Standardized environment-tolerant microbial element library and application thereof

Abstract

The invention discloses a standardized environment-tolerant microbial element library and application thereof, and belongs to the technical field of bioengineering. According to the element library, site modification is carried out on an environment-tolerant gene or a regulatory element thereof, and a prefix and a suffix containing specific enzyme cutting sites are added for sequence standardization and cloning construction, so that a plurality of standardized environment-tolerant microbial elements are obtained and form the element library. Wherein the 5'end of the standardized sequence contains EcoRI and XbaI sites, and the 3 'end of the standardized sequence contains SpeI and PstI sites, so that modular assembly among elements can be realized, and no redundant enzyme cutting sites exist after connection. The element library covers various functional elements such as freezing resistance, high salt resistance, high temperature resistance, acid resistance, heavy metal resistance and the like, microbial hosts can be modified in a plug-and-play mode, the microbial hosts are endowed with physical and chemical environmental stress tolerance or specific functions, and the element library has important application value in the fields of industrial fermentation, biomining industry, environmental governance, agriculture, space biology and the like.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of bioengineering technology, and particularly relates to the field of synthetic biology and environmental tolerance microbial engineering, and especially relates to a standardized biological element library of functional modules under extreme physicochemical conditions such as high salt, high acid, high alkali, high temperature, low temperature, heavy metal stress and a construction method and application thereof. BACKGROUND

[0002] As a new cross-discipline, the core goal of synthetic biology is to design and construct new biological elements, devices and systems under the guidance of engineering concepts, and to realize customized functions by directional modification of natural biological systems. Standardized biological elements are the basis of the development of synthetic biology. Since Tom Knight of MIT proposed the BioBrick standard in 2003, researchers have developed a large number of standardized biological elements (such as DNA modules with specific prefix / suffix sequences) that follow a unified interface, and established public resource platforms including the iGEM parts library, which includes tens of thousands of standardized elements for rapid assembly of biological circuits. Through the modularization and "plug and play" characteristics of these standardized elements, the design and construction efficiency and accuracy of complex genetic circuits have been significantly improved. For example, BioBrick standard parts support efficient splicing and assembly between different elements through predefined enzyme cutting site prefixes and suffixes. However, the existing standardized element library mainly targets model organisms such as Escherichia coli and conventional environmental conditions, and the specialized biological element resources for extreme physicochemical environmental stress conditions are relatively scarce.

[0003] The extreme environment that the target microorganism needs to tolerate refers to an environment in which the physical and chemical parameters such as temperature, pH and salinity are far beyond the conventional "comfort zone", such as high-salt lakes, high-temperature hot springs, strong-acid mines, polar permafrost and the like. The environmental tolerance microorganisms (extremophiles) that can survive in such environments have evolved unique morphological, structural, physiological and biochemical characteristics, and the structure and function of their protein, nucleic acid, lipid and other molecules are significantly different from those of organisms in conventional environments. The study of environmental tolerance microorganisms not only helps to reveal the mechanism of life origin and evolution, but also gives birth to "next-generation industrial biotechnology" - that is, to develop more efficient and energy-saving biological manufacturing processes by using environmental tolerance microbial resources. With the progress of DNA sequencing and genetic engineering technology, more and more synthetic biology tools have been applied to non-model organisms (including various environmental tolerance microorganisms), and researchers are trying to use their unique genetic background and metabolic pathways to design new biosynthetic pathways for the production of enzymes, chemicals and biological materials, etc., in order to achieve economic and social benefits. For example, when using Halomonas as the chassis for industrial fermentation, the target product can be continuously produced without the need for sterile conditions, significantly reducing the risk of contamination and production cost.

[0004] The adaptation mechanisms of microorganisms under extreme physicochemical conditions are often closely related to special genes and molecular elements, which have important application value in synthetic biology. For example, halophilic microorganisms (such as Halomonas, Haloferax, etc.) maintain cell balance by adjusting osmotic pressure, and the typical mechanisms include the use of K + / Na + reverse transporters to expel salt, and the synthesis of compatible solutes such as betaine, glycerol, ectoine, etc.; among them, the ectoine synthesis pathway (encoded by ectA-ectD genes) is the key to maintaining salt balance. For example, the metallothionein gene of Streptomyces, the cusABCF and copAB copper efflux system gene of copper-tolerant bacteria, endow the strain with the ability to survive in high-salt and heavy-metal environments. Thermophilic microorganisms (such as Thermus and Thermococcus) can still metabolize normally at high temperatures by virtue of their stable membrane structure (higher proportion of saturated fatty acids), high G+C content genome, and heat-resistant proteins. A typical example is Taq DNA polymerase (derived from the thermophilic bacterium Thermus aquaticus), which can remain active at temperatures above 90℃. These high-temperature resistant enzyme-encoding genes are an important part of the environmental tolerance element library and can be used to endow engineered bacteria with heat-resistant properties or directly function in high-temperature industrial processes.

[0005] As can be seen, environmental tolerance microorganisms contain a wealth of functional element resources, such as DNA repair enzymes, antioxidant enzymes, drought-resistant trehalose synthetase and LEA proteins, etc. If these elements can be modularized and standardized, they can be used to modify conventional microbial chassis to enable them to survive or produce in extreme environments. Previous studies have shown that introducing environmental tolerance-related genes into model organisms can significantly improve their stress resistance and production performance: for example, after introducing the global regulatory gene irrE of the radiation-resistant bacterium Deinococcus radiodurans into Escherichia coli, the transgenic strain showed significantly enhanced tolerance to high salt, high radiation, and oxidation. Expressing irrE in plants also improved the salt and drought tolerance of crops. For example, introducing the ectoine synthesis pathway gene module of halophilic bacteria into E. coli enabled it to grow normally in high-salt medium and synthesize protective substances such as ectoine, achieving salt-tolerant fermentation production. These achievements highlight the value of developing a standardized environmental tolerance microbial element library - by collecting various environmental tolerance and functional gene modules, and using synthetic biology methods, it is more convenient to design and construct engineered strains that can tolerate a variety of harsh conditions, and apply them to industrial biological manufacturing, environmental remediation, and national defense and aerospace.

[0006] At present, the research on modular elements of microorganisms in extreme physicochemical environment is gradually rising, and more and more genetic elements, molecular tools and operation methods are developed for the engineering modification of environment-tolerant microorganisms, but compared with model organisms, the standardized library of functional elements under extreme environmental stress is still in its infancy, and lacks a mature universal platform. Therefore, it is urgent to construct a set of high-quality and universal standardized environment-tolerant microbial element library to fill the gap in this field and promote the development of related research and application. SUMMARY

[0007] In view of the deficiencies of the prior art, the primary purpose of the present application is to provide a standardized environment-tolerant microbial element library, which realizes the modularization and assembly of environment-tolerant functional genes and regulatory elements through a unified standardized modification strategy, solves the problems of lack of universal standards and low assembly efficiency of existing extreme environment-tolerant biological elements. Another purpose of the present application is to provide a construction method and application of the standardized environment-tolerant microbial element library, which provides an efficient tool for the engineering modification of extreme environment microorganisms and synthetic biology research.

[0008] To achieve the above-mentioned purposes of the application, the following technical solutions are adopted:

[0009] The present application provides a standardized environment-tolerant microbial element library, which is composed of a plurality of standardized environment-tolerant microbial elements, and each standardized environment-tolerant microbial element is constructed by the following steps: (1) site modification: based on the nucleic acid sequence of an environment-tolerant gene or its regulatory element, the EcoRI, XbaI, Spel and PstI restriction endonuclease cleavage sites possibly existing in the nucleic acid sequence are removed by synonymous codon substitution, to obtain a nucleic acid sequence without the above-mentioned cleavage sites; (2) sequence standardization: the nucleic acid sequence without cleavage sites obtained in step (1) is added with a standardized nucleic acid sequence prefix at the 5' end and a standardized nucleic acid sequence suffix at the 3' end in the direction from 5' end to 3' end, to obtain a standardized sequence with standardized sites at both ends; the 5' end of the standardized sequence comprises EcoRI and XbaI cleavage sites, and the 3' end comprises Spel and PstI cleavage sites; if the 5' end of the nucleic acid sequence without cleavage sites starts with “ATG”, the prefix sequence is gaattcgcggccgcttctag, otherwise the prefix sequence is gaattcgcggccgcttctagag; the suffix sequence is tactagtagcggccgctgcag; (3) element cloning and construction: the standardized sequence obtained in step (2) is double-digested with EcoRI and PstI, and then ligated and cloned into a plasmid vector, to obtain the standardized environment-tolerant microbial element.

[0010] In one embodiment, the environmental tolerance genes in the standardized environmental tolerance microbial element library of the present application are nucleic acid sequences encoding proteins with physicochemical environmental stress tolerance functions, including one or more of an anti-freeze protein gene, an anti-high salt protective enzyme gene, a high temperature tolerance enzyme gene, an acid resistance transporter gene, a heavy metal transporter gene, a metallothionein gene, a DNA repair enzyme gene, an antioxidant enzyme gene, a trehalose synthetase gene, or a LEA protein gene.

[0011] In one embodiment, the regulatory elements of the present application include one or more of a promoter, an enhancer, a terminator, or a ribosome binding site.

[0012] In one embodiment, the plasmid vector of the present application is a pSB1A3, pSB1C3, pSB3K3, p15A, pSC101, pMB1, or pUC plasmid vector and its improved versions.

[0013] In one embodiment, the present application protects a method for constructing the standardized environmental tolerance microbial element library, comprising the following steps: (1) site modification of the nucleic acid sequence of the environmental tolerance gene or its regulatory element, removing EcoR I, Xba I, Spe I, and Pst I enzyme cutting sites therein; (2) sequence standardization of the nucleic acid sequence treated in step (1), adding the prefix sequence and the suffix sequence of claim 1 to the 5' end and 3' end thereof, respectively; (3) cloning of the standardized sequence treated in step (2) to a plasmid vector, obtaining the standardized environmental tolerance microbial element; (4) collection of multiple standardized environmental tolerance microbial elements constructed by steps (1)-(3), forming the standardized environmental tolerance microbial element library.

[0014] In one embodiment, the enzyme cutting sites are removed by synonymous codon substitution in step (1), without changing the encoded amino acid sequence.

[0015] In one embodiment, the prefix sequence and the suffix sequence added in step (2) enable modular assembly between different elements through EcoR I / Xba I and Spe I / Pst I enzyme cutting connection, and there are no EcoR I, Xba I, Spe I, and Pst I enzyme cutting sites at the connection after connection of adjacent elements.

[0016] In one embodiment, the present application protects the use of the standardized environmental tolerance microbial element library in microbial genetic engineering, including introduction of the standardized environmental tolerance microbial elements in the element library into host cells, conferring physicochemical environmental stress tolerance or specific functions on the host cells.

[0017] In one embodiment, wherein the application includes connecting a plurality of standardized environmental tolerance microbial elements in a designed order to assemble a genetic module with specific functions, and then introducing the module into a host cell to achieve the modification of the host cell phenotype.

[0018] In one embodiment, wherein the application field includes industrial fermentation, bio-mining, environmental management, agricultural microbial modification or space biology research; the host cell includes E. coli, Pseudomonas, Halomonas, yeast or actinomycetes, and the biological element library can be stored in liquid form or freeze-dried powder form as needed, and can be constructed in the form of a biochip.

[0019] Compared with the prior art, the present application has the following beneficial effects:

[0020] (1) High degree of standardization: all elements adopt a unified double-end interface design (5' end contains EcoR I / Xba I, 3' end contains Spe I / Pst I), which can be assembled modularly through enzyme digestion and connection, and there is no redundant enzyme digestion site at the connection of adjacent elements, ensuring the stability of assembly.

[0021] (2) Strong compatibility: the element library follows the BioBrick standard derivative interface, and is compatible with existing standard element libraries, while supporting various assembly methods such as seamless cloning and homologous recombination, and is suitable for the modification of different host microorganisms.

[0022] (3) High construction efficiency: by pre-modifying to remove internal enzyme digestion sites and standardizing the ends, sequence conflicts and frame shift mutations in the assembly process are avoided, and repeated sequencing verification of intermediate products is not required, significantly shortening the construction period.

[0023] (4) Functional diversity: the element library covers various extreme environmental tolerance functions such as freeze resistance, salt tolerance, high temperature tolerance, acid resistance, and heavy metal tolerance, and can be flexibly combined according to needs to achieve the multi-stress tolerance modification of host strains.

[0024] (5) Wide application range: it can be directly applied to industrial biological manufacturing, environmental management, agricultural improvement, space biological technology and other fields, and provides core tool support for microbial engineering applications in extreme environments.

[0025] In summary, the environmental tolerance microbial element library constructed by the standardization modification strategy of the present application realizes the "plug and play" of extreme environmental functional elements, lays a foundation for the application of synthetic biology in extreme environments, and has important scientific value and application prospect. DETAILED DESCRIPTION

[0026] The application will be further described in conjunction with specific embodiments, which are used to explain the application and are not intended to limit the scope of the application. The test methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used are commercially available unless otherwise specified.

[0027] I. Experimental materials and reagents

[0028] Strains and vectors:

[0029] Host strain: Escherichia coli BL21 (DE3) (purchased from NEB, item number C2530H), used for element cloning and function verification.

[0030] Plasmid vectors: pSB1C3 (chloramphenicol resistance, BioBrick standard vector), pSB1A3 (ampicillin resistance), purchased from iGEM Parts Registry.

[0031] Enzymes and reagents:

[0032] Restriction enzymes: EcoR I-HF, Xba I, Spe I, Pst I (all purchased from NEB, high-fidelity type).

[0033] Tool enzymes: T4 DNA ligase (NEB), Q5 high-fidelity DNA polymerase (NEB).

[0034] Kit: PCR product purification kit (Qiagen, item number 28104), plasmid extraction kit (Omega, item number D6943), gel recovery kit (Sigma, item number NA1111-1KT).

[0035] Culture medium: LB liquid / solid culture medium (containing corresponding antibiotics, final concentration of chloramphenicol 25 μg / mL, final concentration of ampicillin 100 μg / mL), SOC culture medium.

[0036] Environment-tolerant gene: refers to a nucleic acid sequence encoding a protein related to any physicochemical environmental stress. In the present application, the "environment-tolerant microbial element" refers to a functional module composed of the above-mentioned environment-tolerant gene or its regulatory element. For example, an antifreeze protein gene can be used as an environment-tolerant microbial element, which mainly functions to prevent cells from being damaged by ice crystals at low temperatures; for another example, a key enzyme-encoding gene for synthesizing compatible solutes in halophilic microorganisms can be used as a salt-tolerant element to balance osmotic pressure. By studying and utilizing these environment-tolerant genes, special tolerance or functions can be conferred to the engineering strain, which has important significance for industry, biomedicine, etc.

[0037] The environmental tolerance genes described in the present application include, but are not limited to, the specific gene list mentioned in the examples of the present application (see Table 1), and also include homologues of these genes in other species or strains and functional variants thereof. For example, if a certain environmental tolerance gene has orthologous genes with similar sequences and functions in different species, the homologous genes can also be considered as environmental tolerance genes within the scope of the present application; for example, the functional improved version of the gene obtained by mutagenesis is also included.

[0038] Table 1, representative environmental tolerance genes described in the present application

[0039]

[0040]

[0041]

[0042] Here, "homologues" refer to gene sequences that are genetically derived from a common ancestral gene. Homology can be divided into orthologs and paralogs. Orthologues are genes in different species that have diverged from a common ancestral gene and generally retain similar functions; therefore, alleles in different species can be considered as orthologues of each other. The orthologues of the environmental tolerance genes involved in the present application are within the scope of protection of the present application, as long as they have high similarity to the nucleic acid sequences of the genes and are functionally equivalent. The homology / identity of nucleotide or amino acid sequences can be analyzed and determined by Basic Local Alignment Search Tool (BLAST) (including blastn, blastp, blastx, tblastn, tblastx, etc.) to quantify the similarity between sequences.

[0043] Nucleic acid or nucleic acid molecule: in the present application, it is equivalent to DNA or RNA molecule, such as mRNA. Nucleic acid can be single-stranded or double-stranded, and can be DNA-DNA double-stranded, DNA-RNA hybrid double-stranded or RNA-RNA double-stranded, etc. Nucleic acid can also be oligonucleotide, such as antisense oligonucleotide, chimeric DNA-RNA polymer, ribozyme molecule, etc., as well as modified versions of the above various forms (modification can occur on base, sugar or phosphate bond, or simultaneously).

[0044] Biological sources of environmental tolerance genes: including but not limited to various species of the following environmental tolerance microbial genera, such as Pseudomonas, Pseudoalteromonas, Halomonas, Halobacterium, Thermus, Sulfolobus, Acidithiobacillus, Deinococcus, etc. The above-mentioned microorganisms are all known for their tolerance to certain physical and chemical stress environmental conditions, for example, Pseudoalteromonas contains various Antarctic marine psychrophilic strains, Halomonas and Halobacterium are typical halophiles, Thermus is a high-temperature bacterium, Acidithiobacillus is a strong acid environment microorganism, and Deinococcus is a representative bacterium resistant to radiation, etc. The present application analyzes the genomes of these environmental tolerance microorganisms to screen genes related to their tolerance or special metabolism for use in constructing biological elements.

[0045] Regulatory elements: In the present application, regulatory elements refer to cis-acting elements that can control gene expression, including promoters, enhancers, terminators, ribosome binding sites (RBS), and other sequence elements that affect transcription / translation, etc. Specifically, in the embodiments of the present application, the regulatory elements operably linked to the environmental tolerance-related elements can include promoters that can guide the expression of the elements. Suitable promoters can be selected according to the category of the host microorganism and the application requirements, for example, in prokaryotic microorganisms such as Escherichia coli, constitutive or inducible promoters can be selected to drive the expression of environmental tolerance-related genes; in eukaryotic organisms, suitable high-efficiency promoters or induction systems are selected.

[0046] The types of promoters used to regulate the expression of environmental tolerance-related genes in microorganisms include but are not limited to: constitutive promoters (continuous expression), inducible promoters (activated in the presence of specific inducers, such as lactose, arabinose, rhamnose induction, etc.), repressible promoters (inhibited in the presence of specific substances, such as nmt1 thiamine repressor-type promoters), bidirectional promoters (can simultaneously drive the transcription of genes on both sides), and environmental response promoters (respond to specific physical and chemical stimuli, such as temperature, light, pH changes, etc.). For example, some promoters that work under physical and chemical environmental stress conditions: high-salt environment promoters may respond to changes in osmotic pressure, high-temperature promoters induce expression during heat shock, low-temperature promoters activate expression when the temperature drops, strong light induction promoters respond to UV or strong light irradiation, etc.

[0047] According to the present application, the promoter can be of natural origin or artificially engineered synthetic promoter. The artificially engineered synthetic promoter can comprise sequences that can be recognized and bound by specific transcription factors, which can be naturally occurring or engineered designed, as long as there are corresponding minimal promoter elements (such as TATA box, etc.) in the host microorganism, so that the transcription factors can regulate the downstream genes by placing these regulatory sequences upstream.

[0048] Vector: The environment-tolerant microbial elements of the present application can be constructed on a conventional plasmid vector. The plasmid vector is a small circular DNA molecule artificially modified on the basis of natural plasmid to adapt to experimental operation. Compared with natural plasmid, the experimental plasmid vector usually carries one or more selection marker genes (such as antibiotic resistance genes) and an artificially synthesized multi-cloning site (MCS) sequence containing multiple restriction enzyme recognition sites, and most of the non-essential sequences are deleted, so that the molecular weight of the vector is as small as possible to facilitate operation. The vector is preferably an expression vector or an expression construct, meaning that the vector comprises a series of control elements (such as promoters, RBS, etc.) that can drive the transcription and / or translation of foreign genes in host cells. Generally, the expression vector includes the aforementioned promoter and the downstream nucleic acid sequence to be transcribed, and has a terminator near the end of transcription. In the embodiments of the present application, we selected standard BioBrick series plasmids (such as pSB1C3, etc.) as the basic vector for element cloning. These vectors contain a unified replication origin and resistance marker, suitable for standard part splicing and expression.

[0049] The plasmid vector can be introduced into the host microbial cells by common transformation or transfection techniques. For prokaryotes such as bacteria, methods that can be used include calcium chloride-mediated heat shock transformation, electroporation, natural competence method, particle bombardment, etc.; for eukaryotic microorganisms such as yeast, methods that can be used include lithium ion method, electroporation, viral vector transduction, etc. Those skilled in the art can select appropriate methods to make the recombinant vector enter the cells and be stably expressed according to the type of host.

[0050] II. Experimental methods

[0051] 1. Construction of standardized cold-tolerant gene EstA element

[0052] This embodiment takes the cold-adapted lipase gene EstA of the cold-tolerant strain Pseudoalteromonas sp. 643A as an example to illustrate the construction process of the standardized environment-tolerant microbial element in detail.

[0053] 1.1 Gene sequence acquisition and analysis

[0054] The nucleic acid sequence of EstA gene was obtained by searching NCBI database (GenBank Accession No: DQ508437.2), with a full length of 624 bp, encoding 208 amino acids. The sequence was analyzed using restriction enzyme site analysis software (such as NEBcutter), confirming that it does not contain EcoR I (GAATTC), Xba I (TCTAGA), Spe I (ACTAGT) and Pst I (CTGCAG) enzyme cutting sites, so no site modification is needed, and the sequence standardization step is directly entered.

[0055] 1.2 Sequence standardization modification

[0056] According to the standardization rules of the present application, since the 5' end of the EstA gene starts with the start codon "ATG", the 5' end prefix sequence is selected as (SEQ ID No: 1): gaattcgcggccgcttctag (containing EcoR I and Xba I sites); the 3' end suffix sequence is uniformly (SEQ ID No: 2): tactagtagcggccgctgcag (containing Spe I and Pst I sites).

[0057] The prefix sequence-EstA gene sequence-suffix sequence is spliced to form a complete standardized sequence (about 1250 bp in length), and a commercial company is commissioned to perform whole gene synthesis to obtain a standardized EstA gene fragment.

[0058] 1.3 Element cloning and verification

[0059] 1.3.1 PCR amplification: using the synthesized standardized EstA sequence as a template, the following primers are used for PCR amplification, and the primer binding sites are located in the conserved regions at both ends of the standardized sequence:

[0060] • Upstream primer SeqF (SEQ ID No: 3): 5'-TGAGCGAGGAAGCCTGCATA-3'

[0061] • Downstream primer SeqR (SEQ ID No: 4): 5'-TGAGCGGATACATATTTGAATG-3'

[0062] PCR reaction system (50 μL): 5×HF buffer 10 μL, 10 mM dNTP mixture 2 μL, upstream and downstream primers (100 μM) 1 μL each, template DNA 25 ng, high-fidelity DNA polymerase (such as NEB Q5) 0.5 μL, nuclease-free water to 50 μL.

[0063] Reaction conditions: 98°C pre-denaturation for 45 s; 98°C denaturation for 10 s, 68°C annealing for 20 s, 72°C extension for 1 min 15 s (30 cycles); 72°C final extension for 5 min. The amplified products were verified by 1% agarose gel electrophoresis, and the target fragments of about 1250 bp were obtained and purified using a PCR purification kit (e.g., Qiagen 28104).

[0064] 1.3.2 Double enzyme digestion: Take 2 μg of the purified PCR product, add 1 μL of EcoR I-HF (10 U / μL) and 1 μL of Pst I-HF (10 U / μL), 5 μL of 10x CutSmart buffer, and supplement with nuclease-free water to 50 μL, and incubate at 37°C for 1 h and deactivate at 65°C for 20 min. At the same time, take 6 μg of plasmid vector pSB1C3 (containing a chloramphenicol resistance gene) and perform the same enzyme digestion treatment. After enzyme digestion, the linearized vector (about 2000 bp) is recovered by cutting the gel.

[0065] 1.3.3 Ligation and transformation: Mix the enzyme-digested EstA fragment with the linearized pSB1C3 vector at a 3:1 molar ratio, add 1 μL of 10x T4 DNA ligase buffer, 0.5 μL of T4 DNA ligase (5 U / μL), and supplement with nuclease-free water to 10 μL, and incubate at room temperature for 10 min. Take 5 μL of the ligation product to transform E. coli BL21 (DE3) competent cells (ice bath for 5 min → heat shock at 42°C for 45 s → ice bath for 2 min → add 350 μL of SOC medium, and incubate at 37°C for 30 min with shaking), and spread on an LB plate containing chloramphenicol (25 μg / mL) and incubate at 37°C overnight.

[0066] 1.3.4 Positive clone verification: Pick 8 single colonies for colony PCR verification (primers are the same as in 1.3.1), and all amplify a band of about 1250 bp. Select 4 positive clones for culture, extract plasmids, and confirm that the inserted sequence is completely consistent with the designed standardized EstA sequence by Sanger sequencing (primers are SeqF / SeqR), the reading frame is correct, and there is no mutation. Finally, the standardized cold-resistant element pSB1C3-EstA is obtained.

[0067] 2. Standardization of salt-tolerant gene glnA containing internal enzyme digestion sites

[0068] This example takes the glutamine synthetase gene glnA (salt-tolerant key gene, GenBank accession number: 40155616) of Haloferax mediterranei as an example to illustrate the gene modification process containing internal enzyme digestion sites.

[0069] 2.1 Site modification

[0070] The full length of glnA gene is 1,783 bp, encoding 456 amino acids. Sequence analysis shows that it does not contain EcoR I (GAATTC), Xba I (TCTAGA), Spe I (ACTAGT) and Pst I (CTGCAG) enzyme cutting sites, so there is no need for site modification, and it can directly enter the sequence standardization step.

[0071] 2.2 Sequence standardization and cloning

[0072] According to the standardization rules of the present application, the 5' end prefix sequence of the glnA gene is selected as (SEQ ID No: 1) gaattcgcggccgcttctag (containing EcoR I and Xba I sites) since the 5' end of the glnA gene starts with the start codon "ATG"; and the 3' end suffix sequence is uniformly (SEQ ID No: 2) tactagtagcggccgctgcag (containing Spe I and Pst I sites).

[0073] After the spliced sequence is commissioned for synthesis, the method of PCR amplification, double enzyme cutting (EcoR I / Pst I), and ligation to the pSB1A3 vector in Example 1 is used to obtain the standardized salt-tolerant element pSB1A3-glnA, and sequencing verification shows that there is no error.

[0074] 3. Construction of a library of standardized biological elements of other environmental tolerance genes

[0075] In this example, the methods of Examples 1 and 2 are used to standardize the environmental tolerance genes (covering cold tolerance, heat tolerance, salt tolerance, acid tolerance, heavy metal tolerance, etc.) exemplified in Table 1, proving the universality of the method of the present application. The specific steps are as follows:

[0076] (1) Perform enzyme cutting site analysis on each gene, and remove EcoR I, Xba I, Spe I, and Pst I sites by synonymous substitution. If the target gene sequence does not originally contain these enzyme cutting sites, this step can be skipped.

[0077] (2) Add standard prefix and suffix sequences to the ends of the site-free sequence obtained in step (1) in the 5'→3' direction to obtain a sequence with standard sites at both ends. The specific operation is the same as step (2) of Example 1. If the gene starts with ATG at the 5' end, the prefix is (SEQ ID No: 5) gaattcgcggccgcttctag, otherwise the prefix is (SEQ ID No: 6) gaattcgcggccgcttctagag; the suffix is uniformly (SEQ ID No: 7) tactagtagcggccgctgcag. This process can be used to synthesize standardized sequences by commercial gene synthesis or primer PCR to introduce corresponding adapters;

[0078] (3) The subsequent PCR amplification, double enzyme digestion, vector ligation, transformation and sequencing verification steps are similar to step (3) of Example 1. The elements are cloned into vectors such as pSB1C3, pSB3K3 (kanamycin resistance), and the like, and after sequencing verification, the corresponding standardized environmental tolerance microbial elements are obtained;

[0079] (4) The elements are classified by function and stored in the form of plasmid solution in a 96-well plate (each well contains 8 μg of plasmid DNA), frozen and dried (-80°C pre-freezing for 2 h, vacuum freeze-drying for 12 h), sealed with aluminum foil, and stored at -20°C to form the standardized environmental tolerance microbial element library of the present application, including cold-tolerant enzyme elements, salt-tolerant elements, acid / heavy metal-tolerant elements, and the like. These elements, together with the elements constructed in Examples 1 and 2, form a library of a variety of standardized environmental tolerance microbial elements.

[0080] All the standardized biological elements obtained in the examples are prepared in the form of a 96-well plate freeze-dried biochip, and the convenience in actual use is verified.

[0081] First, a large amount of sample of each standardized environmental tolerance microbial element corresponding to the recombinant plasmid is prepared (e.g., plasmid DNA is extracted and quantified). About 8 μg of each plasmid is taken and sequentially added to the automatic dispensing instrument tank. The automatic dispensing instrument is used to sequentially dispense each plasmid solution into individual wells of a 96-well plate, with a predetermined volume (8 μg of plasmid, corresponding to about 10 μL of solution, for subsequent dissolution) added to each well. Each well plate position and plasmid element correspond one-to-one, and a coded label is attached for easy tracking. After dispensing is complete, the 96-well plate is placed in a freeze-drying machine for freeze-drying treatment until a dry plasmid reagent film is formed in each well of the plate. Finally, the 96-well plate is sealed and packaged with anhydrous tin foil, stored in the dark at low temperature, forming a library of standardized environmental tolerance microbial elements in the form of a biochip.

[0082] In actual use, the tin foil seal is torn open and the desired element is taken from the corresponding well. About 10 μL of sterile water (or TE buffer) is added to the well to re-dissolve the freeze-dried plasmid DNA. 1 μL of the re-dissolved plasmid solution is directly used for transformation experiments of E. coli competent cells (transformation method same as Example 1), to verify the effect of freeze-drying preservation on plasmid activity. We selected several elements preserved by freeze-drying in the library (including the M37 element of Example 1 and other elements constructed in Example 2) for transformation, and expected resistant colonies grew on the plates after transformation, indicating that the plasmid remained active. Further, single colony amplification and plasmid extraction, enzyme digestion or sequencing analysis were all consistent with the original constructed plasmid, proving that the freeze-drying process had no adverse effects on the element DNA. Therefore, the element library of the present application prepared in the form of a freeze-dried biochip is convenient for transportation, storage and high-throughput screening, and has good convenience in actual application.

[0083] 4. Component library functionality verification

[0084] Taking the salt-resistant component glnA (pSB1A3-glnA) from the component library as an example, we verify its function of imparting salt resistance to the host:

[0085] (1) Construction of engineered bacteria: pSB1C3-EstA was transformed into Escherichia coli DH5α to obtain recombinant bacteria DH5α / EstA; DH5α transformed by empty vector pSB1C3 was used as a control.

[0086] (2) Salt resistance test:

[0087] The two bacterial strains were inoculated into LB medium (containing ampicillin) containing 0%, 5%, 8%, and 10% NaCl, respectively, and cultured at 37℃ and 220 rpm for 24 h. OD values ​​were then measured. 600 value.

[0088] Results: The control bacteria showed OD under 5% NaCl conditions. 600 =0.18, almost no growth under 10% NaCl conditions; while DH5α / glnA OD under 5% NaCl conditions 600 =1.32, OD under 8% NaCl conditions 600 =0.75, indicating that the glnA element significantly improves the salt tolerance of Escherichia coli.

[0089] 5: Component modular assembly function verification

[0090] A bifunctional module was constructed by assembling the salt-tolerant element pSB1A3-glnA and the heat-resistant element pSB1C3-TM0504, derived from the heat-resistant enzyme gene of Thermotogamaritima.

[0091] (1) pSB1A3-glnA was digested with XbaⅠ and PstⅠ enzymes, and the glnA-containing fragment (1520bp) was recovered;

[0092] (2) pSB1C3-TM0504 was digested with SpeⅠ and PstⅠ enzymes, and the vector backbone (containing TM0504 and pSB1C3) was recovered.

[0093] (3) Since the XbaⅠ and SpeⅠ enzyme digestion ends are complementary (both are 5′-CTAGA-3′), there are no enzyme digestion sites at the ligation site after ligation, and the recombinant plasmid pSB1C3-TM0504-glnA is obtained.

[0094] (4) Functional verification: The E. coli transformed by this module showed OD200 under 8% NaCl + 50℃ conditions. 600 =0.63, while the value of a single-element modified bacteria is only 0.21-0.25, proving that the module assembly achieves functional superposition.

[0095] The above examples demonstrate that the present application can efficiently construct environment-tolerant microbial elements through a standardized modification strategy, the elements can be modularly assembled, and specific environmental tolerance can be conferred to the host. The freeze-dried storage form of the element library is convenient for application and is suitable for industrial fermentation, environmental remediation, and other scenarios.

[0096] Although the present application has been disclosed with reference to the preferred embodiments, it is not intended to limit the present application, and any person skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application. Therefore, the protection scope of the present application should be defined by the claims.

Claims

1. A library of standardized, environmentally resistant microbial elements, characterized in that, The element library is composed of a plurality of standardized environment-tolerant microbial elements, each of which is constructed by the following steps: (1) Site modification: based on the nucleic acid sequence of the environment-tolerant gene or its regulatory element, the EcoRI, XbaI, Spel and PstI restriction enzyme cleavage sites present in the nucleic acid sequence are removed by synonymous codon substitution to obtain a nucleic acid sequence free of the above enzyme cleavage sites; (2) Sequence standardization: the nucleic acid sequence free of enzyme cleavage sites obtained in step (1) is added with a standardized nucleic acid sequence prefix at the 5' end and a standardized nucleic acid sequence suffix at the 3' end in the 5' end to 3' end direction to obtain a standardized sequence with standardized sites at both ends; the 5' end of the standardized sequence contains EcoRI and XbaI enzyme cleavage sites, and the 3' end contains Spel and PstI enzyme cleavage sites; if the 5' end of the nucleic acid sequence free of enzyme cleavage sites starts with "ATG", the prefix sequence is gaattcgcggccgcttctag, otherwise the prefix sequence is gaattcgcggccgcttctagag; the suffix sequence is tactagtagcggccgctgcag; (3) Element cloning and construction: the standardized sequence obtained in step (2) is double-digested with EcoRI and PstI, and then ligated and cloned into a plasmid vector to obtain the standardized environment-tolerant microbial element.

2. The library of standardized, environmentally resistant microbial elements of claim 1, wherein, The environment-tolerant gene is a nucleic acid sequence encoding a protein with physicochemical environment stress tolerance function, including one or more of an antifreeze protein gene, an anti-high-salt protective enzyme gene, a high-temperature tolerance enzyme gene, an acid-resistant transport protein gene, a heavy metal transport protein gene, a metallothionein gene, a DNA repair enzyme gene, an antioxidant enzyme gene, a trehalose synthetase gene, or a LEA protein gene.

3. The library of standardized, environmentally resilient microbial elements of claim 1, wherein, The regulatory element includes one or more of a promoter, an enhancer, a terminator, or a ribosome binding site.

4. The library of standardized, environmentally resilient microbial elements of claim 1, wherein, The plasmid vector is pSB1A3, pSB1C3, pSB3K3, p15A, pSC101, pMB1, or pUC plasmid vector and its improved versions.

5. A method of constructing a library of standardized environmental-tolerant microbial elements according to any one of claims 1-4, characterized in that, comprising the following steps: (1) site modification of the nucleic acid sequence of the environment-tolerant gene or its regulatory element to remove EcoRI, XbaI, Spel and PstI enzyme cleavage sites therein; (2) sequence standardization of the nucleic acid sequence treated in step (1) by adding the prefix sequence and the suffix sequence of claim 1 to the 5' end and the 3' end thereof, respectively; (3) cloning the standardized sequence treated in step (2) into a plasmid vector to obtain a standardized environment-tolerant microbial element; (4) collecting a plurality of standardized environment-tolerant microbial elements constructed by steps (1)-(3) to form the standardized environment-tolerant microbial element library.

6. The method of claim 5, wherein, In step (1), the enzyme cleavage sites are removed by synonymous codon substitution without changing the encoded amino acid sequence.

7. The method of claim 5, wherein, The prefix sequence and suffix sequence added in step (2) make the standardized sequence capable of being cleaved by EcoR I / Xba I and Spe I / Pst I, and the connection between adjacent elements has no EcoR I, Xba I, Spe I and Pst I cleavage sites.

8. Use of the library of standardized environmentally tolerant microbial elements according to any one of claims 1 to 4 for genetic engineering of microorganisms, characterized in that, The standardized environmental tolerance microbial elements in the element library are introduced into host cells to endow the host cells with environmental stress tolerance or specific functions.

9. The use according to claim 8, characterized in that, The application includes connecting multiple standardized environmental tolerance microbial elements in a designed order, assembling a genetic module with specific functions, and then introducing the module into host cells to realize the modification of the phenotype of the host cells.

10. The use according to claim 8 or 9, characterized in that, The application fields include industrial fermentation, biological mining, environmental management, agricultural microbial modification or space biology research; the host cells include Escherichia coli, Pseudomonas, Halomonas, yeast or actinomycetes, and the biological element library can be stored in liquid form or freeze-dried powder form as needed and constructed in the form of a biochip.

Images