RPA (recombinase polymerase amplification) detection primer group for otter flavivirus in Asian and application of RPA detection primer group
By designing a primer set for detecting Asian small-clawed otter flavivirus using RPA and combining it with recombinase polymerase amplification technology, the problem of time-consuming and labor-intensive existing detection methods has been solved, enabling rapid, simple, and specific detection that is suitable for on-site testing at the grassroots level.
Patent Information
- Application Number
- CN202511003338.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-21
- Publication Date
- 2025-12-05
AI Technical Summary
Currently, there is a lack of specific detection methods for Asian small-clawed otter flavivirus. Existing detection technologies are time-consuming, labor-intensive, and costly, making it difficult to meet the needs of rapid on-site testing at the grassroots level.
A primer set for detecting Asian small-clawed otter flavivirus (RPA) was designed to specifically amplify conserved regions of the virus. Combined with recombinase polymerase amplification technology, rapid and convenient detection can be achieved.
It achieves specific, stable, sensitive and efficient detection of Asian small-clawed otter flavivirus, with a detection limit of 5×10-1 copies/μL. It is easy to operate, requires no complicated instruments, and the detection time is completed within 60 minutes, making it suitable for on-site testing at the grassroots level.
Smart Images

Figure BDA0005509584730000071 
Figure BDA0005509584730000081 
Figure BDA0005509584730000101
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of virus detection, in particular to a RPA detection primer set for Asian small-clawed otter flavivirus and application thereof. BACKGROUND
[0002] Flavivirus is a single-stranded RNA virus with envelope, and is linear and non-segmented except Jingmen virus. Flavivirus has a very wide variety, and quite a number of species have the characteristics of cross-species transmission, which is a hotspot in medical and animal medical research. According to the current naming rules of the International Committee on Taxonomy of Viruses, the Flaviviridae is divided into four genera, Flavivirus, which contains important pathogens such as yellow fever virus, Japanese encephalitis virus and dengue fever virus; Pestivirus, such as bovine viral diarrhea virus; Hepacivirus, such as hepatitis C virus, and Pegivirus. Many members of the Flaviviridae infect humans and mammals, such as yellow fever, which spread from West Africa to the Americas in the seventeenth century, caused by mosquito bites, with clinical symptoms of high fever, headache, jaundice, proteinuria, etc. Recently, dengue fever, which is rampant in tropical and subtropical regions, is also caused by mosquito transmission, with clinical symptoms of fever, severe muscle pain, bone and joint pain, and extensive bleeding, rapid body failure, etc. Viruses of the Flavivirus genus circulate in mammals in nature, and human infection with flavivirus often causes acute infection and death. Dengue virus is fully adapted to the human host and exists in the human-mosquito transmission cycle in urban areas in tropical regions, no longer relying on animal hosts. Although some African or Southeast Asian flaviviruses still exist in the monkey-mosquito transmission cycle, water rat-derived flavivirus is a newly discovered virus, and sequence analysis shows that the virus also has the possibility of cross-species transmission.
[0003] The otter is a carnivore of the Mustelidae family, and is widely distributed in water or wetlands in Eurasia, Africa and North and South America. There are 11 species, of which three are found in China, including the Eurasian otter, which can be found throughout the country. The Asian small-clawed otter is the smallest otter species in the world and is a nationally protected animal. It once inhabited all types of aquatic environments in China, but its wild population has been declining due to habitat destruction, illegal hunting and trade. According to literature, otters can be infected with various bacteria, parasites and viral diseases, and are particularly sensitive to many viruses, such as canine distemper, canine infectious hepatitis and canine parvovirus enteritis. Therefore, the prevention and treatment of viral diseases in otters should be taken seriously. At present, there is no specific detection method for various viral diseases in otters. Existing research shows that otters can be infected with Pegivirus (ASOFV) of the Flaviviridae family, so a faster and more convenient detection method is needed to detect Pegivirus in otters on a larger scale. SUMMARY
[0004] To solve the above problems, the application provides an RPA detection primer set for Asian small-clawed otter flavivirus, which can achieve specific, stable, sensitive and efficient detection of Asian small-clawed otter flavivirus based on the RPA detection primer set and can be applied to field detection at the grassroots level, and has important value in the detection of Asian small-clawed otter flavivirus.
[0005] To achieve the above purpose, the application provides an RPA detection primer set for Asian small-clawed otter flavivirus, which is used for amplifying a target sequence, the target sequence is a conserved region of the viral sequence of the Asian small-clawed otter flavivirus, and the viral sequence of the Asian small-clawed otter flavivirus is shown as SEQ ID NO: 1.
[0006] Recombinase Polymerase Amplification (RPA), known as a nucleic acid detection technology that can replace PCR. The technology has high specificity and sensitivity, simple to use, and does not require special equipment. RPA is a protein-DNA complex formed by the combination of recombinase and primer, which can find homologous sequences in double-stranded DNA. Once the primer locates the homologous sequence, a strand exchange reaction occurs to form and start DNA synthesis, and the target region on the template is exponentially amplified. The replaced DNA strand is combined with SSB to prevent further replacement. In this system, a synthesis event is initiated by two opposite primers. The whole process is very fast, and the detectable level of amplification product can be obtained within ten minutes. Analysis can be performed by direct observation or by agarose gel. The RPA method has been developed for the detection of various viruses in animals, including Newcastle disease virus, avian influenza virus, small ruminant pestivirus and West Nile virus, but has not been applied to the detection of Asian small-clawed otter flavivirus. Therefore, the inventors propose to analyze the full genome sequence of Asian small-clawed otter flavivirus (ASOFV), obtain a 208bp-long flavivirus conserved region sequence, and design the above-mentioned RPA detection primer set according to the conserved region sequence. The amplification target sequence of the RPA detection primer set is between 5150-5357bp (virus sequence 6108bp), which can be combined with the recombinase polymerase amplification technology to realize specific, stable, sensitive and efficient detection of Asian small-clawed otter flavivirus.
[0007] In one embodiment, the RPA detection primer set comprises:
[0008] the upstream primer ST-F2: GGAAAGCCTTCATGAGCACTGACATGAAGAGGTGC (SEQ ID NO: 3);
[0009] the downstream primer ST-R3: GATCCCCTGACCTCGCACACCATCGTCTGC (SEQ ID NO: 7).
[0010] In one embodiment, the conserved region is located at 5150bp-5357bp of the virus sequence of Asian small-clawed otter flavivirus.
[0011] The application also provides a biomarker for detecting Asian small-clawed otter flavivirus, which is the target sequence.
[0012] The application also provides the use of the RPA detection primer set or the biomarker in the preparation of a kit for detecting Asian small-clawed otter flavivirus.
[0013] The application also provides a detection system for Asian small-clawed otter flavivirus, comprising the RPA detection primer set or comprising reagents for detecting the biomarker.
[0014] In one embodiment, the detection system is an RPA reaction system.
[0015] In one embodiment, the detection system further comprises a recombinase, a single-strand binding protein and a DNA polymerase.
[0016] In one embodiment, the working concentration of the RPA detection primer set in the detection system is 0.4-0.55 μM.
[0017] The working concentration is the concentration of the primer set that can achieve the expected effect when used. It can be understood that those skilled in the art can prepare a mother liquor or stock solution with a higher concentration when preparing a product containing the primer set, and then dilute it when used. The mother liquor or stock solution and its concentration are within the protection scope of the application.
[0018] The application also provides a kit for detecting Asian small-clawed otter flavivirus, comprising the detection system.
[0019] The application also provides a method for detecting Asian small-clawed otter flavivirus for non-diagnostic purposes, comprising the following steps: extracting RNA from a sample to be tested, and performing RPA reaction using the kit.
[0020] In one embodiment, the RPA reaction conditions include amplification at 37-40℃ for 20-30 min.
[0021] The kit containing the primer set is combined with the RPA amplification method to specifically amplify the gene sequence 5150-5357 (virus sequence 6108 bp), and the constructed otter flavivirus Pegivirus detection method is simple, fast, accurate and less invasive. The electrophoresis band for result determination is clear and bright, and the method takes less time than conventional PCR. The appearance of an electrophoresis band near 250 bp (the target sequence is 208 bp, which will appear near 250 bp) indicates that the sample to be tested contains otter flavivirus Pegivirus.
[0022] In one embodiment, the sample to be tested is taken from an Asian small-clawed otter, and the sample to be tested includes blood and / or liver tissue.
[0023] Compared with the prior art, the application has the following beneficial effects:
[0024] The RPA detection primer group for Asian small-claw otter flavivirus of the application and application thereof can realize specific, stable, sensitive and efficient detection of the Asian small-claw otter Pegivirus based on the RPA detection primer group, and the RPA detection primer group is used to detect the flavivirus from the Asian small-claw otter source by the method of 10 times of continuous dilution of the positive standard, and the minimum detection limit can reach 5*10 -1 copies / μL, which is 10 times of the sensitivity of the conventional fluorescent quantitative PCR method; the RPA detection primer group is used to detect duck Tembusu virus, classical swine fever virus, pangolin-derived swine fever virus, dengue fever virus and avian influenza H9N2 virus, and no positive result is found, which is high in specificity, and it can be seen that the RPA detection primer group can be applied to the field detection, and has important value in the detection of flavivirus.
[0025] Meanwhile, the RPA detection method of the application is simple in operation, does not need complicated and expensive instruments, is fast and efficient, and can be completed within 60 min from sample extraction to result determination, and the timeliness is equivalent to that of the TaqMan real-time fluorescent quantitative PCR method, the result determination method is simple, and the result can be determined by agarose gel nucleic acid electrophoresis. The RPA detection primer of the application combined with the RPA amplification technology can realize the rapid and instant detection of ASOFV, thereby solving the defects of time-consuming, laborious and high cost in the detection of ASOFV, improving the detection sensitivity and specificity, reducing the labor and equipment costs, and shortening the detection period, and the rapid detection technology can be applied to the epidemiological field real-time investigation and epidemic situation monitoring of ASOFV, and has good practical significance and broad market prospect. BRIEF DESCRIPTION OF DRAWINGS
[0026] Figure 1 It is a result graph of ASOFV RPA primer screening experiment, wherein M: DL2000, 1: F1 / R1, 2: F1 / R2, 3: F2 / R2, 4: F2 / R3, 5: F3 / R2, 6: F3 / R3;
[0027] Figure 2 It is a result graph of reaction temperature optimization experiment, wherein M: DL2000, 1: 30℃, 2: 35℃, 3: 37℃, 4: 39℃, 5: 42℃;
[0028] Figure 3 It is a result graph of reaction time optimization experiment, wherein M: DL2000, 1: 5min, 2: 10min, 3: 15min, 4: 20min, 5: 25min, 6: 30min, 7: 35min;
[0029] Figure 4Figure for repeatability detection experiment, M: DL2000, lanes 1-8 are intra-assay replicates, same sample, same time, same loading;
[0030] Figure 5 Figure for repeatability detection experiment, M: DL2000, lanes 9-20 are same sample, every 2 days, same loading;
[0031] Figure 6 Figure for specificity detection experiment, M: DL2000, 1: positive control, 2: SFV, 3: PeV, 4: Ta127 (liver sample No. 217), 5: Ta317 (liver sample No. 317), 6: DV, 7: DTMUV, 8: negative control;
[0032] Figure 7 Figure for sensitivity detection experiment, M: DL2000, 1: 5 x 10 5 copies / μL, 2: 5 x 10 4 copies / μL, 3: 5 x 10 3 copies / μL, 4: 5 x 10 2 copies / μL, 5: 5 x 10 1 copies / μL, 6: 5 x 10 0 copies / μL, 7: 5 x 10 -1 copies / μL, 8: 5 x 10 -2 copies / μL;
[0033] Figure 8 Figure for routine RT-PCR detection of clinical samples, 1, 2 are negative controls (ddH2O); 3, 4 are clinical random samples (blood nucleic acid samples); 5, 6 are clinical sample No. 127 (blood nucleic acid sample and liver nucleic acid sample of Asian small-clawed otter, respectively); 7 is clinical sample No. 127 (kidney nucleic acid sample), 8 is clinical sample No. 317 (liver nucleic acid sample of Asian small-clawed otter); clinical samples in lanes 1-8 are amplified using primer combination 6108-365F / 6108-365R;
[0034] 9, 10 are negative controls (ddH2O); 11 is clinical sample No. 127 (kidney nucleic acid sample); 12 is clinical sample No. 317 (liver nucleic acid sample of Asian small-clawed otter); 13, 14 are clinical sample No. 317 (blood nucleic acid sample and liver nucleic acid sample, respectively); 15, 16 are clinical random samples (blood nucleic acid samples); clinical samples in lanes 9-16 are amplified using primer combination 1797-174F / 1797-174R;
[0035] Figure 9 The result map of RPA clinical sample detection for the optimal primer set F2 / R3, wherein 1 is a clinical sample (liver nucleic acid sample) of Asian small-clawed otter No. 317, 2 is a clinical random collection sample (blood nucleic acid sample), 3 is a negative control (ddH2O), 4 is a clinical random collection sample (blood nucleic acid sample), 5 is a clinical sample (blood nucleic acid sample) No. 127, 6 is a clinical sample (liver nucleic acid sample) No. 127, and 7 is a clinical sample (kidney nucleic acid sample) No. 127. DETAILED DESCRIPTION
[0036] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the accompanying drawings. The preferred embodiments of the present application are shown in the drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.
[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terms used in the specification of the present application herein are only for the purpose of describing specific embodiments and are not intended to limit the present application.
[0038] Source:
[0039] The reagents, materials and equipment used in this embodiment are commercially available unless otherwise specified. The experimental methods are conventional experimental methods in the art unless otherwise specified.
[0040] EMBODIMENT
[0041] I. Obtain the target sequence of amplification.
[0042] The liver tissue and other samples of Asian small-clawed otter were obtained from the Guangzhou Zoo biological sample library, and the Pegivirus gene sequence of Asian small-clawed otter flavivirus was obtained by self-sequencing. The Asian small-clawed otter flavivirus Pegivirus has the following virus sequence, which can be used as the screening basis of the target sequence.
[0043] Virus sequence (length 6108bp):
[0044]
[0045] II. Screening of primers for detection of Asian small-clawed otter flavivirus Pegivirus RPA
[0046] A plurality of upstream primers and downstream primers were designed using software oligo 7.0, and part of the sequences of 3 upstream primers and 3 downstream primers in Table 1 are shown below, 6 primer pairs were combined, and Table 2 shows the amplification system of the PRA detection. The template is a cDNA sample positive for Asian small-clawed otter flavivirus Pegivirus stored in the laboratory of Guangzhou Zoo.
[0047] Table 1. Primer set for detection of Asian small-clawed otter virus Pegivirus RPA
[0048]
[0049] The RPA reaction tube, the reaction buffer, and the MgAc solution were purchased from the United Kingdom Twist DX Company, with the product number kit. The RPA lyophilized enzyme powder (containing recombinant enzyme, single-strand binding protein, and DNA polymerase) is present in the RPA reaction tube, which is dissolved with the reaction buffer when used. The entire RPA amplification reaction is carried out in the RPA reaction tube, and ddH2O is purchased from the United States Thermo Fisher Company.
[0050] After thorough mixing, 2.5 uL of MgAc solution (280 mM) was added to each reaction tube, and the reaction was carried out at 39°C for 5 min, then mixed again, centrifuged, and reacted at 39°C for 30 min, then placed on ice to end the reaction.
[0051] After the reaction was completed, agarose gel electrophoresis was performed, and the electrophoretic band appearing at 250 bp represented the Asian small-clawed otter flavivirus Pegivirus. In this experiment, in order to screen the best primer pair, 3 upstream primers and 3 downstream primers were designed by oligo 7.0, which can be paired into 6 primer pairs. The concentration of the primers was kept consistent in this amplification, the amplification temperature was 39°C, and the amplification time was 30 min. Under the same reaction conditions, after the reaction was completed, gel identification was performed, and it was found that the band size of lane 3 and the target size (208 bp) were quite different, and the amplification efficiency of lane 4 was higher than that of other lanes, i.e., the amplification efficiency of primer set F2 / R3 (SEQ ID NO: 3, SEQ ID NO: 7) was the highest, and the results are shown in Figure 1 . And the specificity of the primer sets corresponding to the other lanes is poor, therefore, after comprehensive consideration, the primer set F2 / R3 was selected for subsequent experiments.
[0052] III. Screening of reaction temperature for detection of Asian small-clawed otter flavivirus Pegivirus RPA
[0053] The RPA reaction temperature screening was performed using the amplification system of Table 2, and 5 temperature gradients were set, i.e. 30°C, 35°C, 37°C, 39°C, and 42°C. After thorough mixing, 2.5 uL of MgAc solution (280 mM) was added to each reaction tube, and each was reacted at 30°C, 35°C, 37°C, 39°C, and 42°C for 5 min, and then mixed again, centrifuged, and reacted at 30°C, 35°C, 37°C, 39°C, and 42°C for 30 min, respectively, and then placed on ice to end the reaction. The amplification products were subjected to gel electrophoresis, and it was found that the band was clearest at 39°C (see Figure 2 ).
[0054] Table 2 RPA reaction system
[0055]
[0056] In this experiment, in order to optimize the best reaction temperature, 5 temperature gradients were set, the reaction time was 30 min, and the same reaction conditions were used. After the reaction was completed, gel identification was performed, and it was found that low temperature 30°C was not conducive to RPA enzyme amplification, and the band was clear and easy to observe at 35°C-39°C. The band was clearest at 39°C, and the high temperature 42°C was not conducive to enzyme amplification. It was determined that the best reaction temperature for this detection was set to 39°C, and therefore the reaction temperature of 39°C was selected for subsequent method research.
[0057] Four, RPA detection reaction time screening of Asian small-clawed otter flavivirus Pegivirus
[0058] In order to optimize the best reaction time, 7 time gradients were set in this experiment, and the reaction temperature was 39°C. The same reaction conditions were used, and gel identification was performed after the reaction was completed. The amplification band could be observed at 5 min, but the band was weak. The amplified band was clear and bright at 10-35 min reaction time, and the band was clear at 20 min. It was determined that the best reaction time for this detection was set to 20 min (as shown in Figure 3 ), and therefore the reaction time of 20 min was selected for subsequent method research.
[0059] Five, RPA repetitive detection of Asian small-clawed otter flavivirus Pegivirus
[0060] The repetitive detection was performed using the primer set F2 / R3 optimal reaction temperature screened in this example and the reaction system of Table 2, and the same sample was added at the same time. The same sample was added every 2 days.
[0061] The experimental results are shown in the figure M: DL2000, 1-8 batch repeatability, the same sample at the same time; 9-20 for the same sample, every 2 days sample. The results show that the established RPA system, batch and batch repeatability is good, see Figure 4 and Figure 5 .
[0062] Six, Asian small claw otter flavivirus Pegivirus RPA specific detection.
[0063] The optimal primer set F2 / R3, the best temperature, and the amplification system of the present embodiment are used for RPA specific detection. The samples to be tested include duck tembusu virus (DTMUV), pangolin pestivirus (PeV), dengue virus (DV), classical swine fever virus (SFV), and Asian small claw otter flavivirus Pegivirus positive RNA (including positive control, liver sample No. 217, and liver sample No. 317).
[0064] The clinical samples No. 217 and No. 317 are blood samples, liver samples, and kidney samples from Asian small claw otters in Guangzhou Zoo. In this experiment, liver sample No. 217 and liver sample No. 317 are selected for testing.
[0065] The results are shown in Figure 6 . Using the established RPA method for detection, positive control and 317 liver sample nucleic acid can be observed to detect the band, and the rest of the samples are not detected. It is proved that the established Asian small claw otter flavivirus Pegivirus RPA detection method has high specificity.
[0066] Seven, Asian small claw otter flavivirus Pegivirus RPA sensitivity detection.
[0067] The amplification system in Table 2 is used for sensitivity detection. The Asian small claw otter flavivirus Pegivirus RNA template is diluted into 5×10 5 copies / μL, 5×10 4 copies / μL, 5×10 3 copies / μL, 5×10 2 copies / μL, 5×10 1 copies / μL, 5×10 0 copies / μL, 5×10 -1 copies / μL, 5×10 -2copies / μL concentration, respectively, RPA amplification was performed. After the sample was fully mixed, 2.5 μL of MgAc solution (280 mM) was added to each reaction tube, and the reaction was performed at 39 for 5 min, mixed again, centrifuged, and reacted at 39 for 30 min, and then placed on ice to end the reaction. Subsequently, agarose gel electrophoresis was performed, and the results showed that the established RPA detection method could detect 5 x 10 -1 copies / μL of nucleic acids, and the results are shown in Figure 7 .
[0068] Eight, RPA detection of clinical samples.
[0069] The clinical samples included clinical sample No. 127, clinical sample No. 317, and clinical random collection samples. The clinical sample No. 127 and the clinical sample No. 317 included blood samples, liver tissue, and kidney tissue of Asian small-clawed otters that appeared symptoms of diseases in the clinic, all of which were from Guangzhou Zoo. The clinical random collection samples were blood samples of Asian small-clawed otters randomly collected in the process of feeding and management in the existing sample library of Guangzhou Zoo.
[0070] 1. The conventional RT-PCR detection was performed on the clinical sample No. 127, the clinical sample No. 317, and the clinical random collection samples, and the reaction system, the amplification reaction program, and the primer set of the conventional RT-PCR detection are shown as follows.
[0071] Reaction system: Premix Ex Taq 12.5 uL, 6108-365F and 6108-365R each 1 uL (or 1797-174F, 1797-174R), template 1 uL, and ddH2O supplemented to 25 uL.
[0072] The conventional RT-PCR amplification reaction program was as follows: 95℃ pre-denaturation for 3 min, 30 cycles; 95℃ denaturation for 30 s; 54℃ annealing for 30 s; 72℃ extension for 20 s; and 72℃ extension for 10 min. The reverse transcription program was as follows: 65℃ for 5 min on ice, 30℃ for 10 min after adding reagents according to the kit, 42℃ for 50 min, and 70℃ for 15 min.
[0073] The primers for the conventional RT-PCR detection are shown in the following table.
[0074] Table 3. Primer sequences for conventional RT-PCR detection
[0075]
[0076] The detection results of the conventional RT-PCR are shown in Figure 8As shown, lanes 1-8 were detected using primers 6108-365F / R, with a target fragment size of approximately 328 bp; lanes 9-16 were detected using primers 1797-174F / R, with a target fragment size of approximately 208 bp. PCR products were analyzed by 1% agarose gel electrophoresis. The sequencing products were subsequently sent to a company for sequencing, confirming the sequence as the Pegivirus gene sequence of the Asian small-clawed otter.
[0077] The liver sample from clinical sample number 317 tested positive by routine RT-PCR, while the clinical sample number 127 and other randomly collected clinical samples tested negative by routine RT-PCR. Although lane 14 contained a band, the band size differed significantly from the target fragment size, indicating non-specific amplification.
[0078] 2. RPA clinical samples were tested using the optimal primer set F2 / R3, along with the optimal temperature, amplification system, and reaction conditions described in this embodiment. The test results are shown below. Figure 9 The liver sample from clinical sample number 317 tested positive, while the clinical sample number 127 and the randomly collected clinical samples tested negative. These results are consistent with those of routine RT-PCR testing.
[0079] IX. Summary.
[0080] The RPA primer set F2 / R3 of this invention can achieve specific, stable, sensitive, and efficient detection of Asian small-clawed otter flavivirus Pegivirus. This invention achieves this by performing 5 × 10⁻⁶ nucleic acid tests. 5 copies / μL, 5×10 4 copies / μL, 5×10 3 copies / μL, 5×10 2 copies / μL, 5×10 1 copies / μL, 5×10 -1 copies / μL, 5×10 -2 The concentration was diluted to copies / μL and subjected to RPA amplification to confirm the limit of detection as 5 × 10⁻⁶. -1 copies / μL.
[0081] The above-mentioned RPA primers were used to detect positive RNA of other flaviviruses, including duck Tembusu virus, pangolin fever virus, dengue fever virus, and Asian swine fever virus. No positive results were found, which proves that the method of the present invention has high specificity.
[0082] This RPA detection primer set can be applied to the field detection of Asian small-clawed otter flavivirus (Pegivirus), and has important application value in the detection of Asian small-clawed otter flavivirus.
[0083] Meanwhile, the RPA detection method of the application is simple in operation, does not require complex and expensive instruments, is fast and efficient, and can be completed within 60 minutes from sample extraction to result determination, and is more time-efficient than the TaqMan real-time fluorescent quantitative PCR method.
[0084] The RPA detection primer of the application in combination with the RPA amplification technology can realize rapid and instant detection of Asian small-clawed otter Pegivirus, thereby solving the defects of time-consuming, laborious and high-cost Asian small-clawed otter Pegivirus detection in the prior art, improving the detection sensitivity and specificity, reducing the labor and equipment costs, and shortening the detection period.
[0085] The technical features of the above-described embodiments can be combined in any manner, and to make the description concise, all possible combinations of the technical features in the above-described embodiments are not described, but as long as the combinations of the technical features do not exist contradictory, they should be considered as the scope of the description.
[0086] The above-described embodiments only express several implementation manners of the application, and the description is more specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be pointed out that for ordinary skilled persons in the art, some modifications and improvements can be made without departing from the concept of the application, and these all belong to the protection scope of the application. Therefore, the protection scope of the patent of the application should be subject to the appended claims.
Claims
1. A RPA detection primer set for Asian small-clawed otter flavivirus, characterized in that, The RPA detection primer set is used for amplifying a target sequence, and the target sequence is a conserved region of a virus sequence of Asian small-clawed otter flavivirus, and the virus sequence of the Asian small-clawed otter flavivirus is shown as SEQ ID NO:
1.
2. The RPA detection primer set of claim 1, wherein, The RPA detection primer set comprises: an upstream primer ST-F2: GGAAAGCCTTCATGAGCACTGACATGAAGAGGTGC (SEQ ID NO: 3); a downstream primer ST-R3: GATCCCCTGACCTCGCACACCATCGTCTGC (SEQ ID NO: 7).
3. The RPA detection primer set of claim 1, wherein, The conserved region is located at 5150bp-5357bp of the virus sequence of the Asian small-clawed otter flavivirus.
4. A biomarker for detecting an Asian otter flavivirus, characterized by, The biomarker is the target sequence according to any one of claims 1-3.
5. Use of the RPA detection primer set according to any one of claims 1-3 or the biomarker according to claim 4 in the preparation of a kit for detecting Asian small-clawed otter flavivirus.
6. A detection system for Asian small-clawed otter flavivirus, characterized by, The kit comprises the RPA detection primer set according to any one of claims 1-3, or comprises reagents for detecting the biomarker according to claim 4.
7. The detection system of claim 6, wherein, The detection system is an RPA reaction system.
8. A kit for detecting an Asian otter flavivirus, characterized by, The kit comprises the detection system according to any one of claims 6-7.
9. A method of detecting Asian small-clawed otter flavivirus for non-diagnostic purposes, characterized in that, The method comprises the following steps: extracting RNA of a sample to be tested, and performing RPA reaction by using the kit according to claim 8.
10. The method of claim 9, wherein, The conditions of the RPA reaction comprise: amplifying at 37-40℃ for 20-30min. The conditions of the RPA reaction comprise: amplifying at 37-40℃ for 20-30min.
Citation Information
Patent Citations
Yellow fever virus detection kit based on RPA technology and applications of yellow fever virus detection kit
CN106544449A
Genetic marker for otter individual recognition and application thereof
CN118291637A
General-purpose primer sets for detecting flaviviruses and use thereof
WO2020153673A1
KR20250149182A