CIC rearrangement sarcoma detection primer group, kit and application of CIC rearrangement sarcoma detection primer group

By designing a primer set for CIC rearrangement sarcoma detection and combining multiplex fluorescent PCR with capillary electrophoresis, the problem of difficulty in efficiently detecting the characteristic fusion genes of CIC rearrangement sarcoma in existing technologies has been solved, achieving high sensitivity and specificity in detection, and is suitable for the clinical auxiliary diagnosis of CIC rearrangement sarcoma.

CN121065340AActive Publication Date: 2025-12-05BEIJING CHILDRENS HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
CN202511324368.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-17
Publication Date
2025-12-05
Estimated Expiration
2045-09-17

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently, sensitively, and economically detecting the characteristic fusion genes of CIC rearrangement sarcomas, especially CIC::DUX4, CIC::NUTM1, and CIC::FOXO4, leading to difficulties in clinical diagnosis.

Method used

A primer set for detecting CIC rearranged sarcomas was designed, including multiple primer combinations. Combining multiplex fluorescent PCR and high-resolution capillary electrophoresis, it can simultaneously detect 20 variant types of gene fusions from three major categories: CIC::DUX4, CIC::NUTM1, and CIC::FOXO4. The detection limit is ≤10 copies, and the detection time is no more than 240 minutes.

Benefits of technology

It achieves high sensitivity and specificity in the detection of CIC rearranged sarcomas, with 100% consistency between the detection results and morphological diagnosis. It is applicable to formalin-embedded paraffin tumor samples, simplifies the detection process, and reduces costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121065340A_ABST
    Figure CN121065340A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene detection, in particular to a CIC rearrangement sarcoma detection primer group, a kit and application of the CIC rearrangement sarcoma detection primer group. The primer combination provided by the invention has good detection sensitivity and specificity. The primer combination is jointly applied to CIC rearrangement sarcoma detection through multiple fluorescent PCR and a high-resolution capillary tube, 20 variation types fused by three types of genes including CIC: DUX4, CIC: NUTM1 and CIC: FOXO4 can be detected at a time, the lower detectable limit is smaller than or equal to 10 copies, and the detection time does not exceed 240 minutes. Besides, 30 real tumor samples are tested by using the primer combination disclosed by the invention, the detection result is completely matched with the morphological diagnosis result, and the consistency reaches 100%; and further performing Sanger sequencing on the PCR amplification product of the positive sample, wherein the Sanger sequencing passes the verification.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene detection, and in particular to a CIC rearrangement sarcoma detection primer set, a kit and application thereof. BACKGROUND

[0002] CIC rearrangement sarcoma is a rare and highly invasive malignant small round cell sarcoma, which belongs to a kind of Ewing sarcoma. Its typical histological features include: tumor cells are mainly small to medium-sized round cells, arranged closely, with vacuolated nuclei, obvious nucleoli, and little cytoplasm and acidophilic cytoplasm; part of the cytoplasm is relatively rich, the cells are epithelioid or spindle-shaped, and nuclear polymorphism and high mitotic figures are common. In addition, map-like necrosis and focal mucoid stroma are often seen, and a few areas may also appear spindle cells, clear cells or pleomorphic giant cells. Due to the rarity of the tumor, poor prognosis and complex and diverse histomorphology, it has certain similarity with Ewing sarcoma, EWSR1 non-ETS fusion round cell sarcoma, sarcoma with BCOR genetic changes, desmoplastic small round cell tumor, NUT cancer and other round cell or spindle cell sarcomas in histomorphology and immunohistochemical expression characteristics, so the difficulty of clinical diagnosis and pathological differential diagnosis is great, and therefore a sensitive and efficient detection method is urgently needed to assist in diagnosis.

[0003] Such sarcomas have characteristic fusion genes, mainly CIC::DUX4, CIC::NUTM1 and CIC::FOXO4, which have important diagnostic value. At present, the main methods for detecting tumor gene variation in clinical practice include fluorescence in situ hybridization (FISH), polymerase chain reaction (PCR) and next-generation sequencing technology. FISH is suitable for single fusion gene detection, but not suitable for multiple gene variation screening; although next-generation sequencing covers a wide range, it has high cost, complex process and long cycle, and still has certain limitations in clinical routine application. In contrast, the PCR method amplifies specific nucleotide sequences by targeting primers and detects them by means of fluorescence signals or gel electrophoresis, which has the advantages of simple operation, high sensitivity and strong specificity. At present, there are few studies on the detection of CIC rearrangement sarcoma, and no PCR kit product for accurately detecting CIC rearrangement sarcoma has been found.

[0004] Therefore, the present application is proposed. SUMMARY

[0005] To solve the above technical problems, the present application provides a CIC rearrangement sarcoma detection primer set, a kit and application thereof.

[0006] Specifically, the technical scheme of the present application is as follows: In a first aspect, the present application provides a CIC rearranged sarcoma detection primer set, comprising at least one of primer set A, primer set B, primer set C, primer set D, primer set E, and primer set F as shown below: The primer set A comprises upstream CIC primer 1, upstream CIC primer 2, downstream DUX4 primer 3, and downstream DUX4 primer 4. The primer set B comprises upstream CIC primer 5, downstream DUX4 primer 6, downstream DUX4 primer 7, and downstream DUX4 primer 8. The primer set C comprises upstream CIC primer 9, downstream DUX4 primer 10, downstream DUX4 primer 11, and downstream DUX4 primer 12. The primer set D comprises upstream CIC primer 13 and downstream DUX4 primer 14. The primer set E comprises upstream CIC primer 15, upstream CIC primer 16, upstream CIC primer 17, upstream CIC primer 18, downstream NUTM1 primer 19, downstream NUTM1 primer 20, downstream NUTM1 primer 21, and downstream NUTM1 primer 22. The primer set F comprises upstream CIC primer 23, upstream CIC primer 24, downstream FOXO4 primer 25, downstream FOXO4 primer 26, and downstream FOXO4 primer 27. The nucleotide sequences of the upstream CIC primer 1, the upstream CIC primer 2, the downstream DUX4 primer 3, the downstream DUX4 primer 4, the upstream CIC primer 5, the downstream DUX4 primer 6, the downstream DUX4 primer 7, the downstream DUX4 primer 8, the upstream CIC primer 9, the downstream DUX4 primer 10, the downstream DUX4 primer 11, the downstream DUX4 primer 12, the upstream CIC primer 13, the downstream DUX4 primer 14, the upstream CIC primer 15, the upstream CIC primer 16, the upstream CIC primer 17, the upstream CIC primer 18, the downstream NUTM1 primer 19, the downstream NUTM1 primer 20, the downstream NUTM1 primer 21, the downstream NUTM1 primer 22, the upstream CIC primer 23, the upstream CIC primer 24, the downstream FOXO4 primer 25, the downstream FOXO4 primer 26, and the downstream FOXO4 primer 27 are sequentially shown in SEQ ID NO. 01-SEQ ID NO. 27.

[0007] Preferably, in the present application, the primer set comprises primer set A, primer set B, primer set C, primer set D, primer set E, and primer set F.

[0008] The above primer set provided by the present application is designed on the basis of the characteristic fusion genes CIC::DUX4, CIC::NUTM1, and CIC::FOXO4 of CIC rearranged sarcoma.

[0009] Although the literature reports that CIC rearranged sarcomas carry characteristic fusion genes, mainly including CIC::DUX4, CIC::NUTM1 and CIC::FOXO4 three types, which have important auxiliary diagnostic value. However, in clinical research, even if the same type of tumor or even the same fusion gene is suffered, the relevant fusion sequences in different individuals are still different. Therefore, the fusion information reported in the literature cannot be directly used to guide the design of amplification primers to construct products.

[0010] The prior art does not disclose the characteristic information and combination mode of the gene segment where the tumor fusion gene prone to breakage and fusion site is located. The present application obtains 20 combination types of the above three fusion genes at the RNA level by studying the region information of the breakage and fusion site prone to the tumor fusion gene, based on the differences in combination mode and combination characteristics, and further combines the characteristics of the amplicon in the PCR amplification product in the clinical field, and finally designs the above primer group.

[0011] The above primer combination provided by the present application has good detection sensitivity and specificity. The above primer combination is used for combined detection of CIC rearranged sarcoma, and through the combination of specific fluorescent groups and multiple primer groups, 20 variation types of CIC::DUX4, CIC::NUTM1 and CIC::FOXO4 can be detected at one time, the detection lower limit is ≤10 copies, the detection time is not more than 240 minutes, and the application prospect is good.

[0012] In the second aspect, the present application provides the use of the above CIC rearranged sarcoma detection primer group in the preparation of a reagent or kit for detecting or diagnosing CIC rearranged sarcoma.

[0013] In the third aspect, the present application provides a CIC rearranged sarcoma detection kit, which comprises the CIC rearranged sarcoma detection primer group of the first aspect.

[0014] Preferably, in the present application, the kit further comprises a fluorescent group; the fluorescent group is selected from at least one of FAM, VIC, TAMRA, ROX, HEX, TET, JOE, NED, Cy5 and Cy3.

[0015] Preferably, in the present application, the kit further comprises a positive control; the positive control is a plasmid standard containing a fusion gene fragment.

[0016] Preferably, the fusion gene fragment comprises at least one of the following gene fragments: C1 type CIC::DUX4 fusion gene fragment, the nucleotide sequence of which is shown in SEQ ID NO. 30; A CIC::DUX4 fusion gene fragment of type C3, the nucleotide sequence of which is shown as SEQ ID NO. 31; A CIC::DUX4 fusion gene fragment of type C5, the nucleotide sequence of which is shown as SEQ ID NO. 32; A CIC::DUX4 fusion gene fragment of type C4, the nucleotide sequence of which is shown as SEQ ID NO. 33; A CIC::NUTM1 fusion gene fragment of type C12, the nucleotide sequence of which is shown as SEQ ID NO. 34; A CIC::FOXO4 fusion gene fragment of type C18, the nucleotide sequence of which is shown as SEQ ID NO. 35.

[0017] Preferably, in the present application, the kit further comprises a primer set G of a reference gene HPRT1, the primer set G comprising an upstream primer 28 and a downstream primer 29; the nucleotide sequences of the upstream primer 28 and the downstream primer 29 are shown as SEQ ID NO. 28-SEQ ID NO. 29 in turn.

[0018] Preferably, in the present application, the kit further comprises a negative control, a PCR reaction buffer, a nucleic acid template and ddH2O.

[0019] In a fourth aspect, the present application provides a CIC rearranged sarcoma detection device, which uses the CIC rearranged sarcoma detection kit to amplify the sample to be tested; then determines the molecular weight of the amplification product; and finally determines whether the sample to be tested is a CIC rearranged sarcoma based on the determination result of the molecular weight. Advantages

[0020] The present application provides a CIC rearranged sarcoma detection primer set, a kit and an application thereof, the primer set comprising at least one of primer set A, primer set B, primer set C, primer set D, primer set E and primer set F. The above primer combination provided by the present application has good detection sensitivity and specificity. In a more specific embodiment, the present application combines the above primer combination for CIC rearranged sarcoma detection through multiplex fluorescent PCR and high-resolution capillary, which can detect 20 types of gene fusion variations of 3 major categories of CIC::DUX4, CIC::NUTM1 and CIC::FOXO4 at one time, the detection lower limit is ≤10 copies, and the detection time is not more than 240 minutes. In addition, 30 real tumor samples are tested by the primer combination of the present application, and the detection results are consistent with the morphological diagnosis results, and the consistency reaches 100%; further Sanger sequencing of the PCR amplification product of the positive sample is verified. BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions of the present application or the prior art, the drawings required to be used in the embodiments or prior art description will be described below.

[0022] Figure 1 Figure for 20 CIC rearranged tumor molecular genetic types determined in Example 1.

[0023] Figure 2 Detection results of C1 type CIC::DUX4 fusion gene in Example 2.

[0024] Figure 3 Detection results of C2 type CIC::DUX4 fusion gene in Example 2.

[0025] Figure 4 Detection results of C3 type CIC::DUX4 fusion gene in Example 2.

[0026] Figure 5 Detection results of C4 type CIC::DUX4 fusion gene in Example 2.

[0027] Figure 6 Detection results of C5 type CIC::DUX4 fusion gene in Example 2.

[0028] Figure 7 Detection results of C6 type CIC::DUX4 fusion gene in Example 2.

[0029] Figure 8 Detection results of C7 type CIC::DUX4 fusion gene in Example 2.

[0030] Figure 9 Detection results of C8 type CIC::DUX4 fusion gene in Example 2.

[0031] Figure 10 Detection results of C9 type CIC::DUX4 fusion gene in Example 2.

[0032] Figure 11 Detection results of C10 type CIC::DUX4 fusion gene in Example 2.

[0033] Figure 12 Detection results of C11 type CIC::DUX4 fusion gene in Example 2.

[0034] Figure 13 Detection results of C12 type CIC::NUTM1 fusion gene in Example 2.

[0035] Figure 14 Detection results of C13 type CIC::NUTM1 fusion gene in Example 2.

[0036] Figure 15 Detection result of C14 type CIC::NUTM1 fusion gene in Example 2.

[0037] Figure 16 Detection result of C15 type CIC::NUTM1 fusion gene in Example 2.

[0038] Figure 17 Detection result of C16 type CIC::NUTM1 fusion gene in Example 2.

[0039] Figure 18 Detection result of C17 type CIC::NUTM1 fusion gene in Example 2.

[0040] Figure 19 Detection result of C18 type CIC::FOXO4 fusion gene in Example 2.

[0041] Figure 20 Detection result of C19 type CIC::FOXO4 fusion gene in Example 2.

[0042] Figure 21 Detection result of C20 type CIC::FOXO4 fusion gene in Example 2.

[0043] Figure 22 Detection result of determination of kit detection performance in Example 3. DETAILED DESCRIPTION

[0044] The technical solutions provided by the present application will be described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the present application. If not specifically indicated, the experimental methods used in the examples are conventional methods; the materials, reagents, etc. used can be obtained from commercial channels. Example 1

[0045] This example provides a CIC sarcoma detection kit, and the process of obtaining the kit is described.

[0046] The present application integrates literature reports and more than one hundred cases of CIC rearrangement sarcoma fusion gene data in local laboratory, uniformly references genome version and transcript information (CIC: NM_015125; DUX4: NM_001306068; NUTM1: NM_001284292; FOXO4: NM_005938), removes unreliable cases, and mainly divides three kinds of fusion genes (CIC::DUX4, CIC::NUTM1 and CIC::FOXO4) into 20 combination types at the RNA level, which are specifically shown in Table 1. Figure 1 .

[0047] On the basis of the 20 types of variations determined above, the application further adopts various measures to design detection primer groups and conduct experimental verification to meet the detection requirements of highly degraded and fragmented nucleic acids of the most common formalin-embedded paraffin (FFPE) tumor samples in clinical practice. In addition to meeting the specificity and compatibility of conventional multiplex primers, the application also requires the primers to meet the following conditions: ① The upstream primer must be located within the range of the upstream fusion gene, and the downstream primer must be located within the range of the downstream fusion partner gene. The primers cannot cross the breakpoint of the fusion of two genes to prevent the insertion and deletion of bases at this position from affecting the amplification efficiency; ② The primers used for the same gene in different fusion types should be as simple and consistent as possible to minimize non-specific cross-reactions; ③ Each tube primer combination can amplify all target fragments in the tube; ④ The total number of primers should be as small as possible to reduce unnecessary cross-reactions; ⑤ Each primer has a difference in amplification product of greater than or equal to 2 bp to meet the resolution requirements of high-resolution capillary electrophoresis instruments; ⑥ The amplification fragment should be greater than 100 bp to avoid primer dimer signal interference; ⑦ Each tube primer combination has no non-specific amplification with human genomic DNA. In addition, formalin-embedded paraffin tumor samples are the most common sample type in clinical practice, and their nucleic acids, especially RNA, are highly degraded and fragmented. In order to meet the detection requirements of such samples, the application limits the amplification fragment to be less than 350 bp.

[0048] According to the above principles, the application designs and optimizes multiple groups of primer combinations, and finally passes a multiplex primer group combined with a specific fluorescent group to detect 20 types of variation of 3 major gene fusions (Table 1) at one time. The minimum detectable lower limit is 10 copies, and the shortest detection time is 240 minutes. The kit is designed according to the variation type to detect the expression of CIC::DUX4 fusion (C1-C11 type) in tube A-D, CIC::NUTM1 (C12-C17 type) in tube E, CIC::FOXO4 (C18-C20 type) fusion gene in tube F, and housekeeping gene HPRT1 in tube G, and the nucleic acid quality of the quality control sample.

[0049] Table 1 Design of detection kit and primer sequences used

[0050] Table 2 Reaction system of each tube (25 μL as an example)

[0051] The kit also includes positive and negative controls. The negative control is pure water, and the positive control is a plasmid standard (1000 copies / μl) inserted with a fusion gene fragment. The gene variation and its inserted nucleotide sequence corresponding to each tube positive control are as follows: Tube A, C1 type CIC::DUX4 fusion: 5'-cccgaggaccccacctcgcccaagcgcaagatgagaagacgctccagctgcagctcggagcccaacacccccaagagtgccaagtgcgagggggacatcttcacctttgaccgtacaggtacagaagccgaggacgtgcttggggagctagagtatgacaaggtgccatactcctccctgcggcgcaccctggaccagcgccgggccctggtcatgcagctctttcaggaccatggcttcttcccgtcagcccaggccacagccgccttccaggcccgctatgcagacatctttccctccaaggtctaggcccggtgagagactccactccgcggagaactgcctttctttcctgggcatcccggggatcccagagccggcccaggtaccagcagacctgcgcgcagtgcgcaccccggctgacgtgcaagggagctcgctggcctctctgtgcccttgttcttccgtgaaattctggctgaatgtctccccccaccttccgacgctgtctaggcaaacctggattagagttacatctcctggatgattagttcagagatatattaaaatgccccctcc-3'.

[0052] Tube B, Type C3 CIC::DUX4 fusion: 5'-gcccgctatgcagacatctttccctccaaggtttgtctgcagttgaagatccgtgaggtgcgccagaagatcatgcaggctgccactcccacggagcagccccctggagctgaggctcctctccctgtaccgccccccactggcaccgctgctgcccctgcccccactcccagccccgcagggggccctgaccccacctcacccagctcggactctggcacggcccaggctgccccgccactgcctccacccccagagtcggggcctggacagcctggctgggagggggctccccagccctcccccccaccgccctggtctgcactcccctgcggcctgctgctggatgagctcctggcgagcccggagtttctgcagcaggcgcaacctctcctagaaacggaggccccgggggagctggaggcctcggaagaggccgcctcgctggaagcacccctcagcgaggaagaataccgggctctgctggaggagctttaggacgcggggttgggacggggtcgggtggttcggggcagggcggtggcctctctttcgcggggaacacctggctggctacggaggggcgtgtctccgccccgccccctccaccgggctgaccggcctgggattcctgccttcta-3'.

[0053] Tube C, C5 type CIC::DUX4 fusion: 5'-cccgaggaccccacctcgcccaagcgcaagatgagaagacgctccagctgcagctcggagcccaacacccccaagagtgccaagtgcgagggggacatcttcacctttgaccgtacaggtacagaagccgaggacgtgcttggggagctagagtatgacaaggtgccatactcctccctgcggcgcaccctggaccagcgccgggccctggtcatgcagctctttcaggaccatggcttcttcccgtcagcccaggccacagccgccttccaggcccgctatgcagacatctttccctccaaggtttgtctgcagttgaagatccgtgaggtgcgccagaagatcatgcaggcccccggcgggggtcaccctgctccctcgtgggtcgccttcgcccacaccggcgcgtggggaacggggcttcccgcaccccacgtgccctgcgcgcctggggctctcccacagggggctttcgtgagccaggcagcgagggccgcccccgcgctgcagcccagccaggccgcgccggcagaggggatctcccaacctgccccggcgcgcggggatttcgcctacgccgccccggctcctccggacggggcgctctcccaccctcaggctcctcggtggcctccgcac-3'.

[0054] Tube D, CIC::DUX4 fusion of type C4: 5'-ggcgcaccctggaccagcgccgggccctggtcatgcagctctttcaggaccatggcttcttcccgtcagcccaggccacagccgccttccaggcccgctatgcagacatctttccctccaaggtttgtctgcagttgaagatccgtgaggtgcgccagaagatcatgcaggctgccactcccacggagcagccccctggagctgaggctcctctccctgtaccgccccccactggcaccgctgctgcccctgcccccactcccagccccgcagggggccctgaccccacctcacccagctcggactctgggacccgcagcgcgacggcctgccgggcccctgcgcggtggcacagcctgggcccgctcaagcggggccgcagggccaaggggtgcttgcgccacccacgtcccaggggagtccgtggtggggctggggccggggtccccaggtcgccggggcggcgtgggaaccccaagccggggcagctccacctccccagcccgcgcccccggacgcctccgcctccgcgcggcaggggcagatgcaaggcatcccggcgccctcccaggcgctccaggagccggcgccctggtctgcactcccctgcggcctgctgctggatgagctcctggcga-3'.

[0055] Tube E, CIC::NUTM1 fusion of type C12: 5'-cctgctgaggagcggaccagcgccaagggccctgagaccatggccagcaaattccccagctcatcttcagactggcgcgtccctgggcagggcctggagaatcgtggggagcctcccactcctcccagcccggccccagctccagctgtagcccctggtggcagcagcgagagcagcagtgggcgggcagccggggacaccccggagcgcaaggaggcggctggtactggcaagaaggtgaaggtgcggcccccgcccctgaagaagacctttgactctgtggacaacagggtcctgtcagaagtggacttcgaagagcgctttgctgagttgcctgagtttcggcctgaggaggtgctgccctcccccaccctgcagtctctggccacctcaccccgggccatcctgggctcttaccgcaagaagaggaagaactccacggtgtacattccgaagaaggcagcctccaagacacgggccccccgccggcgtcagcgtaaagcccagagacctcctgctcctgaggcacccaaggagatcccaccagaagctgtgaaggagtatgttgacatcatggaatggctggtggggactcacttggccactggggagtcagatggaaaacaagaggaagaagggcagcagcaggaggaggaagggatgtatccagatccaggtctcctgagctacatcaatgagctgtgttctcagaaggtctttgtctccaa-3'.

[0056] Tube F, CIC :: FOXO4 fusion in C18 type: 5'-gcgggcagccggggacaccccggagcgcaaggaggcggctggtactggcaagaaggtgaaggtgcggcccccgcccctgaagaagacctttgactctgtggacaacagggtcctgtcagaagtggacttcgaagagcgctttgctgagttgcctgagtttcggcctgaggaggtgctgccctcccccaccctgcagtctctggccacctcaccccgggccatcctgggctcttaccgcaagaagaggaagaactccacggacctggattcagcacccgaggaccccacctcgcccaagcgcaagatgagaagacgctccagctgcagctcggagcccaacacccccaagagtgccaagtgcgagggggacatcttcacctttgaccgtacaggtacagaagccgaggacgtgcttggggagctagagtatgacaaggtgccatgtaaagcccccaagaagaaaccatctgtgctgccagctccacccgaaggtgccactccaacgagccctgtcggccactttgccaagtggtcaggcagcccttgctctcgaaaccgtgaagaagccgatatgtggaccaccttccgtccacgaagcagttcaaatgccagcagtgtcagcacccggctgtcccccttgaggccagagtctgaggtgctggcggaggaaataccagcttcagtcagcagttatgcagggggtgtccctcccaccctcaatgaaggt-3'.

[0057] The PCR amplification procedure used for detection is shown in Table 3 below: Table 3 Amplification procedure

[0058] The resulting PCR amplification products were electrophoresed on an ABI 3500 Genetic Analyzer (high resolution capillary electrophoresis instrument) with HiDi and Liz600 internal size standards, and the size of the amplified products was analyzed using Gene Mapper software.

[0059] The detection results and their interpretation criteria are shown in Table 4. First, check if the G tube has a 190 bp ROX amplification peak. If not, the nucleic acid quality control fails and the nucleic acid needs to be extracted again for the experiment. If yes, the nucleic acid quality control is passed. Second, check if the A-F tube has an amplification peak greater than 100 bp of the corresponding fluorescent color: A tube, FAM fluorescent product peak corresponds to C1 / C2 / C8 type CIC::DUX4 fusion; B tube, FAM fluorescent product peak corresponds to C3 / C10 / C11 type CIC::DUX4 fusion; C tube, FAM fluorescent product peak corresponds to C5 / C6 / C7 type CIC::DUX4 fusion; D tube, FAM fluorescent product peak corresponds to C4 / C9 type CIC::DUX4 fusion; E tube, VIC fluorescent product peak corresponds to C12 / C13 / C14 / C15 / C16 / C17 type CIC::NUTM1 fusion; F tube, TAMRA fluorescent product peak corresponds to C18 / C19 / C20 type CIC::FOXO4 fusion. If A-F tube has no product peak greater than 100 bp of the corresponding fluorescent color, it is judged as negative, and no related gene fusion is detected.

[0060] Table 4 Result interpretation criteria Example 2

[0061] In this example, the performance of the kit provided in Example 1 is detected.

[0062] The plasmids inserted with the corresponding fusion gene fragments (C1-C20) are used as fusion gene detection standards, and the standard solution (1, 10, 100, 1000 copies / μl) is configured as the amplification template. The kit and its detection program are used to detect 10 copies of the fusion gene.

[0063] The detection results of C1-C20 types are shown in Table 4, respectively. Figures 2-21

[0064] Figure 2 The results show that the kit has good detection effect for C1 type CIC::DUX4 fusion gene in the range of 1-100 copies. The standard product tested is 250 bp FAM peak, and the minimum detection limit is 1 copy.

[0065] Figure 3 The results show that the kit has good detection effect for C2 type CIC::DUX4 fusion gene in the range of 1-100 copies. The standard product tested is 317 bp FAM peak, and the minimum detection limit is 10 copies.

[0066] Figure 4 ​Results show: the kit detects C3 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 272bp FAM peak, the minimum detection limit is 10 copies.

[0067] Figure 5 Results show: the kit detects C4 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 344bp FAM peak, the minimum detection limit is 10 copies.

[0068] Figure 6 Results show: the kit detects C5 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 208bp FAM peak, the minimum detection limit is 1 copy.

[0069] Figure 7 Results show: the kit detects C6 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 259bp FAM peak, the minimum detection limit is 10 copies.

[0070] Figure 8 Results show: the kit detects C7 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 135bp FAM peak, the minimum detection limit is 10 copies.

[0071] Figure 9 Results show: the kit detects C8 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 140bp FAM peak, the minimum detection limit is 10 copies.

[0072] Figure 10 Results show: the kit detects C9 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 210bp FAM peak, the minimum detection limit is 1 copy.

[0073] Figure 11 Results show: the kit detects C10 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 123bp FAM peak, the minimum detection limit is 10 copies.

[0074] Figure 12Results show: the kit detects C11 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 194bp FAM peak, the minimum detection limit is 10 copies.

[0075] Figure 13 Results show: the kit detects C12 type CIC::NUTM1 fusion gene in 1-100 copies has good detection effect, using standard test product for 356bp VIC peak, the minimum detection limit is 10 copies.

[0076] Figure 14 Results show: the kit detects C13 type CIC::NUTM1 fusion gene in 1-100 copies has good detection effect, using standard test product for 240bp VIC peak, the minimum detection limit is 10 copies.

[0077] Figure 15 Results show: the kit detects C14 type CIC::NUTM1 fusion gene in 1-100 copies has good detection effect, using standard test product for 301bp VIC peak, the minimum detection limit is 10 copies.

[0078] Figure 16 Results show: the kit detects C15 type CIC::NUTM1 fusion gene in 1-100 copies has good detection effect, using standard test product for 337bp VIC peak, the minimum detection limit is 10 copies.

[0079] Figure 17 Results show: the kit detects C16 type CIC::NUTM1 fusion gene in 1-100 copies has good detection effect, using standard test product for 227bp VIC peak, the minimum detection limit is 1 copy.

[0080] Figure 18 Results show: the kit detects C17 type CIC::NUTM1 fusion gene in 1-100 copies has good detection effect, using standard test product for 285bp VIC peak, the minimum detection limit is 10 copies.

[0081] Figure 19 Results show: the kit detects C18 type CIC::FOXO4 fusion gene in 1-100 copies has good detection effect, using standard test product for 162bp TAMRA peak, the minimum detection limit is 1 copy.

[0082] Figure 20The results show that the kit has good detection effect on C19 type CIC::FOXO4 fusion gene in the range of 1-100 copies, the standard product test product is 290bp TAMRA peak, and the minimum detection limit is 10 copies.

[0083] Figure 21 The results show that the kit has good detection effect on C20 type CIC::FOXO4 fusion gene in the range of 1-100 copies, the standard product test product is 271bp TAMRA peak, and the minimum detection limit is 1 copy. Example 3

[0084] This example uses 30 real tumor samples (21 Ewing sarcoma, 2 sarcoma with BCOR genetic abnormalities, 5 CIC rearrangement sarcoma and 2 EWSR1 non-ETS fusion round cell sarcoma) to test the detection performance of the kit provided in Example 1.

[0085] All samples pass nucleic acid quality control, and 5 CIC rearrangement sarcomas are detected FAM signal product peaks, and the PCR amplification product of the positive sample is subjected to Sanger sequencing, and the results are all CIC::DUX4 fusion, which is consistent with the detection results of the kit, as shown in Figure 22 . Figure 22 The upper graph is the FAM signal peak of the kit detecting 30 samples with CIC::DUX4 fusion, and the lower graph is the Sanger sequencing verification result).

[0086] The histological type of the sample is analyzed, and the histological diagnosis of the positive sample is consistent with CIC rearrangement sarcoma (see Table 5), and the detection results of the remaining cases are all negative.

[0087] Table 5 Detection results of 30 real tumor samples

[0088] The detection results of the kit using 30 tumor samples this time are consistent with the morphological diagnosis results, and the consistency is 100%.

[0089] In summary, the application provides a primer set, a kit and an application for detecting CIC rearrangement sarcoma by using multiplex fluorescent PCR combined with capillary electrophoresis fragment analysis technology, which has the advantages of simple operation, accurate results and economic advantage, and is suitable for clinical auxiliary diagnosis of CIC rearrangement sarcoma, and has good application prospect.

[0090] The above-described embodiments only express several implementation manners of the present application, facilitate concrete and detailed understanding of the technical solutions of the present application, but cannot be understood as a limitation on the patent protection scope of the present application. It should be noted that, for ordinary skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which all belong to the protection scope of the present application.

Claims

1. A CIC rearranged sarcoma detection primer set characterized in that, comprises at least one of primer group A, primer group B, primer group C, primer group D, primer group E, primer group F as shown below; the primer group A comprises upstream CIC primer 1, upstream CIC primer 2, downstream DUX4 primer 3, downstream DUX4 primer 4; the primer group B comprises upstream CIC primer 5, downstream DUX4 primer 6, downstream DUX4 primer 7, downstream DUX4 primer 8; the primer group C comprises upstream CIC primer 9, downstream DUX4 primer 10, downstream DUX4 primer 11, downstream DUX4 primer 12; the primer group D comprises upstream CIC primer 13, downstream DUX4 primer 14; the primer group E comprises upstream CIC primer 15, upstream CIC primer 16, upstream CIC primer 17, upstream CIC primer 18, downstream NUTM1 primer 19, downstream NUTM1 primer 20, downstream NUTM1 primer 21, downstream NUTM1 primer 22; the primer group F comprises upstream CIC primer 23, upstream CIC primer 24, downstream FOXO4 primer 25, downstream FOXO4 primer 26, downstream FOXO4 primer 27; wherein the nucleotide sequences of upstream CIC primer 1, upstream CIC primer 2, downstream DUX4 primer 3, downstream DUX4 primer 4, upstream CIC primer 5, downstream DUX4 primer 6, downstream DUX4 primer 7, downstream DUX4 primer 8, upstream CIC primer 9, downstream DUX4 primer 10, downstream DUX4 primer 11, downstream DUX4 primer 12, upstream CIC primer 13, downstream DUX4 primer 14, upstream CIC primer 15, upstream CIC primer 16, upstream CIC primer 17, upstream CIC primer 18, downstream NUTM1 primer 19, downstream NUTM1 primer 20, downstream NUTM1 primer 21, downstream NUTM1 primer 22, upstream CIC primer 23, upstream CIC primer 24, downstream FOXO4 primer 25, downstream FOXO4 primer 26, downstream FOXO4 primer 27 are sequentially shown as SEQ ID NO. 01-SEQ ID NO.

27.

2. The CIC rearrangement sarcoma detection primer set of claim 1, wherein, comprises primer group A, primer group B, primer group C, primer group D, primer group E and primer group F.

3. Use of the CIC rearranged sarcoma detection primer group of claim 1 or 2 in the preparation of a reagent or kit for detecting or diagnosing CIC rearranged sarcoma.

4. A CIC rearrangement sarcoma detection kit characterized in that, comprises the CIC rearranged sarcoma detection primer group of claim 1 or claim 2.

5. The CIC rearrangement sarcoma detection kit of claim 4, wherein, further comprises a fluorescent group; the fluorescent group is at least one selected from FAM, VIC, TAMRA, ROX, HEX, TET, JOE, NED, Cy5, Cy3.

6. The CIC rearrangement sarcoma detection kit of claim 5, wherein, further comprises a positive control; the positive control is a plasmid standard inserted with a fusion gene fragment.

7. The CIC rearrangement sarcoma detection kit of claim 6, wherein, the fusion gene fragment comprises at least one of the gene fragments as shown below: a C1 type CIC::DUX4 fusion gene fragment, the nucleotide sequence of which is shown as SEQ ID NO. 30; A CIC::DUX4 fusion gene fragment of type C3, the nucleotide sequence of which is shown as SEQ ID NO. 31; A CIC::DUX4 fusion gene fragment of type C5, the nucleotide sequence of which is shown as SEQ ID NO. 32; A CIC::DUX4 fusion gene fragment of type C4, the nucleotide sequence of which is shown as SEQ ID NO. 33; A CIC::NUTM1 fusion gene fragment of type C12, the nucleotide sequence of which is shown as SEQ ID NO. 34; A CIC::FOXO4 fusion gene fragment of type C18, the nucleotide sequence of which is shown as SEQ ID NO.

35.

8. The CIC rearrangement sarcoma detection kit of claim 7, wherein, The primer set G of the internal reference gene HPRT1 is also included, and the primer set G includes an upstream primer 28 and a downstream primer 29; the nucleotide sequences of the upstream primer 28 and the downstream primer 29 are shown as SEQ ID NO. 28-SEQ ID NO.

29.

9. The CIC rearrangement sarcoma detection kit of claim 8, wherein, A negative control, a PCR reaction buffer, a nucleic acid template and ddH2O are also included.

10. A CIC rearranged sarcoma detection device characterized by, The device uses the CIC rearrangement sarcoma detection kit of any one of claims 4-9 to amplify the sample to be tested; determines the molecular weight size of the amplification product; and determines whether the sample to be tested is a CIC rearrangement sarcoma based on the determination result of the molecular weight size.

Citation Information

Patent Citations

  • Sarcoma fusion gene and / or mutation joint detection primer group and kit

    CN112094915A

  • Primer composition for detecting sarcoma fusion gene mutation, kit and application

    CN113005200A

  • Composition for simultaneously detecting multiple gene fusion of sarcoma and application of composition

    CN117904294A

  • BCOR-accompanying genetics abnormal sarcoma detection primer group, kit and application of BCOR-accompanying genetics abnormal sarcoma detection primer group

    CN118291631A

  • Primer group and kit for detecting EWSR1 non-ETS fused round cell sarcoma and application of primer group and kit

    CN120249492A