Primer, probe, reagent and kit for detecting mealybug gluteus

Abstract

The invention relates to the technical field of molecular diagnosis of insects, in particular to a primer, a probe, a reagent and a kit for detecting mealybug buttocks. The primer, the probe, the reagent and the kit disclosed by the invention are used for carrying out molecular detection on the mealybug buttocks, the specificity is high, the sensitivity can be as low as the pictogram level, and the occurrence of the mealybug buttocks can be investigated and confirmed in time on site.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of insect molecular diagnosis, in particular to a primer and probe for detecting Planococcus minor, reagent and kit. BACKGROUND

[0002] Planococcus minor belongs to the Planococcus genus of the Pseudococcidae family of the Homoptera order, and is a major pest of tropical and subtropical ornamental plants and fruits. It mainly damages the tender parts of host plants such as stems, leaves, flowers, and fruits. Light yellowing of leaves, severe withering and shedding, poor plant development, and serious impact on the economic value of fruits and the appearance of ornamental plants are caused by P. minor, which is a plant quarantine harmful organism in China. P. minor has already entered China. P. minor is similar in morphology to P. kraunokia and P. citri, and often occurs mixed on a host, making it difficult to distinguish between the two, so it is necessary to establish a rapid and accurate method for identifying P. minor.

[0003] Currently, the main technology for high-sensitivity molecular detection is fluorescence quantitative PCR. This technology has been very mature after more than 20 years of development and has been widely used in various fields of molecular detection. However, this technology requires expensive and inconvenient-to-carry instruments to achieve detection, and the detection time is usually more than 40 minutes, which greatly limits the application of this technology in the POCT (Point-of-care) field.

[0004] In order to solve the problem of the lack of fluorescence quantitative PCR in the field of rapid nucleic acid detection, the technology of rapid nucleic acid amplification under isothermal conditions has become the focus of research in recent years, including the following techniques: transcription-mediated amplification and its derivative technologies. Due to the constraints of reaction mechanism, the overall detection time is long, and the sensitivity is also limited, which cannot achieve high-sensitivity detection in a short time; loop-mediated isothermal amplification has the characteristics of rapidness and sensitivity, but the weak anti-pollution ability leads to false positives, which limits its application in the field of nucleic acid rapid detection; there are many related researches on recombinase polymerase amplification technology (RPA technology) or its derivative technologies, but there are few products applied in clinical practice. The complex operation and weak fluorescence signal make it difficult to meet the demand of ultra-fast and high-sensitivity detection.

[0005] Therefore, it is the most effective way to fundamentally prevent and control P. minor to invent a field molecular rapid detection technology and apply it to the scenes of port entry vegetable and fruit quarantine, harmful organism monitoring and survey, etc. Specifically, it is urgent to provide a field rapid detection kit and method for P. minor, which has the advantages of accuracy comparable to professional laboratories, rapidness, simplicity, portability, etc. SUMMARY

[0006] In view of the above-mentioned disadvantages of the prior art, the present application aims to provide primers and probes, reagents and kits for detecting Planococcus frigidus.

[0007] To achieve the above-mentioned object and other related objects,

[0008] In a first aspect of the present application, primers and probes for detecting Planococcus frigidus are provided, the primers comprising a forward primer and a reverse primer; and the probes being RNA primer probes;

[0009] The nucleotide sequence of the forward primer is selected from any one of SEQ ID NO: 1 to SEQ ID NO: 5, or a nucleotide sequence having at least 80% sequence identity to any one of the above sequences;

[0010] The nucleotide sequence of the reverse primer is selected from any one of SEQ ID NO: 6 to SEQ ID NO: 10, or a nucleotide sequence having at least 80% sequence identity to any one of the above sequences;

[0011] The nucleotide sequence of the RNA primer probe is selected from any one of SEQ ID NO: 11 to SEQ ID NO: 16, or a nucleotide sequence having at least 80% sequence identity to any one of the above sequences.

[0012] In one or more embodiments of the present application, the nucleotide sequence is selected from any one of SEQ ID NO: 1 to SEQ ID NO: 5, or a nucleotide sequence having at least 95% sequence identity to any one of the above sequences;

[0013] The nucleotide sequence of the reverse primer is selected from any one of SEQ ID NO: 6 to SEQ ID NO: 10, or a nucleotide sequence having at least 95% sequence identity to any one of the above sequences;

[0014] The nucleotide sequence of the RNA primer probe is selected from any one of SEQ ID NO: 11 to SEQ ID NO: 16, or a nucleotide sequence having at least 95% sequence identity to any one of the above sequences.

[0015] In one or more embodiments of the present application, the nucleotide sequence of the forward primer is selected from the sequence shown in SEQ ID NO: 2, or a nucleotide sequence having at least 80% sequence identity to any one of the above sequences;

[0016] The nucleotide sequence of the reverse primer is selected from the sequence shown in SEQ ID NO: 6, or a nucleotide sequence having at least 80% sequence identity to any one of the above sequences;

[0017] The nucleotide sequence of the RNA primer probe is selected from the sequence shown in SEQ ID NO: 15, or a nucleotide sequence having at least 80% sequence identity to any of the above sequences.

[0018] In one or more embodiments of the present application, the nucleotide sequence of the forward primer is selected from the sequence shown in SEQ ID NO: 2, or a nucleotide sequence having at least 90% sequence identity to any of the above sequences;

[0019] The nucleotide sequence of the reverse primer is selected from the sequence shown in SEQ ID NO: 6, or a nucleotide sequence having at least 90% sequence identity to any of the above sequences;

[0020] The nucleotide sequence of the RNA primer probe is selected from the sequence shown in SEQ ID NO: 15, or a nucleotide sequence having at least 90% sequence identity to any of the above sequences.

[0021] In one or more embodiments of the present application, the nucleotide sequence of the forward primer is selected from the sequence shown in SEQ ID NO: 2, or a nucleotide sequence having at least 95% sequence identity to any of the above sequences;

[0022] The nucleotide sequence of the reverse primer is selected from the sequence shown in SEQ ID NO: 6, or a nucleotide sequence having at least 95% sequence identity to any of the above sequences;

[0023] The nucleotide sequence of the RNA primer probe is selected from the sequence shown in SEQ ID NO: 15, or a nucleotide sequence having at least 95% sequence identity to any of the above sequences.

[0024] In one or more embodiments of the present application, the nucleotide sequence of the forward primer is selected from the sequence shown in SEQ ID NO: 2; the nucleotide sequence of the reverse primer is selected from the sequence shown in SEQ ID NO: 6; and the nucleotide sequence of the RNA primer probe is selected from the sequence shown in SEQ ID NO: 15.

[0025] In one or more embodiments of the present application, the 5' end of the RNA primer probe is labeled with FAM as a reporter group, and the 3' end is labeled with BHQ1 as a quencher group.

[0026] In a second aspect of the present application, a reagent for detecting the oceanic pink mealybug is provided, and the reagent comprises the primers and the probe described above.

[0027] In one or more embodiments of the present application, the reagent comprises a forward primer, a reverse primer, and an RNA primer probe;

[0028] The nucleotide sequence of the forward primer is selected from the sequence shown in SEQ ID NO: 2; the nucleotide sequence of the reverse primer is selected from the sequence shown in SEQ ID NO: 6; and the nucleotide sequence of the RNA primer probe is selected from the sequence shown in SEQ ID NO: 15.

[0029] In a third aspect of the present application, a kit for detecting the oceanic pink mealybug is provided, wherein the kit comprises the primers and the probe described above, or the kit comprises the reagents described above.

[0030] In one or more embodiments of the present application, the kit comprises a forward primer, a reverse primer, and an RNA primer probe.

[0031] The nucleotide sequence of the forward primer is selected from the sequence shown in SEQ ID NO: 2; the nucleotide sequence of the reverse primer is selected from the sequence shown in SEQ ID NO: 6; and the nucleotide sequence of the RNA primer probe is selected from the sequence shown in SEQ ID NO: 15.

[0032] In one or more embodiments of the present application, the kit further comprises one or a combination of a nucleic acid amplification enzyme system, a signal amplification enzyme system, and a high-efficiency lysis solution.

[0033] In one or more embodiments of the present application, the kit further comprises a nucleic acid amplification enzyme system, a signal amplification enzyme system, and a high-efficiency lysis solution.

[0034] In one or more embodiments of the present application, the nucleic acid amplification enzyme system comprises one or a combination of a recombinase, a single-strand binding protein, a polymerase, and an ATP energy regeneration enzyme (all purchased from Suzhou Jingrui Biotechnology Co., Ltd.).

[0035] In one or more embodiments of the present application, the nucleic acid amplification enzyme system comprises a recombinase, a single-strand binding protein, a polymerase, and an ATP energy regeneration enzyme.

[0036] In one or more embodiments of the present application, the signal amplification enzyme system comprises a transcription enzyme and / or a cleavage enzyme (both purchased from Suzhou Jingrui Biotechnology Co., Ltd.).

[0037] In one or more embodiments of the present application, the signal amplification enzyme system comprises a transcription enzyme and a cleavage enzyme.

[0038] In one or more embodiments of the present application, the high-efficiency lysis solution comprises one or a combination of Tris, NaCl, EDTA, SDS, PVP-40, and broad-spectrum protease (purchased from Suzhou Jingrui Biotechnology Co., Ltd.). Tris, NaCl, EDTA, SDS, PVP-40, and broad-spectrum protease are all purchased from Suzhou Jingrui Biotechnology Co., Ltd.

[0039] In one or more embodiments of the present application, the high-efficiency lysis solution comprises Tris, NaCl, EDTA, SDS, PVP-40, and broad-spectrum protease.

[0040] In one or more embodiments of the present application, the kit further comprises a nucleic acid amplification enzyme system, a signal amplification enzyme system, and a high-efficiency lysis solution.

[0041] Preferably, the nucleic acid amplification enzyme system comprises a recombinase, a single-strand binding protein, a polymerase, and an ATP energy regeneration enzyme.

[0042] Preferably, the signal amplification enzyme system comprises a transcription enzyme and a cleavage enzyme.

[0043] Preferably, the high-efficiency lysis solution comprises Tris, NaCl, EDTA, SDS, PVP-40, and broad-spectrum protease.

[0044] In one or more embodiments of the present application, a kit for detecting D. oleae based on enzyme-mediated double amplification of nucleic acid comprises an RNA primer, a DNA upstream primer, and a DNA downstream primer. The nucleotide sequence of the RNA primer is FAM-UAAUAUUAUAUUUAUUAUUAUUAAAAUA-BHQ1, the DNA upstream primer is 5'-AAGCTAATACGACTCACTATAGGGCCATTAATATTAATATCATCAGATTTAATTTTT CCT-3', and the DNA downstream primer is 5'-AAAGGGGGATAAAGTGTTCAACCGGTAT-3'.

[0045] The present application is directed to the conserved region of the COI sequence in the genome of D. oleae, and designs an RNA primer, a DNA upstream primer, and a DNA downstream primer based on enzyme-mediated double amplification of nucleic acid rapid detection technology. Through constant-temperature nucleic acid amplification and constant-temperature signal amplification reaction of the sample to be tested, the fluorescence signal value is finally detected for judgment.

[0046] In one or more embodiments of the present application, the kit further comprises a nucleic acid amplification enzyme system and a signal amplification enzyme system, and is integrated into one reaction tube, the nucleic acid amplification enzyme system comprises four enzymes (recombinase, single-stranded binding protein, polymerase, ATP energy regeneration enzyme), and the signal amplification enzyme system comprises two enzymes (transcription enzyme and cleavage enzyme).

[0047] In one or more embodiments of the present application, the RNA primer fluorescent probe is a single-stranded nucleotide sequence labeled with a FAM reporter group at the 5' end and a BHQ1 quencher group at the 3' end. The FAM and BHQ1 modified RNA primer fluorescent probe is used to show the fluorescence signal generated during the amplification of the target gene. The fluorescence signal is directly proportional to the total amount of DNA bound to the probe.

[0048] In one or more embodiments of the present application, the kit comprises a high-efficiency lysis solution for extracting DNA from a sample for detecting the Diaphorina citri, the kit comprises a high-efficiency lysis solution for extracting DNA from a sample for detecting the Diaphorina citri, and the high-efficiency lysis solution comprises Tris (pH 8), NaCl, EDTA, SDS, PVP-40, and a broad-spectrum protease.

[0049] In one or more embodiments of the present application, the kit comprises a nucleic acid amplification detection reagent, which comprises a system comprising basic dry powder (recombinase, single-stranded binding protein, polymerase, ATP energy regeneration enzyme, signal amplification enzyme system), DNA upstream primer, DNA upstream primer, RNA primer, activation solution NTP (nucleoside triphosphate), buffer, RNase-free water, and lyophilized protectant.

[0050] The present application also provides the use of any of the above-mentioned kits for rapidly detecting Diaphorina citri.

[0051] A method for on-site rapid detection of Diaphorina citri based on enzyme-mediated double amplification of nucleic acid amplification, comprising the following steps:

[0052] S1. Collect the sample, add the high-efficiency lysis solution, and treat at 95°C for 10 minutes;

[0053] S2. Using the DNA of step S1 as a template, add the above-mentioned pre-packaged lyophilized ball to perform isothermal amplification reaction, and under the condition of constant temperature at 42 degrees, the target nucleic acid is amplified to 10 9 times within 10-30 minutes;

[0054] S3. The fluorescence signal Tt value of step S2 reaction is used as the detection result of Diaphorina citri, if there is no Tt value in the cycle, it indicates that the sample to be tested is not Diaphorina citri, and the detection result is negative, if there is a Tt value, it indicates that the sample to be tested is Diaphorina citri, and the detection result is positive.

[0055] The on-site molecular rapid detection scheme is that the sample to be detected is efficiently lysed for 10 minutes, and a pre-packaged freeze-dried ball is prepared by a nucleic acid amplification enzyme system, a signal amplification enzyme system, an RNA primer (RNA1), a DNA upstream primer (F1), and a DNA downstream primer (R1), so that only the sample DNA needs to be added to a palm metal bath and a palm fluorescence detector for reaction for 10-30 minutes, and the minute diagnosis is completed.

[0056] Compared with the prior art, the present application has the following beneficial effects:

[0057] (1) The DNA extraction step provided by the present application is simplified, and only the lysing solution and heat treatment for a few minutes are needed.

[0058] (2) The enzyme-mediated double amplification nucleic acid amplification technology for detecting the ocean hip stripe boundary in the present application can amplify the target nucleic acid to 109 times under the condition of 42 degrees constant temperature within 10-30 minutes through the integration of the nucleic acid amplification enzyme system, and one nucleic acid amplification product can generate more than 10,000 fluorescence signals, so that the sample detection is efficient and rapid.

[0059] (3) The present application detects the ocean hip stripe mealybug by molecular detection, has strong specificity, and the sensitivity can be as low as 1 copy / μL, so that the occurrence of the ocean hip stripe mealybug can be investigated and confirmed in a timely manner.

[0060] (4) The present application can be used with a portable palm metal bath and a palm fluorescence detector, and can be carried to any place such as a hazard site to carry out detection, so as to meet various application scenarios.

[0061] (5) The operation process of the present application is simple, and has wide application prospects. BRIEF DESCRIPTION OF DRAWINGS

[0062] Figure 1 It is the F1R1 RNA primer probe screening result.

[0063] Figure 2 It is the F2R2 RNA primer probe screening result.

[0064] Figure 3 It is the DNA F1R1-5 primer screening result of Example 2 of the present application.

[0065] Figure 4 It is the DNA F2R1-5 primer screening result of Example 2 of the present application.

[0066] Figure 5 It is the DNA F3R1-5 primer screening result of Example 2 of the present application.

[0067] Figure 6 It is the DNA F4R1-5 primer screening result of Example 2 of the present application.

[0068] Figure 7 Results of DNA F5R1-5 primer screening for Example 2 of the present invention.

[0069] Figure 8 Results of specificity experiment for Example 3 of the present invention.

[0070] Figure 9 Results of sensitivity experiment for Example 4 of the present invention. DETAILED DESCRIPTION

[0071] The following illustrates the embodiments of the present invention by specific examples, and other advantages and effects of the present invention can be easily understood by those skilled in the art from the disclosure of the present specification.

[0072] Table 1 is a primer screening table of the present embodiment

[0073]

[0074] Example 1

[0075] 1. Experimental sample

[0076] The positive sample of the oceanic planthopper used in the experiment was intercepted on a red mangrove in Vietnam, and both the DNA barcode technology and the fluorescent quantitative PCR detection were positive.

[0077] The total DNA of the sample was extracted using the TIANamp Genomic DNA Kit, and after imaging verification by agarose electrophoresis and concentration detection by a microspectrophotometer (Nanodrop), the extracted DNA was stored in a -80℃ refrigerator.

[0078] 2. Reaction system

[0079] In the eight-tube containing the basic dry powder (recombinant enzyme, single-strand binding protein, polymerase, ATP energy regenerating enzyme, signal amplification enzyme system), 1 μL of DNA upstream primer (10 μM), 1 μL of DNA upstream primer (10 μM), 1 μL of RNA primer (1 μM), and 7 μL of DNA (sample DNA) were added, and then centrifuged, and left at room temperature for 2 min. 10 μL of activating solution (a solution composed of NTP (nucleoside triphosphate) and buffer) was added along the wall of the eight-tube, and then centrifuged, shaken and mixed for 10 s, and then centrifuged and detected on the machine. The fluorescent quantitative PCR instrument (LightCycler 480 II (Roach)) had a reaction temperature of 42℃, signal collection was performed once for each cycle, a total of 30 cycles, the reaction time was 30 min, and the reporter group was set to FAM.

[0080] The DNA verified by the previous qPCR was used as a template, and RNase-free Water (Takara, 9012) was used as a blank control for RNA primer screening. The primers F1 and F2 were combined with primers R1 and R2 to test, respectively, F1R1 and F2R2, and each group of primers was added with RNA primers RNA1, RNA2, RNA3, RNA4, RNA5, and RNA6. The same primer groups were compared, and the RNA primers with the smallest Tt value and the highest end-point fluorescence value were selected. At the same time, according to the RNA primers, the DNA primer screening results of the corresponding four groups were determined, and the RNA primers with the smallest Tt value, the highest end-point fluorescence value, and no amplification signal in the negative control were selected.

[0081] The results show that, Figure 1 F1R1 RNA primer probe screening results, Figure 2 F2R2 RNA primer probe screening results. Two groups of DNA primers F1R1 and F2R2 and six RNA primers RNA1, RNA2, RNA3, RNA4, RNA5, and RNA6 were combined, a total of 12 combinations, four of which had better amplification effects, among which F2R2 RNA5 had the lowest Tt value of 12 and relatively high fluorescence value, and no amplification signal in the negative control, so RNA5 was selected as the RNA primer for subsequent experiments. Figures 1-2

[0082] Example 2

[0083] The DNA of the oceanic pink scale insect was used as a template, and the sample addition system of Example 1 was used to fix the RNA5 primer (RNA primer). The upstream and downstream primers F1-5 and R1-5 were combined to screen, and the DNA primers with the smallest Tt value and the highest end-point fluorescence value and no amplification signal in the negative control were selected. The results show that, in the DNA upstream and downstream primer screening results, the Tt value of F2R5 group is relatively low, which is 7, and the fluorescence value is relatively high, indicating that the DNA primer F2R1 has better effect, and there is no amplification signal in the negative control, so the F2R1 primer is selected for subsequent experiments. Figures 3-7

[0084] Example 3

[0085] ​​The DNA extracted by using Tiangen TGuide S32 magnetic bead method animal tissue genomic DNA extraction kit DP602-D as a template, according to the sample adding system of Example 1, with RNase-free Water as a blank control, and the optimal primer set F2R1 RNA5 screened according to the reaction system, time and temperature of Example 1 is detected for specificity. Selecting the same host as the oceanian pink waxy scale insect, the approximate species of the oceanian pink waxy scale insect, orange pink waxy scale insect, new pineapple grey scale insect, pineapple clean scale insect, banyan scale insect, long-tailed scale insect, mallow scale insect and jack bell scale insect, a total of 8 scale insects are tested for the specificity of the oceanian pink waxy scale insect (Table 1), and the tested 8 scale insects are not detected, and the oceanian pink waxy scale insect is detected, indicating that the primer and probe combination screened in the present study has high specificity for the oceanian pink waxy scale insect. Figure 8

[0086] Example 4

[0087] The DNA of the oceanian pink waxy scale insect sample is diluted by 10 times gradient, and the limit of detection is tested. The DNA concentration of the oceanian pink waxy scale insect is 102 ng / μL, and the DNA is diluted by gradient with RNase-free Water into stock solution (No. 1), ×10 1 (No. 2), ×10 2 (No. 3), ×10 3 (No. 4), ×10 4 (No. 5) for machine detection (the reaction system and reaction condition are the same as the test sample), and the fluorescence signal curve is shown in Figure 9 , and the Ct values are 2.67 for No. 1, 10.15 for No. 2, 18.90 for No. 3, No. 4 and No. 5 have no signal. Therefore, the specific probe concentration of the oceanian pink waxy scale insect is 102 ng / μL ×10 -2 , i.e. 1.02 ×10 -4 ng / μL. It has high sensitivity, and the gradient diluted plasmid has good machine effect Figure 9 .

[0088] In summary, the primer and probe of the present application have high specificity for detecting the oceanian pink waxy scale insect for molecular detection, and the sensitivity can be as low as 10.2 picograms, which can investigate the occurrence of the oceanian pink waxy scale insect in time. Therefore, the present application effectively overcomes the various shortcomings in the prior art and has high industrial utilization value.

[0089] ​The above embodiments are only illustrative of the principles of the present application and its efficacy, and are not intended to limit the present application. Any modification or change made by any person skilled in the art without departing from the spirit and scope of the present application shall be covered by the claims of the present application.

Claims

1. Primers and probes for the detection of Icerya purchasi Maskell, characterized in that, The primers comprise a forward primer and a reverse primer; the probe is an RNA primer probe; The nucleotide sequence of the forward primer is selected from any one of SEQ ID NO:1 to SEQ ID NO:5, or a nucleotide sequence having at least 80% sequence identity with any of the above sequences; The nucleotide sequence of the reverse primer is selected from any one of SEQ ID NO:6 to SEQ ID NO:10, or a nucleotide sequence having at least 80% sequence identity with any of the above sequences; The nucleotide sequence of the RNA primer probe is selected from any one of SEQ ID NO:11 to SEQ ID NO:16, or a nucleotide sequence having at least 80% sequence identity with any of the above sequences.

2. The primers and probes for detecting oceanic whitefly according to claim 1, characterized by: The nucleotide sequence of the forward primer is selected from any one of SEQ ID NO:1 to SEQ ID NO:5, or a nucleotide sequence having at least 95% sequence identity with any of the above sequences; The nucleotide sequence of the reverse primer is selected from any one of SEQ ID NO:6 to SEQ ID NO:10, or a nucleotide sequence having at least 95% sequence identity with any of the above sequences; The nucleotide sequence of the RNA primer probe is selected from any one of SEQ ID NO:11 to SEQ ID NO:16, or a nucleotide sequence having at least 95% sequence identity with any of the above sequences.

3. The primers and probes for detecting oceanic whitefly according to claim 1, characterized by: The nucleotide sequence of the forward primer is selected from the sequence shown in SEQ ID NO:2, or a nucleotide sequence having at least 80% sequence identity with any of the above sequences; The nucleotide sequence of the reverse primer is selected from the sequence shown in SEQ ID NO:6, or a nucleotide sequence having at least 80% sequence identity with any of the above sequences; The nucleotide sequence of the RNA primer probe is selected from the sequence shown in SEQ ID NO:15, or a nucleotide sequence having at least 80% sequence identity with any of the above sequences.

4. The primers and probes for detecting oceanic whitefly according to claim 1, characterized by: The nucleotide sequence of the forward primer is selected from the sequence shown in SEQ ID NO:2, or a nucleotide sequence having at least 95% sequence identity with any of the above sequences; The nucleotide sequence of the reverse primer is selected from the sequence shown in SEQ ID NO:6, or a nucleotide sequence having at least 95% sequence identity with any of the above sequences; The nucleotide sequence of the RNA primer probe is selected from the sequence shown in SEQ ID NO:15, or a nucleotide sequence having at least 95% sequence identity with any of the above sequences.

5. The primers and probes for detecting oceanic pink mealybug according to claim 1, characterized in that: The nucleotide sequence of the forward primer is selected from the sequence shown in SEQ ID NO:2; The nucleotide sequence of the reverse primer is selected from the sequence shown in SEQ ID NO:6; The nucleotide sequence of the RNA primer probe is selected from the sequence shown in SEQ ID NO:

15.

6. The primers and probes for detecting oceanic pink mealybug according to claim 1, characterized in that: The 5' end of the RNA primer probe is labeled with FAM as a reporter group, and the 3' end is labeled with BHQ1 as a quencher group.

7. A reagent for detecting Planococcus frugalis, characterized by, The reagent comprises the primers and the probe according to any one of claims 1 to 5.

8. A kit for detecting Planococcus frugalis, characterized by, The kit comprises the primer and probe of any one of claims 1 to 5, or the kit comprises the reagent of claim 6.

9. The kit for detecting Aspidistra panduriformis Mealybug according to claim 8, wherein: The kit further comprises one or a combination of nucleic acid amplification enzyme system, signal amplification enzyme system, and high-efficiency lysis solution; Preferably, the nucleic acid amplification enzyme system comprises one or a combination of recombinase, single-strand binding protein, polymerase, and ATP energy regeneration enzyme; Preferably, the signal amplification enzyme system comprises transcription enzyme and / or cleavage enzyme; Preferably, the high-efficiency lysis solution comprises one or a combination of Tris, NaCl, EDTA, SDS, PVP-40, and broad-spectrum protease.

10. The kit for detecting Aspidistra impariseta according to claim 9, wherein: The kit further comprises one or a combination of nucleic acid amplification enzyme system, signal amplification enzyme system, and high-efficiency lysis solution; Preferably, the nucleic acid amplification enzyme system comprises one or a combination of recombinase, single-strand binding protein, polymerase, and ATP energy regeneration enzyme; Preferably, the signal amplification enzyme system comprises transcription enzyme and cleavage enzyme; Preferably, the high-efficiency lysis solution comprises Tris, NaCl, EDTA, SDS, PVP-40, and broad-spectrum protease.

Images