Application of BAG3 protein in plant antivirus

By constructing SlBAG1/3/3l gene-edited mutants and AtBAG3 overexpressing plants, the function of BAG protein in plant antiviral activity was revealed, solving unknown problems of BAG protein in antiviral strategies, enhancing the antiviral ability of Arabidopsis thaliana and tomato, and providing new breeding resources.

CN121065252APending Publication Date: 2025-12-05INST OF MICROBIOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511452537.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-12
Publication Date
2025-12-05

AI Technical Summary

Technical Problem

The function of BAG protein, a key actuator in the programmed cell death signaling pathway for plant antiviral cells, is not fully understood in the current technology, which limits the possibility of developing novel antiviral strategies. In particular, there are no reports on whether and how BAG protein is activated after viral infection, or on the role of its functional domains in antiviral activity.

Method used

By constructing gene-edited mutants of SlBAG1, SlBAG3, and SlBAG3l and plants overexpressing AtBAG3, their antiviral functions in Arabidopsis and tomato were verified. It was found that SlBAG1/3/3l gene knockout increased susceptibility, while AtBAG3 overexpression enhanced resistance, and the BAG3-N-terminal domain induced cell death.

Benefits of technology

This study enhanced antiviral capabilities in Arabidopsis thaliana and tomato. The BAG3-N-terminal domain is conserved in different plants, providing new antiviral breeding targets and gene resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121065252A_ABST
    Figure CN121065252A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biology, and provides a tomato yellow leaf curl virus resistant gene of a plant, and the gene is an SlBAG1 gene, an SlBAG3 gene or an SlBAG3l gene. The base sequence of the SlBAG1 gene is as shown in SEQ ID NO. 1 in a sequence table; the base sequence of the SlBAG3 gene is as shown in SEQ ID NO. 2 in the sequence table; the base sequence of the SlBAG3l gene is as shown in SEQ ID NO. 3 in the sequence table. The gene provided by the invention can effectively inhibit the replication and proliferation of tomato yellow leaf curl virus, thereby enhancing the antiviral ability of plants.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and in particular to the application of the cell death signaling pathway regulated by plant BAG3 protein in regulating plant disease resistance. BACKGROUND

[0002] Plant viral disease is one of the main factors restricting global agricultural production, causing huge economic losses every year. As the largest group of plant viruses, geminiviruses can infect important crops such as tomatoes, cotton, corn, and soybeans, causing billions of dollars in losses worldwide every year. Its genome is highly variable, and the resistance obtained through traditional disease-resistant breeding is often quickly overcome. Therefore, it is crucial to explore new antiviral gene resources based on broad-spectrum and conserved mechanisms.

[0003] Programmed cell death is a defense response triggered by plants when infected by pathogens, limiting the spread and proliferation of pathogens through the programmed death of local cells. The precise regulation of programmed cell death is crucial, and its abnormal activation or inhibition can cause damage to the plant. Currently, the identification of key execution elements in the plant antiviral programmed cell death signaling pathway and the understanding of its regulatory mechanisms are still incomplete.

[0004] Bcl-2-associated athanogene (BAG) family proteins are a class of conserved molecular chaperone regulators. In plants, although some studies have shown that BAG (AtBAG) may be involved in regulating cell death, its specific function in antiviral immunity, especially whether and how it functions as a direct execution element of cell death, has been less studied. Specifically, whether BAG protein is specifically activated by viral infection, its activation mechanism, and the role of its functional domain in antiviral immunity have not been reported. This research gap limits the possibility of developing new antiviral strategies using BAG and its related pathways. SUMMARY

[0005] Therefore, the present application aims to provide a plant gene for resisting tomato yellow leaf curl virus, which is SlBAG1 gene, SlBAG3 gene or SlBAG3l gene; the base sequence of the SlBAG1 gene is shown in SEQ ID NO. 1 in the sequence listing; the base sequence of the SlBAG3 gene is shown in SEQ ID NO. 2 in the sequence listing; and the base sequence of the SlBAG3l gene is shown in SEQ ID NO. 3 in the sequence listing.

[0006] Further, the plant is a dicotyledonous plant, and the virus is a geminivirus.

[0007] Further, the dicotyledonous plant is Arabidopsis thaliana, tomato or tobacco.

[0008] Further, the plant is a monocotyledonous plant.

[0009] Further, the monocotyledonous plant is rice or maize.

[0010] The present application provides a new target and gene resource for plant antiviral breeding. BRIEF DESCRIPTION OF DRAWINGS

[0011] Figure 1 Genotype identification results of Arabidopsis thaliana AtBAG3 gene editing mutants.

[0012] Figure 2 Protein expression analysis in wild type, Atbag3 mutant and AtBAG3 overexpression Arabidopsis thaliana plants.

[0013] Figure 3 Phenotypes of wild type, Atbag3 mutant and AtBAG3 overexpression Arabidopsis thaliana plants under healthy and TYLCV virus infection.

[0014] Figure 4 TYLCV virus accumulation detection in wild type, Atbag3 mutant and AtBAG3 overexpression Arabidopsis thaliana plants.

[0015] The values are mean ± SEM (n = 6) (*P < 0.05).

[0016] Figure 5 Genotype identification results of tomato SlBAG1, SlBAG3 and SlBAG3-like (SlBAG3l) gene editing mutants.

[0017] Figure 6 Comparison of growth states of wild type and Slbag1 / 3 / 3l mutant plants of tomato.

[0018] Figure 7 Phenotypes of wild type and Slbag1 / 3 / 3l mutant plants of tomato under healthy and virus infection.

[0019] Figure 8 Virus accumulation detection in wild type and Slbag1 / 3 / 3l mutant plants of tomato under healthy and virus infection.

[0020] The values are mean ± SEM (n = 8).

[0021] Figure 9Western blot analysis of SlBAG1, SlBAG3, SlBAG31 and TYLCV coat protein (CP) in healthy and virus-infected tomato wild type and Slbag1 / 3 / 3l triple mutant.

[0022] Figure 10 Detection of the cell death-inducing ability of N-terminal proteins of tomato SlBAG1 / 3 / 3l (SlBAG1-N, SlBAG3-N and SlBAG31-N).

[0023] Figure 11 Detection results of SlBAG1-N, SlBAG3-N and SlBAG31-N proteins.

[0024] Figure 12 Leaf ion leakage analysis induced by SlBAG1 / 3 / 3l-N.

[0025] Figure 13 Detection of the cell death-inducing ability of N-terminal proteins of BAG3 in Arabidopsis thaliana (At-), Oryza sativa (Os-) and Zea mays (Zm-) (AtBAG3-N, OsBAG3-N and ZmBAG3-N).

[0026] Figure 14 Detection results of AtBAG3-N, OsBAG3-N and ZmBAG3-N proteins.

[0027] Figure 15 Leaf ion leakage analysis induced by AtBAG3-N, OsBAG3-N and ZmBAG3-N. DETAILED DESCRIPTION

[0028] The application will be further described in conjunction with the specific embodiments, and the examples given are only for illustrating the application, but not for limiting the scope of the application.

[0029] In the following examples, the experimental methods are all routine methods unless otherwise specified.

[0030] In the following examples, the materials, reagents and instruments used are all commercially available unless otherwise specified.

[0031] In the following examples, the first nucleotide of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA, and the last nucleotide is the 3' terminal nucleotide of the corresponding DNA unless otherwise specified.

[0032] The pENTR-3C cloning vector in the following examples is a product of Invitrogen Corporation, the plant expression vector pSAT4-DEST-nEYFP-C1 (pE3136) is a product of Invitrogen Corporation, the plant expression vector pBA-YFP is a product of Invitrogen Corporation.

[0033] The E. coli DH5a and Agrobacterium EHA105 strains are products of Biomed Biotech Co., Ltd.

[0034] The main reagents used in the following examples are as follows:

[0035] The reagents used for molecular cloning: EX Taq DNA polymerase and LA Taq DNA polymerase are products of Takara Bio Inc., restriction enzymes and T4 DNA ligase are products of NEB, the antibiotics used are products of Inolco, the 2000 bp DNA marker is a product of Biomed Biotech Co., Ltd., and the SYBR qPCR Mix is a product of TOYOBO.

[0036] The reagents used for protein-related experiments: Cocktail protease inhibitors are products of Roche, IPTG is a product of Inolco, 30% Acrylamide is a product of Sigma, BAG3 primary antibody is prepared by Huada Biotech Co., Ltd., TYLCV coat protein primary antibody is a product of Wuhan Aijietec Biotech Co., Ltd., GFP primary and secondary antibodies are products of Beijing Quanshi Gold Biotech Co., Ltd., and the pre-stained protein molecular weight marker is a product of Baoyijie Biotech Co., Ltd.

[0037] Reagent kits: Plasmid mini-extraction kit and agarose gel DNA recovery kit are products of Transgen Biotech Co., Ltd., and ECL luminescent liquid is a product of Cytiva.

[0038] The primers used in the examples are synthesized by GenScript Biotech Co., Ltd., and related sequencing work is performed.

[0039] The SlBAG1 gene coding region sequence (CDS) in the following examples is shown in SEQ ID NO. 1 of the sequence listing, and the amino acid sequence of the SlBAG1 protein is shown in SEQ ID NO. 5 of the sequence listing.

[0040] The SlBAG3 gene coding region sequence (CDS) in the following examples is shown in SEQ ID NO. 2 of the sequence listing, and the amino acid sequence of the SlBAG3 protein is shown in SEQ ID NO. 6 of the sequence listing.

[0041] The SlBAG3l gene coding region sequence (CDS) in the following examples is shown in SEQ ID NO. 3 of the sequence listing, and the amino acid sequence of the SlBAG3l protein is shown in SEQ ID NO. 7 of the sequence listing.

[0042] The AtBAG3 gene coding region sequence (CDS) in the following examples is shown in SEQ 4, and the amino acid sequence of the AtBAG3 protein is shown in SEQ 8.

[0043] Example 1

[0044] Overexpression of AtBAG3 enhances plant resistance to tomato yellow leaf curl virus

[0045] I. Construction of Atbag3 mutant and AtBAG3 overexpression Arabidopsis materials

[0046] 1. Construction of Arabidopsis Atbag3 mutant using CRISPR / Cas9 gene editing technology.

[0047] Specific guide RNA (gRNA) was designed for Arabidopsis AtBAG3 gene (Gene ID: AT5G07220) using online tool CRISPR-P 2.0, with target sequence: GAGTGGGAGTCTCGACCTGG AGG. The vector containing the gRNA expression frame was transformed into wild-type Arabidopsis Col-0 by Agrobacterium-mediated inflorescence immersion. The T0 generation seeds were harvested and positive seedlings were screened on resistance plates. The target site of T1 generation plants was PCR amplified and sequenced to identify, successfully obtaining a homozygous mutant strain with mutations at the target site, named Atbag3 #9, for subsequent experiments, as shown in Figure 1 .

[0048] 2. The complete coding sequence (CDS) of AtBAG3 gene was obtained by PCR amplification using Arabidopsis cDNA as template.

[0049] The amplification primer pair used was: upstream primer: CCAATTCAGTCGACTGGATCCATGATGAAGATGAATACAGGA; downstream primer: GCTGGGTCTAGATATCTCGAG TCGAAGAATTCCCATTTGAAT. The PCR product was ligated into the pENTR-3C entry vector, and then subjected to LR recombination reaction to connect it to the plant overexpression vector driven by 35S promoter YFP-BAG3 fusion expression. Wild-type Arabidopsis was transformed by Agrobacterium-mediated method, and homozygous overexpression T3 generation strain was obtained by hygromycin screening and Western blotting identification, named YFP-BAG3 #6, for subsequent experiments.

[0050] II. Western blot detection of wild type, Atbag3 mutant and AtBAG3 overexpression Arabidopsis proteins.

[0051] Total proteins were extracted from wild type, Atbag3 mutant and YFP-BAG3 overexpression plants, respectively. The samples were ground into powder by liquid nitrogen, and equal amounts of extracts were subjected to 10% SDS-PAGE electrophoresis separation. Anti-BAG3 antibody was used as the primary antibody, and rabbit-derived secondary antibody was used for detection to verify the gene editing and overexpression effects. The results are shown in Figure 2 Atbag3 mutant AtBAG3 expression was significantly reduced, while clear YFP-BAG3 fusion protein bands were visible in the YFP-BAG3 overexpression lines. The large subunit protein of the ribosome was used as an internal reference.

[0052] III. Verification of AtBAG3 disease resistance function.

[0053] Tomato yellow leaf curl virus was used for infection experiments. First, 20-25 non-toxic whitefly adults were placed on tomato plants infected with TYLCV for 3 days of infection feeding, and then transferred to 4-week-old healthy Arabidopsis plants for 3 days of infection inoculation. Wild type, YFP-AtBAG3 #6 overexpression lines and Atbag3 #9 mutant were set up, with 6 replicates in each group. Total DNA was extracted from systemically infected leaves 21 days after inoculation, and qPCR analysis was performed using virus-specific primers. The primer sequences are shown in Table 1:

[0054] Table 1. List of detection primer sequences

[0055] TYLCV-qF GAAGCGACCAGGCGATATAA TYLCV-qR GGAACATCAGGGCTTCGATA AtACTIN2-qF AGTGGTCGTACAACCGGTATTGT AtACTIN2-qR GATGGCATGAGGAAGAGAGAAAC SlACTIN-qF ACCATGTTCCCAGGTATTGC SlACTIN-qR GCATCTCTGGTCCAGTAGGAA

[0056] YFP-AtBAG3 overexpression plants showed obvious hypersensitive response, while wild type and Atbag3 mutant had fewer necrotic spots and weaker hypersensitive response, thus limiting the ability of the virus to move. The results are shown in Figure 3 qPCR analysis showed that the virus accumulation in YFP-AtBAG3 overexpression plants was significantly lower than that in wild type, while the virus accumulation in Atbag3 mutant was significantly higher than that in wild type. The results are shown in Figure 4 The above results show that overexpression of AtBAG3 can significantly enhance the resistance of Arabidopsis to TYLCV, reduce virus replication and proliferation, and knockout of AtBAG3 gene increases the susceptibility of plants to TYLCV.

[0057] Example 2

[0058] Gene knockout tomato SlBAG1 / 3 / 3-like (SlBAG1 / 3 / 3l) increases susceptibility to tomato yellow leaf curl virus

[0059] I. Construction of Slbag1 / 3 / 3l triple mutant tomato material

[0060] 1. Constructing tomato Slbag1 / 3 / 3l triple mutant by CRISPR / Cas9 gene editing technology. Specific guide RNA (gRNA) was designed for the coding region of tomato SlBAG1 (Gene ID: Solyc03g026220.3.1), SlBAG3 (Gene ID: Solyc06g035720.3.1) and SlBAG3l (Gene ID: Solyc08g080320.3.1) genes, and the target sequences are as follows:

[0061] SlBAG1: TTAACCCGGACCCGAATCGGAGG;

[0062] SlBAG3: AGATGTTGAGCGGTCCAACTGGG;

[0063] SlBAG3l: TCTTCAGTATGTAATCCAGTTGG.

[0064] The binary vector PV58KN-SlBAG1 / 3 / 3l containing the above gRNA expression frame was transformed into tomato cultivar (Micro-Tom) by Agrobacterium-mediated method. After harvesting T0 generation seeds, positive transformation seedlings were obtained by screening on medium containing hygromycin. The target site of T1 generation plants was amplified by PCR and sequenced, and homozygous mutant lines with editing at three target sites were screened for subsequent experiments. The mutation type of the target site was verified by sequencing, and the results are shown in Figure 5 .

[0065] Under normal growth conditions, no obvious phenotypic differences were observed between Slbag1 / 3 / 3l mutant plants and wild type tomatoes, and the results are shown in Figure 6 . This result shows that the knockout of SlBAG1 / 3 / 3l genes does not affect the basic growth and development of tomatoes.

[0066] II. Verification of SlBAG1 / 3 / 3l disease resistance function

[0067] Tomato yellow leaf curl virus resistance experiment was carried out by whitefly-mediated inoculation method. The specific steps are as follows: 20-25 virus-free adult whiteflies were placed on tomato plants infected with TYLCV and fed for 3 days to obtain toxins. Then, the toxinized whiteflies were transferred to 4-week-old healthy wild type and Slbag1 / 3 / 3l tomato mutant plants for inoculation and feeding for 3 days. Eight biological replicates were set for each genotype.

[0068] At 14 days post inoculation, the systemically infected leaves of tomato plants were collected and total DNA was extracted. The viral DNA accumulation in the plants was detected by quantitative PCR. The primer sequences used in qPCR are shown in Table 1. The tomato SlACTIN gene was used as an internal control for normalization.

[0069] Disease symptom observation: At 14 days post inoculation, wild type plants showed typical necrotic spots and chlorosis symptoms, which are usually associated with the activation of local defense responses. In contrast, Slbagl / 3 / 3l mutant plants did not show necrotic symptoms, but exhibited significant leaf curling and growth retardation, as shown in Figure 7 The symptoms indicated that the virus had systemically infected the plants and affected the normal development of the plants. Compared with the wild type, the symptoms of Slbagl / 3 / 3l plants indicated that the plants had reduced resistance to the virus.

[0070] Virus titer quantification: The results of qPCR analysis are shown in Figure 8 The virus accumulation in Slbagl / 3 / 3l mutant plants was significantly higher than that in wild type plants.

[0071] The above results indicated that knocking out SlBAGl, SlBAG3 and SlBAG3l genes reduced the resistance of tomato to TYLCV, leading to increased virus susceptibility and enhanced virus replication. This proved that SlBAGl / 3 / 3l genes are positive regulators of tomato resistance to TYLCV.

[0072] Example 3

[0073] Tomato yellow leaf curl virus infection induces local cell death in plants

[0074] I. TYLCV infection promotes the cleavage of tomato SlBAGl / 3 / 3l proteins

[0075] In view of the significant difference in necrotic phenotype between wild type and Slbagl / 3 / 3l mutant plants after TYLCV infection, we further analyzed whether BAG3 proteins directly mediate cell death. Western blot analysis was performed on TYLCV-infected and control-treated tomato plants using BAG3-specific antibodies. The results are shown in Figure 9 A clear specific band appeared below the main SlBAGl / 3 / 3l protein band at about 15 kilodaltons in the TYLCV-infected samples, but not in the control and Slbagl / 3 / 3l mutant materials. This result indicated that TYLCV infection specifically induced proteolytic cleavage of SlBAGl, SlBAG3 and SlBAG3l proteins, producing a cleavage product with a molecular weight of about 15 kilodaltons.

[0076] II. The N-terminal domain of SlBAG1 / 3 / 3l protein is the key functional fragment inducing cell death.

[0077] Based on the molecular structure of BAG3 protein, which contains a ubiquitin-like domain at its N-terminus and a BAG domain at its C-terminus, and both domains have a theoretical molecular weight close to 15 kilodaltons, we speculate that the above-mentioned cleavage products may be one of the functional domains and may directly induce cell death.

[0078] To verify this hypothesis, we constructed truncated expression vectors for the N-terminal domain of tomato SlBAG1, SlBAG3, and SlBAG3l proteins (amino acids 1-122 of the N-terminal of SlBAG1 / 3 / 3l, named SlBAG1-N, SlBAG3-N, and SlBAG3l-N, respectively) and performed transient expression in N. benthamiana leaves. The experimental results are shown in Figure 10-12 : The expression of SlBAG1-N, SlBAG3-N, and SlBAG3l-N can effectively induce cell death. This result clearly shows that the N-terminal domain of the BAG protein cleavage product produced after TYLCV infection is the key functional fragment for BAG3-mediated programmed cell death.

[0079] III. The cell death induced by BAG3-N is evolutionarily conserved in monocotyledonous plants

[0080] To evaluate whether the function of BAG3-N-induced cell death is evolutionarily conserved, we performed cross-species sequence alignment and identified the homologous domain of BAG3-N in various plants, including the monocotyledonous plants rice (Oryza sativa, OsBAG3) and corn (Zea mays, ZmBAG3).

[0081] Further, we performed transient expression of the coding sequences of OsBAG3-N and ZmBAG3-N in N. benthamiana leaf cells. The experiment confirmed that both OsBAG3-N and ZmBAG3-N can induce cell death ( Figure 13-15 ). This result shows that the cell death signaling pathway mediated by BAG3-N is conserved in monocotyledonous and dicotyledonous plants. This conservation suggests that the strategy of using BAG3-N to trigger the necrotic response to enhance plant disease resistance has the potential to be applied to various crops, including rice and corn.

Claims

1. A plant gene conferring resistance to Tomato yellow leaf curl virus, characterized in that, The gene is a SlBAG1 gene, a SlBAG3 gene or a SlBAG3l gene. The base sequence of the SlBAG1 gene is shown in SEQ ID NO. 1 in the sequence listing. The base sequence of the SlBAG3 gene is shown in SEQ ID NO. 2 in the sequence listing. The base sequence of the SlBAG3l gene is shown in SEQ ID NO. 3 in the sequence listing.

2. A gene for resistance to Tomato yellow leaf curl virus in a plant according to claim 1, characterized in that, The plant is a dicotyledon.

3. A gene for resistance to Tomato yellow leaf curl virus in a plant according to claim 2, characterized in that, The dicotyledon is Arabidopsis thaliana, tomato or tobacco.

4. The gene for resistance to Tomato yellow leaf curl virus of a plant according to claim 1, characterized in that, The plant is a monocotyledon.

5. The gene of a plant according to claim, which is characterized in that, The monocotyledon is rice or corn.