control group (as shown in FIG. 9). Figure 8

[0065] It can be seen that transient overexpression of RsLNC2361 gene in radish leaves can increase the content of anthocyanin in radish leaves and significantly increase the expression level of anthocyanin biosynthesis-related genes. Silencing of RsLNC2361 in radish root flesh can reduce the accumulation of anthocyanin in fleshy roots and the expression level of anthocyanin biosynthesis genes.

[0066] The above examples only describe the preferred modes of the present application and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art shall fall within the protection scope determined by the claims of the present application.​​​

Claims

1. Application of the RsLNC2361 gene in any of the following: (1) Application in regulating the synthesis of anthocyanins in radish; (2) Application in radish breeding; in, The nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:

1.

2. Application of recombinant vectors containing the RsLNC2361 gene in any of the following: (1) Application in regulating the synthesis of anthocyanins in radish; (2) Application in radish breeding; in, The recombinant vector is constructed by ligating the RsLNC2361 gene and an expression vector, and the nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:

1.

3. The use of a host bacterium containing the recombinant vector of claim 2 in any of the following: (1) Application in regulating the synthesis of anthocyanins in radish; (2) Application in radish breeding.

4. The application as described in any one of claims 1-3, characterized in that, The RsLNC2361 gene positively regulates the synthesis of anthocyanins in radish.

5. A method for regulating anthocyanin synthesis in radish, characterized in that, The method includes the step of introducing the RsLNC2361 gene into radish to regulate the synthesis of anthocyanins in radish; wherein the nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:

1.

6. The method as described in claim 5, characterized in that, The RsLNC2361 gene positively regulates the synthesis of anthocyanins in radish.

7. A breeding method for increasing the anthocyanin content of radishes, characterized in that, The method includes the step of overexpressing the RsLNC2361 gene in radish to increase the anthocyanin content of radish; wherein the nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:

1.

8. A breeding method for reducing anthocyanin content in radishes, characterized in that, The method includes the step of silencing the RsLNC2361 gene in radishes to reduce the anthocyanin content of radishes; wherein the nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:

1.

9. A method for cultivating a transgenic radish with high anthocyanin content, characterized in that, The method includes the step of overexpressing the RsLNC2361 gene in radishes to obtain transgenic radishes with high anthocyanin content; wherein the nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:1.

Images