Reeditable templates, cells, compositions and methods of making

Abstract

The invention provides, inter alia, a method of engineering a reeditable target locus in a cell, the method comprising inserting an exogenous reeditable template sequence into the target locus; a method of engineering a reeditable cell, the cell comprising a reeditable template sequence flanked by two homologous arms such that the reeditable template sequence is inserted into a target locus by homologous recombination, and a method of engineering a reeditable cell comprising a reeditable template sequence flanked by two homologous arms, and methods of use thereof. In some aspects, a reeditable template sequence is provided, where the template sequence has no substantial sequence similarity to any region in the genome, and where the template sequence can be identified by a genome editing system.

Description

[0001] Cross-reference to related applications

[0002] This application claims priority and benefit to U.S. Provisional Patent Application Serial No. 63 / 465,352, filed May 10, 2023, the contents of which are incorporated herein by reference in their entirety.

[0003] The sequence list is incorporated by reference.

[0004] This application contains a sequence list, which has been submitted electronically in XML format and is hereby incorporated in its entirety by reference. The sequence list file is titled MIL-024WO1.XML, created on April 24, 2024, and is 18,368,504 bytes in size. Background Technology

[0005] Genome editing technologies based on programmable nucleases such as large-scale nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR-associated RNA-guided nucleases (e.g., Cas9, Cas12a) are powerful tools for achieving therapeutic genome editing at precise loci in diseased cells and tissues, thereby removing or correcting harmful mutations or inserting protective mutations.

[0006] While ZFNs, TALENs, and a wide range of nucleases achieve specific DNA binding via protein-DNA interactions, Cas and related nucleases target specific sites via RNA-guided molecules that directly pair with the target locus. However, despite the benefits of precise genome targeting, these genome editing techniques have limitations, such as unwanted cuts at previously edited sites and at off-target sites of remaining concern.

[0007] Sequence-specific recombinases and integrases, such as serine recombinases specific to unique attachment sites (attP and attB), are other useful tools for expanding genome engineering strategies because they recognize and target specific genomic sequences, thereby repairing gene mutations or enabling site-specific integration of functional genes. However, the insertion of DNA sequences into the genome is not seamless, and residual sequences from integration events are preserved.

[0008] On the other hand, programmable epigenome editing does not require DNA breaks, thus eliminating gene editing-related cytotoxicity, and it is also tunable and reversible. However, programmable epigenome editing requires constitutive expression of dCas fusion proteins, making it challenging for therapeutic cell and organism editing. Summary of the Invention

[0009] The present invention provides flexible genome editing technologies that are precise and specific to a target locus, and allow for reengineering and further manipulation of the edited locus to achieve different phenotypes in a short time or reengineering of cells for a particular phenotype for therapeutic use. As described in more detail below and in the examples, the present invention provides "re-editing technologies" that include methods of engineering a re-editable target locus and cells with a re-editable template. Methods of designing a re-editable template that is unique and recognizable by a particular genome editing system are provided herein.

[0010] The present invention provides, among other things, methods of engineering a re-editable target locus in a cell, the method comprising inserting an exogenous re-editable template sequence into the target locus, wherein the template sequence has no substantial sequence similarity to any region in the genome, and wherein the template sequence is recognizable by a genome editing system. The present invention also provides, among other things, methods of engineering a re-editable cell and methods of use thereof, the cell comprising a unique re-editable template sequence flanked by two homology arms such that the re-editable template sequence is inserted into a target locus by homologous recombination.

[0011] In some aspects, provided herein are re-editable template sequences, wherein the template sequence has no substantial sequence similarity to any region in the genome, and wherein the template sequence is recognizable by a genome editing system. The re-editable templates of the present invention allow for subsequent targeted modification of the cell by a different genome editing nuclease than the one used to insert the re-editable template. The re-editable templates and methods of the present invention facilitate the rapid development of multiple different types of mutations in a platform cell in a plug-and-play approach for multiple different indications.

[0012] Because the re-editable template of the present application is designed to have no substantial sequence similarity to any region in the genome (e.g., where another coding region in the genome that can be recognized by the guide RNA or another nuclease system contains at least 3 mismatches), off-target editing is minimized or eliminated, and thus the methods provided herein modify the locus to be uniquely edited using one or more genome editing tools, such as CRISPR-Cas, transcription activator-like effector nucleases (TALENs), or zinc finger nucleases (ZFNs). In some embodiments, in the CRISPR-Cas system, gRNAs with established on- and off-target profiles are used to accurately modify the target locus. In some embodiments, the re-editable locus can be edited by another gRNA, but not the same gRNA as the one used to insert the re-editable template. In some embodiments, the wild-type gene is knocked out by insertion of the re-editable template.

[0013] As described in the Examples section, in some embodiments, the HLA class I and II genes are knocked out and an exemplary modified target locus, such as B2M and CIITA, is integrated with a particular re-editable template for inducing a nuclease to make a double-strand break, and thus enable subsequent manipulation. In some embodiments, in the subsequent manipulation, a protein-coding gene is integrated in the template sequence, e.g., to protect the cell from recognition by NK cells (masking gene), to terminate the cell in the presence of an inducing molecule (safety switch), or to express one or more proteins that can increase the efficacy of the product (e.g., CAR cassette). In some embodiments, a platform iPSC line is generated that is amenable to modification due to the integrated re-editable template, with the advantage of shortening the manufacturing time in a GMP suite to provide a universal off-the-shelf therapeutic iPSC or iPSC-derived cell for treating a variety of conditions, thereby reducing costs. In short, the present application is summarized as follows: In some aspects, provided herein are methods of engineering a re-editable target locus in a cell, the method comprising inserting an exogenous re-editable template sequence into the target locus, wherein the template sequence has no substantial sequence similarity to any region in the genome, and wherein the template sequence is recognizable by a genome editing system.

[0014] In some aspects, provided herein are methods of engineering a re-editable cell, the method comprising introducing an exogenous re-editable template sequence flanked by two homology arms such that the re-editable template sequence is inserted into a target locus by homologous recombination, wherein the template sequence has no substantial sequence similarity to any region in the genome, and wherein the template sequence is recognizable by a genome editing system.

[0015] In some embodiments, the genome editing system is a CRISPR-Cas associated nuclease system, a Transcription Activator-Like Effector Nuclease (TALEN) system, or a Zinc Finger Nuclease (ZFN) system. In some embodiments, the genome editing system is a CRISPR-Cas associated nuclease system. In some embodiments, the genome editing system is a Transcription Activator-Like Effector Nuclease (TALEN) system. In some embodiments, the genome editing system is a Zinc Finger Nuclease (ZFN) system.

[0016] In some embodiments, the Cas protein is Cas9, Casl2a, or Casl2b. In some embodiments, the Cas protein is Cas9. In some embodiments, the Cas protein is Casl2a. In some embodiments, the Cas protein is Casl2b.

[0017] In some embodiments, the Cas protein is an enzymatically dead Cas protein or a nickase. In some embodiments, the Cas protein is an enzymatically dead Cas protein. In some embodiments, the Cas protein is a nickase. In some embodiments, the Cas protein is Cas9 D10A or Cas9 H840A.

[0018] In some embodiments, the Cas nuclease, TALEN, or ZFN is fused to a Fokl nuclease or a related nuclease domain. In some embodiments, the Cas nuclease is fused to a Fokl nuclease. In some embodiments, the enzymatically dead Cas nuclease or nickase is fused to a Fokl nuclease. In some embodiments, the Cas9 D10A or Cas H840A is fused to a Fokl nuclease. In some embodiments, the TALEN is fused to a Fokl nuclease. In some embodiments, the ZFN is fused to a Fokl nuclease. In some embodiments, the Cas9 D10A or Cas H840A is fused to a Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase.

[0019] In some embodiments, the homology arm is between about 50 nt to 500 nt. In some embodiments, the homology arm is about 50 nt. In some embodiments, the homology arm is about 100 nt. In some embodiments, the homology arm is about 150 nt. In some embodiments, the homology arm is about 200 nt. In some embodiments, the homology arm is about 250 nt. In some embodiments, the homology arm is about 300 nt. In some embodiments, the homology arm is about 350 nt. In some embodiments, the homology arm is about 400 nt. In some embodiments, the homology arm is about 450 nt. In some embodiments, the homology arm is about 500 nt. In some embodiments, the homology arm is greater than 500 nt.

[0020] In some embodiments, the re-editable template is between about 10-500 nt. In some embodiments, the re-editable template is about 10 nt. In some embodiments, the re-editable template is about 20 nt. In some embodiments, the re-editable template is about 30 nt. In some embodiments, the re-editable template is about 40 nt. In some embodiments, the re-editable template is about 50 nt. In some embodiments, the re-editable template is about 60 nt. In some embodiments, the re-editable template is about 70 nt. In some embodiments, the re-editable template is about 80 nt. In some embodiments, the re-editable template is about 90 nt. In some embodiments, the re-editable template is about 100 nt.

[0021] In some embodiments, the re-editable template is about 150 nt. In some embodiments, the re-editable template is about 200 nt. In some embodiments, the re-editable template is about 250 nt. In some embodiments, the re-editable template is about 300 nt. In some embodiments, the re-editable template is about 350 nt. In some embodiments, the re-editable template is about 400 nt. In some embodiments, the re-editable template is about 450 nt. In some embodiments, the re-editable template is about 500 nt.

[0022] In some embodiments, the re-editable template comprises a protospacer adjacent motif (PAM). In some embodiments, the re-editable template comprises a 5'-NGG-3' PAM and the nuclease is Cas9. In some embodiments, the re-editable template comprises a specific PAM for a specific Cas nuclease.

[0023] In some embodiments, the coding region in the genome that can be recognized by the guide RNA contains at least 3 mismatches relative to the sequence in the re-editable template that can be recognized by the guide RNA. In some embodiments, the coding region in the genome that can be recognized by the guide RNA contains at least 4 mismatches relative to the sequence in the re-editable template that can be recognized by the guide RNA. In some embodiments, there is no off-target editing.

[0024] In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a cultured cell. In some embodiments, the cell is a primary cell. In some embodiments, the cell is a non-dividing cell. In some embodiments, the cell is an immune cell. In some embodiments, the cell is a B cell, a T cell, or an NK cell. In some embodiments, the cell is a stem cell or progenitor cell. In some embodiments, the cell is an induced pluripotent stem cell (iPSC).

[0025] In some embodiments, the target locus is at least one locus selected from the group consisting of a pan-expressed gene, a cell division-associated gene, and a gene whose expression is restricted to a particular cell type. In some embodiments, the target locus is a Class I or Class II HLA gene. In some embodiments, the target locus is a Class I HLA gene. In some embodiments, the target locus is a Class II HLA gene. In some embodiments, the target locus is B2M.

[0026] In some embodiments, the gRNA that directs a double-strand break to insert a re- editable template in the B2M exon 1 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to GAGTAGCGCGAGCACAGCTA (SEQ ID NO: 1), AGGGTAGGAGAGACTCACGC (SEQ ID NO: 2), or GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 3). In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 1 locus is 70% identical to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 1 locus is 75% identical to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 1 locus is 80% identical to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 1 locus is 85% identical to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 1 locus is 90% identical to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 1 locus is 95% identical to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 1 locus is 99% identical to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 1 locus is 100% identical to any one of SEQ ID NOs: 1-3.

[0027] In some embodiments, the editable template is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to ATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCCAGGTCCTAATGATTAGCTGTGCTCGCCCTGCTCTCTCTGTCTGGCCTGGAGGCTATTCAGCGTGAGTCTCTCCTACCCTCCCGCTCTGGTCCTTCCTCTCCCGCTCTGCACCCTCTGTGGCCCT (SEQ ID NO: 5). In some embodiments, the editable template is defined by a sequence having 70% identity to SEQ ID NO: 5. In some embodiments, the editable template is defined by a sequence having 75% identity to SEQ ID NO: 5. In some embodiments, the editable template is defined by a sequence having 80% identity to SEQ ID NO: 5. In some embodiments, the editable template is defined by a sequence having 85% identity to SEQ ID NO: 5. In some embodiments, the editable template is defined by a sequence having 90% identity to SEQ ID NO: 5. In some embodiments, the editable template is defined by a sequence having 95% identity to SEQ ID NO: 5. In some embodiments, the editable template is defined by a sequence having 99% identity to SEQ ID NO: 5. In some embodiments, the editable template is defined by a sequence having 100% identity to SEQ ID NO: 5.

[0028] In some embodiments, the re-editable template is defined by a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% identity to AAAACGGGAAAGTCCCTCTCTCTAACCTGGCACTGCGTCGCTGGCTTGGAGACAGGTGACGGTCCCTGCGGGCCTTGTCCTGATTGGCTGGGCACGCGTTTAATATAAGTGGAGGCGTCGCGCTGGCGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCGTAGAGCGTGTGACTAGCTGTACTGGAGCTGTGAAGCTAATCCGGTCTGGAAGCCATTCAGCGTGAGTCTCTCCTACCCTCCCGCTCTGGTCCTTCCTCTCCCGCTCTGCACCCTCTGTGGCCCTCGCTGTGCTCTCTCGCTCCGTGACTTCCCTTCTCCAAGTTCTCCTTGGT (SEQ ID NO: 6). In some embodiments, the re-editable template is defined by a sequence having 70% identity to SEQ ID NO: 6. In some embodiments, the re-editable template is defined by a sequence having 75% identity to SEQ ID NO: 6. In some embodiments, the re-editable template is defined by a sequence having 80% identity to SEQ ID NO: 6. In some embodiments, the re-editable template is defined by a sequence having 85% identity to SEQ ID NO: 6. In some embodiments, the re-editable template is defined by a sequence having 90% identity to SEQ ID NO: 6. In some embodiments, the re-editable template is defined by a sequence having 95% identity to SEQ ID NO: 6. In some embodiments, the re-editable template is defined by a sequence having 99% identity to SEQ ID NO: 6. In some embodiments, the re-editable template is defined by a sequence having 100% identity to SEQ ID NO: 6.

[0029] In some embodiments, the gRNA that directs a double-strand break to insert a re- editable template in the B2M exon 2 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to AAGTCAACTTCAATGTCGGA (SEQ ID NO: 7), AGTCACATGGTTCACACGGC (SEQ ID NO: 8), or ACTTGTCTTTCAGCAAGGAC (SEQ ID NO: 9). In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 2 locus is 70% identical to any one of SEQ ID NOs: 7-9. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 2 locus is 75% identical to any one of SEQ ID NOs: 7-9. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 2 locus is 80% identical to any one of SEQ ID NOs: 7-9. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 2 locus is 85% identical to any one of SEQ ID NOs: 7-9. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 2 locus is 90% identical to any one of SEQ ID NOs: 7-9. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 2 locus is 95% identical to any one of SEQ ID NOs: 7-9. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 2 locus is 99% identical to any one of SEQ ID NOs: 7-9. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 2 locus is 100% identical to any one of SEQ ID NOs: 7-9.

[0030] In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 70%, 80%, 90%, 95%, 99%, or 100% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 70% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 80% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 90% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 95% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 99% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 99% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 100% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4).

[0031] In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 2 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to CCTAGATCCAATAGTAGAGT (SEQ ID NO: 10) or GGTCACGTGGTTCACCCTAC (SEQ ID NO: 11). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 2 locus is 70% identical to either of SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 2 locus is 75% identical to either of SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 2 locus is 80% identical to either of SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 2 locus is 85% identical to either of SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 2 locus is 90% identical to either of SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 2 locus is 95% identical to either of SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 2 locus is 99% identical to either of SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 2 locus is 100% identical to either of SEQ ID NO: 10 or 11. In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus is 70% identical to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus is 80% identical to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4).In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 90% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 95% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 99% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 100% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4).

[0032] In some embodiments, the target locus is CIITA.

[0033] In some embodiments, the target locus is CIITA.

[0034] In some embodiments, the gRNA that directs a double-strand break to insert a re- editable template in exon 2 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15). In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in exon 2 of the CIITA locus is 70% identical to any one of SEQ ID NOs: 13-15. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in exon 2 of the CIITA locus is 75% identical to any one of SEQ ID NOs: 13-15. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in exon 2 of the CIITA locus is 80% identical to any one of SEQ ID NOs: 13-15. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in exon 2 of the CIITA locus is 85% identical to any one of SEQ ID NOs: 13-15. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in exon 2 of the CIITA locus is 90% identical to any one of SEQ ID NOs: 13-15. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in exon 2 of the CIITA locus is 95% identical to any one of SEQ ID NOs: 13-15. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in exon 2 of the CIITA locus is 99% identical to any one of SEQ ID NOs: 13-15. In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in exon 2 of the CIITA locus is 100% identical to any one of SEQ ID NOs: 13-15.

[0035] In some embodiments, the editable template is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to TTCTGCCTCTTTCCAACACCCTGTGAGGTGACTGAGCATTGTCTTCCCTCCCAGGCAGTTCCCAGTGTGCTACCATGGAGTTGTGACCCCTATAATGAGACCTGGCTGGAGAAGAAGAGATTGAGCTCTACTCAGGTGGGCCCTCCTCC (SEQ ID NO: 18). In some embodiments, the editable template is defined by a sequence having 70% identity to SEQ ID NO: 18. In some embodiments, the editable template is defined by a sequence having 75% identity to SEQ ID NO: 18. In some embodiments, the editable template is defined by a sequence having 80% identity to SEQ ID NO: 18. In some embodiments, the editable template is defined by a sequence having 85% identity to SEQ ID NO: 18. In some embodiments, the editable template is defined by a sequence having 90% identity to SEQ ID NO: 18. In some embodiments, the editable template is defined by a sequence having 90% identity to SEQ ID NO: 18. In some embodiments, the editable template is defined by a sequence having 95% identity to SEQ ID NO: 18. In some embodiments, the editable template is defined by a sequence having 99% identity to SEQ ID NO: 18. In some embodiments, the editable template is defined by a sequence having 100% identity to SEQ ID NO: 18.

[0036] In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 70% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 80% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 90% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 95% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 99% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 100% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17).

[0037] In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 70% identical to SEQ ID NO: 19. In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 75% identical to SEQ ID NO: 19. In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 80% identical to SEQ ID NO: 19. In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 85% identical to SEQ ID NO: 19. In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 90% identical to SEQ ID NO: 19. In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 95% identical to SEQ ID NO: 19. In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 99% identical to SEQ ID NO: 19. In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 100% identical to SEQ ID NO: 19.

[0038] In some embodiments, the gRNA that recognizes the editable template inserted in exon 3 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to TGACTGATGTAAGACTAGTA (SEQ ID NO: 20). In some embodiments, the gRNA that recognizes the editable template inserted in exon 3 of the CIITA locus is 70% identical to SEQ ID NO: 20. In some embodiments, the gRNA that recognizes the editable template inserted in exon 3 of the CIITA locus is 75% identical to SEQ ID NO: 20. In some embodiments, the gRNA that recognizes the editable template inserted in exon 3 of the CIITA locus is 80% identical to SEQ ID NO: 20. In some embodiments, the gRNA that recognizes the editable template inserted in exon 3 of the CIITA locus is 85% identical to SEQ ID NO: 20. In some embodiments, the gRNA that recognizes the editable template inserted in exon 3 of the CIITA locus is 90% identical to SEQ ID NO: 20. In some embodiments, the gRNA that recognizes the editable template inserted in exon 3 of the CIITA locus is 95% identical to SEQ ID NO: 20. In some embodiments, the gRNA that recognizes the editable template inserted in exon 3 of the CIITA locus is 99% identical to SEQ ID NO: 20. In some embodiments, the gRNA that recognizes the editable template inserted in exon 3 of the CIITA locus is 100% identical to SEQ ID NO: 20.

[0039] In some embodiments, the re-editable template is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to AAATTTCCTTCTTCATCCAAGGGACTTTTCCTCCCAGAACCCGACACAGACACCATCAACTGCGACCAGTTCAGCTGACTGATGTAAGACTAGTAAGGTGATGAAGAGACCAGGGAGGCTTATGCCAATATCGGTGAGGAAGCACCTGAGCCCAGAAAAGGACAATCAAGGGCAAGAGTTCTTTGCTGCCACTTGTCA (SEQ ID NO: 21). In some embodiments, the re-editable template is defined by a sequence having 70% identity to SEQ ID NO: 21. In some embodiments, the re-editable template is defined by a sequence having 75% identity to SEQ ID NO: 21. In some embodiments, the re-editable template is defined by a sequence having 80% identity to SEQ ID NO: 21. In some embodiments, the re-editable template is defined by a sequence having 85% identity to SEQ ID NO: 21. In some embodiments, the re-editable template is defined by a sequence having 90% identity to SEQ ID NO: 21. In some embodiments, the re-editable template is defined by a sequence having 95% identity to SEQ ID NO: 21. In some embodiments, the re-editable template is defined by a sequence having 99% identity to SEQ ID NO: 21. In some embodiments, the re-editable template is defined by a sequence having 100% identity to SEQ ID NO: 21.

[0040] In some embodiments, the re-editable template comprises an exogenous protein coding gene. In some embodiments, the exogenous gene is an immunomodulatory gene or a masking gene. In some embodiments, the exogenous gene is an immunomodulatory gene. In some embodiments, the exogenous gene is a masking gene. In some embodiments, the exogenous gene expresses a protein that causes cell death, wherein the gene is selected from the group consisting of HSV-TK, iCaspase8, and iCaspase9. In some embodiments, the exogenous gene expresses a protein that causes cell death of proliferating cells in the presence of a specific compound, wherein the gene is HSV-TK. In some embodiments, the exogenous gene expresses a protein that causes cell death upon activation, wherein the gene is iCaspase8. In some embodiments, the exogenous gene expresses a protein that causes cell death upon activation, wherein the gene is iCaspase9.

[0041] In some embodiments, the re-editable template comprises a chimeric antigen receptor (CAR) gene.

[0042] In some embodiments, provided are isolated cells engineered by the methods provided herein.

[0043] In some embodiments, provided herein are engineered cells comprising a re-editable target locus, wherein the re-editable target locus comprises an exogenous re-editable template sequence that does not have substantial sequence similarity to any region in the remainder of the genome, and wherein the re-editable template sequence is recognizable by a genome editing system.

[0044] In some embodiments, the genome editing system is a CRISPR-Cas associated nuclease system, a transcription activator-like effector nuclease (TALEN) system, or a zinc finger nuclease (ZFN) system. In some embodiments, the genome editing system is a CRISPR-Cas associated nuclease system. In some embodiments, the genome editing system is a transcription activator-like effector nuclease (TALEN) system. In some embodiments, the genome editing system is a zinc finger nuclease (ZFN) system.

[0045] In some embodiments, the cell comprises a Cas protein, wherein the Cas protein is Cas9, Casl2a, or Casl2b. In some embodiments, the Cas protein is Cas9. In some embodiments, the Cas protein is Casl2a. In some embodiments, the Cas protein is Casl2b.

[0046] In some embodiments, the Cas protein of the engineered cell is an enzymatically inactive Cas protein or a nickase. In some embodiments, the Cas protein is an enzymatically inactive Cas protein. In some embodiments, the Cas protein is a nickase. In some embodiments, the Cas protein is Cas9 D10A or Cas9 H840A.

[0047] In some embodiments, the Cas protein, TALEN, or ZFN is fused to a Fokl nuclease or a related nuclease domain. In some embodiments, the Cas protein is fused to a Fokl nuclease. In some embodiments, the enzymatically inactive Cas protein or the nickase is fused to a Fokl nuclease. In some embodiments, Cas9 D10A or Cas9 H840A is fused to a Fokl nuclease or an M-MLV reverse transcriptase. In some embodiments, the TALEN is fused to a Fokl nuclease. In some embodiments, the ZFN is fused to a Fokl nuclease.

[0048] In some embodiments, the homology arm is between about 50 nt to 500 nt. In some embodiments, the homology arm is about 50 nt. In some embodiments, the homology arm is about 100 nt. In some embodiments, the homology arm is about 150 nt. In some embodiments, the homology arm is about 200 nt. In some embodiments, the homology arm is about 250 nt. In some embodiments, the homology arm is about 300 nt. In some embodiments, the homology arm is about 350 nt. In some embodiments, the homology arm is about 400 nt. In some embodiments, the homology arm is about 450 nt. In some embodiments, the homology arm is about 500 nt. In some embodiments, the homology arm is greater than about 500 nt.

[0049] In some embodiments, the re-editable template is between about 10-500 nt. In some embodiments, the re-editable template is about 10 nt. In some embodiments, the re-editable template is about 20 nt. In some embodiments, the re-editable template is about 30 nt. In some embodiments, the re-editable template is about 40 nt. In some embodiments, the re-editable template is about 50 nt. In some embodiments, the re-editable template is about 60 nt. In some embodiments, the re-editable template is about 70 nt. In some embodiments, the re-editable template is about 80 nt. In some embodiments, the re-editable template is about 90 nt. In some embodiments, the re-editable template is about 100 nt.

[0050] In some embodiments, the re-editable template is about 150 nt. In some embodiments, the re-editable template is about 200 nt. In some embodiments, the re-editable template is about 250 nt. In some embodiments, the re-editable template is about 300 nt. In some embodiments, the re-editable template is about 350 nt. In some embodiments, the re-editable template is about 400 nt. In some embodiments, the re-editable template is about 450 nt. In some embodiments, the re-editable template is about 500 nt.

[0051] In some embodiments, the re-editable template of the cell comprises a protospacer adjacent motif (PAM). In some embodiments, the re-editable template comprises a 5'-NGG-3' PAM and the nuclease is Cas9. In some embodiments, the re-editable template comprises a specific PAM for a specific Cas nuclease.

[0052] In some embodiments, the coding region in the genome that can be recognized by the guide RNA contains at least 3 mismatches. In some embodiments, the coding region in the genome that can be recognized by the guide RNA contains 3 mismatches. In some embodiments, the coding region in the genome that can be recognized by the guide RNA contains more than 3 mismatches. In some embodiments, the coding region in the genome that can be recognized by the guide RNA contains 4 mismatches. In some embodiments, the coding region in the genome that can be recognized by the guide RNA contains 5 mismatches. In some embodiments, the coding region in the genome that can be recognized by the guide RNA contains 6 mismatches. In some embodiments, the coding region in the genome that can be recognized by the guide RNA contains 7 mismatches. In some embodiments, the coding region in the genome that can be recognized by the guide RNA contains 8 mismatches. In some embodiments, the coding region in the genome that can be recognized by the guide RNA contains 9 mismatches. In some embodiments, the coding region in the genome that can be recognized by the guide RNA contains 10 mismatches. In some embodiments, there is no off-target editing.

[0053] In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a cultured cell. In some embodiments, the cell is a primary cell. In some embodiments, the cell is a non-dividing cell. In some embodiments, the cell is an immune cell. In some embodiments, the cell is a B cell, a T cell, or an NK cell. In some embodiments, the cell is a B cell. In some embodiments, the cell is a T cell. In some embodiments, the cell is an NK cell. In some embodiments, the cell is a stem cell or a progenitor cell. In some embodiments, the cell is a stem cell. In some embodiments, the cell is a progenitor cell. In some embodiments, the cell is an induced pluripotent stem cell (iPSC).

[0054] In some embodiments, the target locus is an immune gene. In some embodiments, the target locus is a class I or class II HLA gene. In some embodiments, the target locus is a class I HLA gene. In some embodiments, the target locus is a class II HLA gene. In some embodiments, the target locus is B2M.

[0055] In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a reeditable template in the B2M exon 1 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to GAGTAGCGCGAGCACAGCTA (SEQ ID NO: 1), AGGGTAGGAGAGACTCACGC (SEQ ID NO: 2), or GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 3). In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a reeditable template in the B2M exon 1 locus is 70% identical to any one of SEQ ID NOs: 1-3. In some embodiments, the reeditable template in the cell is defined by a sequence that is 75% identical to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a reeditable template in the B2M exon 1 locus is 80% identical to any one of SEQ ID NOs: 1-3. In some embodiments, the reeditable template in the cell is defined by a sequence that is 85% identical to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a reeditable template in the B2M exon 1 locus is 90% identical to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a reeditable template in the B2M exon 1 locus is 95% identical to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a reeditable template in the B2M exon 1 locus is 99% identical to any one of SEQ ID NOs: 1-3. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a reeditable template in the B2M exon 1 locus is 100% identical to any one of SEQ ID NOs: 1-3.

[0056] In some embodiments, the re-editable template in the cell is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to ATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCCAGGTCCTAATGATTAGCTGTGCTCGCCCTGCTCTCTCTGTCTGGCCTGGAGGCTATTCAGCGTGAGTCTCTCCTACCCTCCCGCTCTGGTCCTTCCTCTCCCGCTCTGCACCCTCTGTGGCCCT (SEQ ID NO: 5). In some embodiments, the re-editable template in the cell is defined by a sequence having 70% identity to SEQ ID NO: 5. In some embodiments, the re-editable template in the cell is defined by a sequence having 75% identity to SEQ ID NO: 5. In some embodiments, the re-editable template in the cell is defined by a sequence having 80% identity to SEQ ID NO: 5. In some embodiments, the re-editable template in the cell is defined by a sequence having 85% identity to SEQ ID NO: 5. In some embodiments, the re-editable template in the cell is defined by a sequence having 90% identity to SEQ ID NO: 5. In some embodiments, the re-editable template in the cell is defined by a sequence having 95% identity to SEQ ID NO: 5. In some embodiments, the re-editable template in the cell is defined by a sequence having 99% identity to SEQ ID NO: 5. In some embodiments, the re-editable template in the cell is defined by a sequence having 100% identity to SEQ ID NO: 5.

[0057] In some embodiments, the re-editable template in the cell is codon-optimized. In some embodiments, the re-editable template in the cell is defined by a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% identity to AAAACGGGAAAGTCCCTCTCTCTAACCTGGCACTGCGTCGCTGGCTTGGAGACAGGTGACGGTCCCTGCGGGCCTTGTCCTGATTGGCTGGGCACGCGTTTAATATAAGTGGAGGCGTCGCGCTGGCGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCGTAGAGCGTGTGACTAGCTGTACTGGAGCTGTGAAGCTAATCCGGTCTGGAAGCCATTCAGCGTGAGTCTCTCCTACCCTCCCGCTCTGGTCCTTCCTCTCCCGCTCTGCACCCTCTGTGGCCCTCGCTGTGCTCTCTCGCTCCGTGACTTCCCTTCTCCAAGTTCTCCTTGGT (SEQ ID NO: 6). In some embodiments, the re-editable template in the cell is defined by a sequence having 70% identity to SEQ ID NO: 6. In some embodiments, the re-editable template in the cell is defined by a sequence having 75% identity to SEQ ID NO: 6. In some embodiments, the re-editable template in the cell is defined by a sequence having 80% identity to SEQ ID NO: 6. In some embodiments, the re-editable template in the cell is defined by a sequence having 85% identity to SEQ ID NO: 6. In some embodiments, the re-editable template in the cell is defined by a sequence having 90% identity to SEQ ID NO: 6. In some embodiments, the re-editable template in the cell is defined by a sequence having 95% identity to SEQ ID NO: 6. In some embodiments, the re-editable template in the cell is defined by a sequence having 99% identity to SEQ ID NO: 6. In some embodiments, the re-editable template in the cell is defined by a sequence having 100% identity to SEQ ID NO: 6.

[0058] In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 70%, 80%, 90%, 95%, 99%, or 100% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 70% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 80% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 90% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 95% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 100% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4).

[0059] In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in the B2M exon 2 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to AAGTCAACTTCAATGTCGGA (SEQ ID NO: 7), AGTCACATGGTTCACACGGC (SEQ ID NO: 8), or ACTTGTCTTTCAGCAAGGAC (SEQ ID NO: 9). In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in the B2M exon 2 locus is 70% identical to any one of SEQ ID NOs: 7-9. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in the B2M exon 2 locus is 75% identical to any one of SEQ ID NOs: 7-9. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in the B2M exon 2 locus is 80% identical to any one of SEQ ID NOs: 7-9. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in the B2M exon 2 locus is 85% identical to any one of SEQ ID NOs: 7-9. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in the B2M exon 2 locus is 90% identical to any one of SEQ ID NOs: 7-9. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in the B2M exon 2 locus is 95% identical to any one of SEQ ID NOs: 7-9. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in the B2M exon 2 locus is 99% identical to any one of SEQ ID NOs: 7-9. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in the B2M exon 2 locus is 100% identical to any one of SEQ ID NOs: 7-9.

[0060] In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in the B2M exon 2 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to CCTAGATCCAATAGTAGAGT (SEQ ID NO: 10) or GGTCACGTGGTTCACCCTAC (SEQ ID NO: 11). In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in the B2M exon 2 locus is 70% identical to SEQ ID NO: 10 or 11. In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in the B2M exon 2 locus is 75% identical to SEQ ID NO: 10 or 11. In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in the B2M exon 2 locus is 80% identical to SEQ ID NO: 10 or 11. In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in the B2M exon 2 locus is 85% identical to SEQ ID NO: 10 or 11. In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in the B2M exon 2 locus is 90% identical to SEQ ID NO: 10 or 11. In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in the B2M exon 2 locus is 95% identical to SEQ ID NO: 10 or 11. In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in the B2M exon 2 locus is 99% identical to SEQ ID NO: 10 or 11. In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in the B2M exon 2 locus is 100% identical to SEQ ID NO: 10 or 11.

[0061] In some embodiments, the re-editable template in the cell is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to AAATGTAAACACTTGGTGCCTGATATAGCTTGACACCAAGTTAGCCCCAAGTGAAATACCCTGGCAATATTAATGTGTCTTTTCCCGATATTCCTCAGGTACCCCCTAGATCCAATAGTAGAGTAGGTGACCAGCCTAGAACGGAGCCTGTAGGGTGAACCACGTGACCCTGTAACAGTGGGGTAAGTCTTACATTCTTTTGTAAGCTGCTGAAAGTTGTGTATGAGTAGTCATATCATAAAGCTGCTTTGATATAAAAAAGGTCTATGGCCATACTACCC (SEQ ID NO: 12). In some embodiments, the re-editable template in the cell is defined by a sequence having 70% identity to SEQ ID NO: 12. In some embodiments, the re-editable template in the cell is defined by a sequence having 75% identity to SEQ ID NO: 12. In some embodiments, the re-editable template in the cell is defined by a sequence having 80% identity to SEQ ID NO: 12. In some embodiments, the re-editable template in the cell is defined by a sequence having 85% identity to SEQ ID NO: 12. In some embodiments, the re-editable template in the cell is defined by a sequence having 90% identity to SEQ ID NO: 12. In some embodiments, the re-editable template in the cell is defined by a sequence having 95% identity to SEQ ID NO: 12. In some embodiments, the re-editable template in the cell is defined by a sequence having 99% identity to SEQ ID NO: 12. In some embodiments, the re-editable template in the cell is defined by a sequence having 100% identity to SEQ ID NO: 12.

[0062] In some embodiments, the target locus is CIITA.

[0063] In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in exon 2 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15). In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in exon 2 of the CIITA locus is 70% identical to any one of SEQ ID NOs: 13-15. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in exon 2 of the CIITA locus is 75% identical to any one of SEQ ID NOs: 13-15. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in exon 2 of the CIITA locus is 80% identical to any one of SEQ ID NOs: 13-15. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in exon 2 of the CIITA locus is 85% identical to any one of SEQ ID NOs: 13-15. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in exon 2 of the CIITA locus is 90% identical to any one of SEQ ID NOs: 13-15. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in exon 2 of the CIITA locus is 95% identical to any one of SEQ ID NOs: 13-15. In some embodiments, the gRNA that directs a double-strand break in the cell for insertion of a re-editable template in exon 2 of the CIITA locus is 100% identical to any one of SEQ ID NOs: 13-15.

[0064] In some embodiments, the re-editable template in the cell is defined by a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% identity to TTCTGCCTCTTTCCAACACCCTGTGAGGTGACTGAGCATTGTCTTCCCTCCCAGGCAGTTCCCAGTGTGCTACCATGGAGTTGTGACCCCTATAATGAGACCTGGCTGGAGAAGAAGAGATTGAGCTCTACTCAGGTGGGCCCTCCTCC (SEQ ID NO: 18). In some embodiments, the re-editable template in the cell is defined by a sequence having 70% identity to SEQ ID NO: 18. In some embodiments, the re-editable template in the cell is defined by a sequence having 75% identity to SEQ ID NO: 18. In some embodiments, the re-editable template in the cell is defined by a sequence having 80% identity to SEQ ID NO: 18. In some embodiments, the re-editable template in the cell is defined by a sequence having 85% identity to SEQ ID NO: 18. In some embodiments, the re-editable template in the cell is defined by a sequence having 90% identity to SEQ ID NO: 18. In some embodiments, the re-editable template in the cell is defined by a sequence having 95% identity to SEQ ID NO: 18. In some embodiments, the re-editable template in the cell is defined by a sequence having 99% identity to SEQ ID NO: 18. In some embodiments, the re-editable template in the cell is defined by a sequence having 100% identity to SEQ ID NO: 18.

[0065] In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 70% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 80% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 90% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 95% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 100% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17).

[0066] In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 70% identical to SEQ ID NO: 19. In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 75% identical to SEQ ID NO: 19. In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 80% identical to SEQ ID NO: 19. In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 85% identical to SEQ ID NO: 19. In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 90% identical to SEQ ID NO: 19. In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 95% identical to SEQ ID NO: 19. In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 99% identical to SEQ ID NO: 19. In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 100% identical to SEQ ID NO: 19.

[0067] In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to TGACTGATGTAAGACTAGTA (SEQ ID NO: 20). In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 70% identical to SEQ ID NO: 20. In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 75% identical to SEQ ID NO: 20. In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 80% identical to SEQ ID NO: 20. In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 85% identical to SEQ ID NO: 20. In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 90% identical to SEQ ID NO: 20. In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 95% identical to SEQ ID NO: 20. In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 99% identical to SEQ ID NO: 18. In some embodiments, the gRNA in the cell that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 100% identical to SEQ ID NO: 20.

[0068] In some embodiments, the re-editable template in the cell is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to AAATTTCCTTCTTCATCCAAGGGACTTTTCCTCCCAGAACCCGACACAGACACCATCAACTGCGACCAGTTCAGCTGACTGATGTAAGACTAGTAAGGTGATGAAGAGACCAGGGAGGCTTATGCCAATATCGGTGAGGAAGCACCTGAGCCCAGAAAAGGACAATCAAGGGCAAGAGTTCTTTGCTGCCACTTGTCA (SEQ ID NO: 21). In some embodiments, the re-editable template in the cell is defined by a sequence having 70% identity to SEQ ID NO: 21. In some embodiments, the re-editable template in the cell is defined by a sequence having 75% identity to SEQ ID NO: 21. In some embodiments, the re-editable template in the cell is defined by a sequence having 80% identity to SEQ ID NO: 21. In some embodiments, the re-editable template in the cell is defined by a sequence having 85% identity to SEQ ID NO: 21. In some embodiments, the re-editable template in the cell is defined by a sequence having 90% identity to SEQ ID NO: 21. In some embodiments, the re-editable template in the cell is defined by a sequence having 95% identity to SEQ ID NO: 21. In some embodiments, the re-editable template in the cell is defined by a sequence having 99% identity to SEQ ID NO: 21. In some embodiments, the re-editable template in the cell is defined by a sequence having 100% identity to SEQ ID NO: 21.

[0069] In some embodiments, the re-editable template in the cell comprises an exogenous protein-coding gene.

[0070] In some embodiments, the exogenous protein-coding gene is an immunomodulatory gene or a masking gene. In some embodiments, the exogenous protein-coding gene is an immunomodulatory gene. In some embodiments, the exogenous protein-coding gene is a masking gene.

[0071] In some embodiments, the exogenous gene in the cell expresses a protein that causes cell death.

[0072] In some embodiments, the re-editable template of the cell comprises a chimeric antigen receptor (CAR) gene.

[0073] In some embodiments, provided herein are methods of making an engineered cell, the method comprising contacting an engineered cell with a genome editing system, the genome editing system comprising a nucleic acid encoding a recombinant nuclease protein or a Cas protein and a guide RNA that specifically recognizes a PAM sequence comprised in a re-editable template, wherein the recombinant nuclease protein or the Cas protein is capable of binding the guide RNA and editing the locus.

[0074] In some embodiments, the nucleic acid encoding the Cas protein is fused to an adenine or cytosine deaminase, and wherein the Cas protein fusion is capable of binding the guide RNA and base editing the re-editable template.

[0075] In some aspects, provided herein are re-editable template sequences, wherein the template sequence has no substantial sequence similarity to any region in the genome, and wherein the template sequence is recognizable by a genome editing system.

[0076] As used in this application, the terms "about" and "approximately" are used as equivalents. Any numerical values used in this application, whether or not preceded by the term "about" or "approximately," are intended to cover any normal fluctuation of the art.

[0077] Other features, objects, and advantages of the application are apparent from the following detailed description. It should be understood, however, that the detailed description, while indicating embodiments of the application, is given by way of illustration only, not by way of limitation. Various changes and modifications within the scope of the application will become apparent to those skilled in the art from the detailed description. BRIEF DESCRIPTION OF DRAWINGS

[0078] The figures described below collectively comprise the drawings accompanying the specification and are for illustrative purposes only, not limiting purposes.

[0079] Figure 1 is a schematic diagram showing integration of a re-editable template into a WT locus by genome editing and homology directed recombination, thereby forming a re-editable target locus. The re-editable target locus comprises the integrated re-editable template and homology arms located on either side of the re-editable template.

[0080] DEFINITIONS

[0081] In order that the present application can be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the specification.

[0082] About or approximately:As used herein, the term "about" or "approximately," when applied to one or more values of interest, refers to a range of values that are similar to a stated reference value. In certain embodiments, unless otherwise stated or otherwise clear from context, the term "about" or "approximately" means within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the stated reference value in either direction (greater than or less than the stated reference value) of values, except that such number will exceed 100% of a possible value.

[0083] Base editing: As used herein, "base editing" is a CRISPR-Cas9 based genome editing technology that allows for the introduction of point mutations in DNA without generating DSBs. Two main classes of base editors include cytosine (or cytidine) base editors or CBEs that allow for C > T conversion or adenine (or adenosine) base editors or ABEs that allow for A > G conversion.

[0084] Biologically active: As used herein, the phrase "biologically active" refers to the characteristic of any agent that is active in a biological system, particularly in an organism. For example, an agent that has a biological effect on an organism when administered to that organism is considered to be biologically active. In particular embodiments, where a protein or polypeptide is biologically active, portions of that protein or polypeptide that share at least one biological activity of that protein or polypeptide are often referred to as "biologically active" portions.

[0085] Homology arms: As used herein, "homology arms" refers to flanking sequences, on either side of a reeditable template. The reeditable template is introduced into a wild-type target locus by homologous recombination between the wild-type locus and the donor template, thereby integrating the intervening reeditable template flanked by two homology arms. In some embodiments, each homology arm is between 50-500 nt. The size of the two homology arms can be the same or different relative to each other.

[0086] Homology directed repair (HDR):Homology directed repair (HDR) is one of the mechanisms to repair DNA double-strand breaks generated by CRISPR-endonuclease based genome editing. HDR requires an HDR donor template, which contains sequences homologous to the specific sequences flanking the cleavage site, defined as "homology arms". HDR allows the introduction of exogenous DNA template to obtain DNA editing within the genome. In brief, HDR repair is carried out by the following steps: (a) excision of the 5' end of the DNA strand, i.e. digestion of nucleotides from the 5' end at the cleavage site to generate a 3' overhang; (b) the 3' overhang serves as a substrate for repair proteins such as Rad51 protein, which stimulates strand invasion of the donor repair template for base insertion or gene replacement; (c) the invading strand displaces one strand of the homologous DNA duplex and pairs with the other strand, forming a hybrid DNA structure called a displacement loop (D-loop); (d) the recombination intermediate is then resolved to repair the DNA. The conservative HDR method is precise and accurate, and proceeds through the classical double-strand break repair, synthesis-dependent strand annealing, or break-induced repair pathways.

[0087] Non-homologous end joining (NHEJ): Non-homologous end joining (NHEJ) is a mechanism to repair DNA double-strand breaks generated by CRISPR-endonuclease based genome editing. In NHEJ, the ends generated at the break site are directly ligated without the need for a homologous template. NHEJ occurs in non-dividing and proliferating cells, and is directed by short homologous DNA segments or microhomologies, typically corresponding to overhangs. NHEJ is generally more error-prone than HDR. The general mechanism of NHEJ occurs as follows: (a) recognition and assembly of DNA ends at the DNA double-strand break by NHEJ complex containing Ku70 / Ku80 heterodimer and stabilization, which recruits other factors to the break site, such as DNA-PKcs, XRCC4, DNA ligase IV, XRCC4-like factor (XLF), aprataxin, and PNK-like factor (APLF); (b) bridging of DNA ends and promotion of end stability; (c) DNA end processing by enzymes such as Artemis, PNKP, APLF, polymerase mu and lambda, Werner (WRN), aprataxin, and K; and (d) ligation of break ends by DNA ligase IV and dissolution of NHEJ complex.

[0088] On-target editing or on-target editing efficiency:On-target editing involves specific and efficient genetic editing at the desired target locus while minimizing or preventing unintended or non-specific modification of the genome at sites other than the target locus. “On-target editing” or “on-target editing efficiency” refers to the percentage of cells edited at the on-target locus relative to the total number of cells. The percentage of on-target editing is a measure of the efficiency of gene editing. For example, 50% on-target editing means that 50% of the cells are edited at the on-target locus. In the case of CRISPR-Cas editing systems, on-target editing is determined by designing gRNAs that provide high on-target activity while having minimal off-target effects.

[0089] Off-target editing: Off-target editing refers to non-specific and unintended genetic modifications resulting from genome editing methods. If the repair complex after dsDNA cleavage binds to sequences other than the target sequence due to homology or mismatch tolerance, off-target sequences are cleaved, resulting in non-specific genetic modifications, including point mutations, deletions, insertions, inversions, and / or translocations. Due to base mismatch tolerance in linear sequences or bulge mismatches, i.e., off-target sites with a few missing bases or small deletions (RNA bulges) and off-target sites with extra bases or small insertions (DNA bulges) recognized by gRNAs, result in partial but sufficient matches to the target sequence, resulting in off-target binding. In some embodiments, the standard for specifying inhibition of off-target editing requires at least 3 mismatches in a coding gene in the genome relative to the template sequence that can be recognized by a particular guide RNA.

[0090] Pilot editing: As used herein, the term “prime editing” refers to a universal and precise method of genome editing that uses a catalytically impaired Cas endonuclease fused to an engineered reverse transcriptase to directly write new genetic information into a specified DNA site, programmed with a prime editing guide RNA (pegRNA) that both specifies the target site and encodes the desired edit. Prime editing is used to insert sequences of about 30-40 nt in length. Prime editing edits sequences without generating a double-strand break. It offers advantages in efficiency and product purity over HDR, complementary and inferior advantages compared to base editing, and lower off-target editing than Cas nucleases at known Cas off-target sites.

[0091] RNA guide or guide RNA (gRNA): Refers to an RNA molecule that facilitates the targeting of a Cas protein to a target locus. gRNAs are guide RNAs that comprise a guide sequence (crRNA) and a Cas9 nuclease recruiting sequence (tracrRNA). As used herein, “sgRNA” and “gRNA” are used interchangeably.

[0092] Re-editable templateAs used in this article, the term "editable template" refers to a sequence that has no substantial sequence homology with any coding region of the genome and can be recognized by a genome editing system.

[0093] Re-editable locus or Re-editable target or Re-editable gene or Re-editable site As used herein, the terms “re-editable locus,” “re-editable target,” “re-editable gene,” and “re-editable site” are used interchangeably to refer to a locus, target, gene, or site in the genome in which a re-editable template with two homologous arms is integrated via homology-driven recombination and can be recognized by a genome editing system for subsequent modification.

[0094] Substantial sequence similarity As used herein, the term "substantial sequence similarity" is used interchangeably with "sequence homology" and "sequence identity," and refers to at least 70%, 75%, 80%, 85%, 90%, 95%, or higher identity with a region in the genome. In some implementations, substantial sequence similarity refers to 100% sequence identity. Detailed Implementation

[0095] This invention provides a "re-editing technique," a flexible genome editing technique that is precise and specific to target loci, and also prepares edited loci for further manipulation by another precise genome editing system to achieve multiple phenotypes or reengineer cells with specific phenotypes for therapeutic purposes in a short time. The "re-editing technique" of this invention includes methods for engineering re-editable target loci and cells having re-editable templates. In particular, this invention provides a method for engineering re-editable target loci in cells, comprising inserting an exogenous re-editable template sequence into the target locus; and a method for engineering re-editable cells containing a re-editable template sequence flanked by two homologous arms, such that the re-editable template sequence is inserted into the target locus via homologous recombination; and a method of using such a method. In some aspects, this invention provides re-editable template sequences wherein the template sequence has no substantial sequence similarity to any region of the genome, and wherein the template sequence is recognizable by a genome editing system. Various aspects of the invention will be described in more detail below.

[0096] Engineering a re-editable target locus by re-editing technology

[0097] The present application provides, among other things, methods of engineering a re- editable target locus in a cell, the methods comprising inserting an exogenous re- editable template sequence into the target locus, wherein the template sequence has no substantial sequence similarity to any coding region in the genome, and wherein the template sequence is recognizable by a genome editing system. In some embodiments, the template sequence is recognizable by an integrase (e.g., a bacteriophage-derived integrase, such as phiC31, Bxbl). As used herein, "exogenous" refers to a sequence that is not normally expressed at a given locus.

[0098] Re-editable template

[0099] The re-editable template sequences of the present application are designed such that they have no substantial sequence similarity to any coding region in the genome. In some embodiments, the re-editable template has less than about 70%, 75%, 80%, 85%, 90%, 95%, or 100% identity to any coding region in the genome. In some embodiments, the re-editable template has about 70-75% identity to any coding region in the genome. In some embodiments, the re-editable template has about 75-80% identity to any coding region in the genome. In some embodiments, the re-editable template has about 80-85% identity to any coding region in the genome. In some embodiments, the re-editable template has about 85-90% identity to any coding region in the genome. In some embodiments, the re-editable template has about 90-95% identity to any coding region in the genome. In some embodiments, the re-editable template has about 95-100% identity to any coding region in the genome. In some embodiments, the re-editable template has less than 70% identity to any coding region in the genome. In some embodiments, the re-editable template has less than 75% identity to any coding region in the genome. In some embodiments, the re-editable template has less than 80% identity to any coding region in the genome. In some embodiments, the re-editable template has less than 85% identity to any coding region in the genome. In some embodiments, the re-editable template has less than 90% identity to any coding region in the genome. In some embodiments, the re-editable template has less than 95% identity to any coding region in the genome. In some embodiments, the re-editable template has less than 100% identity to any coding region in the genome.

[0100] Accordingly, off-target editing is minimized or eliminated by the re-editable templates of the present application. Off-target editing is a major limitation of genome editing technologies that needs to be suppressed to provide safe and widespread use of gene therapy in various therapeutic applications. In brief, off-target editing results in double-stranded DNA breaks at sequences other than the intended target site, resulting in unwanted mutations and gene disruption, leading to toxicity or lethality. However, off-target editing can also occur at the target site, for example, a single base pair substitution in the protospacer sequence at the target site can cause the Cas enzyme to re-cut at the same target site, thereby removing the desired genomic modification through the template repair pathway. Typically, additional target site disruption mutations are introduced in the repair template to prevent re-cutting, but these can affect regulatory motifs or result in non-synonymous mutations.

[0101] Off-target cleavage in the CRISPR-Cas system results from recognition of complementary genomic sites by the gRNA, and some approaches to minimize this include Cas9 variants that are less specific for off-targets, such as HF-Cas9, eCas9, and HypaCas9. In some embodiments of the present application, the Cas9 is a variant Cas9 or Cas9 homolog.

[0102] The present application provides re-editable templates that prevent undesired re-cutting by the same genome editing tool used to insert the re-editable template, but rather the template is prepared for subsequent specific modification by another genome editing tool. In some embodiments, the genome editing tool is a TALEN, zinc finger nuclease, meganuclease, CRISPR-Cas, or related nuclease directed by a nucleic acid (e.g., RNA) or protein. In some embodiments, the genome editing tool is a sequence-specific recombinase or integrase, such as phiC31 with its cognate attP or attB recognition sequences. In some embodiments, the target is a pseudo attP or attB site in the genome that can be recognized by the recombinase or integrase. The re-editable templates of the present application allow subsequent targeted modification of the cell by a genome editing nuclease that is different from the genome editing nuclease used to insert the re-editable template, thereby facilitating rapid development of multiple different types of mutations in a platform cell for use in treating multiple different indications.

[0103] The designed re-editable template sequence determines the suitability of the genome editing system for subsequent editing. For example, in some embodiments, where a sequence is inserted 5' to an existing PAM site, a new cleavage site is created near the previously existing PAM site, such that the template sequence is re-editable because the PAM site is specified in the homology arm. In some embodiments, if the re-editable template does not have a 5'-NGG-3' PAM, it cannot be subsequently modified by a Cas9 nuclease, but it can be recognized and edited by, for example, a TALEN or another Cas protein. Thus, in various embodiments, the re-editable template is designed to prevent re-cutting and off-target effects, while allowing for subsequent precise genome modification.

[0104] In some embodiments, any coding region in the genome contains at least 3 mismatches relative to the template sequence recognizable by the guide RNA. In some embodiments, any coding region in the genome contains at least 1 mismatch relative to the template sequence recognizable by the guide RNA. In some embodiments, any coding region in the genome contains at least 2 mismatches relative to the template sequence recognizable by the guide RNA. In some embodiments, any coding region in the genome contains at least 4 mismatches relative to the template sequence recognizable by the guide RNA. In some embodiments, any coding region in the genome contains at least 5 mismatches relative to the template sequence recognizable by the guide RNA. In some embodiments, any coding region in the genome contains at least 6 mismatches relative to the template sequence recognizable by the guide RNA. In some embodiments, any coding region in the genome contains at least 7 mismatches relative to the template sequence recognizable by the guide RNA. In some embodiments, any coding region in the genome contains at least 8 mismatches relative to the template sequence recognizable by the guide RNA. In some embodiments, any coding region in the genome contains at least 9 mismatches relative to the template sequence recognizable by the guide RNA. In some embodiments, any coding region in the genome contains less than 10 mismatches relative to the template sequence recognizable by the guide RNA. It is clear that the template sequence can be recognized by the guide RNA when a nuclease with mismatch tolerance is subsequently recruited and cleavage occurs.

[0105] The re-editable template of the present application is less than about 500 nt. In some embodiments, the re-editable template is between about 10-500 nt. In some embodiments, the re-editable template is between about 10-100 nt. In some embodiments, the re-editable template is between about 10-20 nt. In some embodiments, the re-editable template is between about 20-30 nt. In some embodiments, the re-editable template is between about 30-40 nt. In some embodiments, the re-editable template is between about 40-50 nt. In some embodiments, the re-editable template is between about 50-60 nt. In some embodiments, the re-editable template is between about 60-70 nt. In some embodiments, the re-editable template is between about 70-80 nt. In some embodiments, the re-editable template is between about 80-90 nt. In some embodiments, the re-editable template is between about 90-100 nt. In some embodiments, the re-editable template is between about 100-200 nt. In some embodiments, the re-editable template is between about 200-300 nt. In some embodiments, the re-editable template is between about 300-400 nt. In some embodiments, the re-editable template is between about 400-500 nt.

[0106] In some embodiments, the entire exon is replaced by the re-editable template. In some embodiments, one or more exons are replaced by the re-editable template, e.g., by a different PAM. In some embodiments, the re-editable template is inserted into a non-coding region.

[0107] In some embodiments, wherein the genome editing system is a CRISPR-Cas system, the Cas protein is a Type II Cas enzyme. In some embodiments, the Cas protein is Cas9, Casl2a, or Casl2b. Type II nucleases include: Cas9, a dual-RNA guided nuclease that requires both CRISPR RNA (crRNA) and tracrRNA and contains both HNH and RuvC nuclease domains; Casl2a, a single-RNA guided nuclease that requires only crRNA and contains a single RuvC domain; and Casl2b, a dual-RNA guided nuclease that contains a single RuvC domain and requires both crRNA and tracrRNA.

[0108] In some embodiments, the Cas protein is an enzymatically inactive Cas protein or a cleavage enzyme. In some embodiments, the Cas protein is Cas9 D10A or Cas9 H840A. In some embodiments, the Cas nuclease, TALEN, or ZFN is fused with a FokI nuclease or an associated nuclease domain. Fusion of inactive Cas9 with FokI nuclease (fCas9) improves DNA cleavage specificity. DNA cleavage by fCas9 requires the association of two fCas9 monomers that simultaneously bind to target sites 15 or 25 base pairs apart. In human cells, fCas9 is more than 140-fold more efficient at modifying target DNA sites than wild-type Cas9. (Guilinger, Thompson, and Liu, 2014, Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification, Nature Biotechnology (32, pp. 577-582). In some embodiments, inactive Cas9 is fused with M-MLV reverse transcriptase. In some embodiments, Cas9 H840A is fused with M-MLV reverse transcriptase for lead editing.

[0109] In various embodiments of the invention, the genome editing system is a CRISPR-Cas system, and the editable template contains a pre-spacer adjacent motif (PAM). The PAM is typically a DNA sequence of 2-6 nt in length adjacent to a CRISPR locus, which is targeted and cleaved by a Cas-associated nuclease in the CRISPR-Cas genome editing system. The Cas enzyme is guided to bind to the DNA sequence adjacent to the PAM sequence, thereby performing DNA cleavage at a precise site. In some embodiments, the editable template contains a 5′-NGG-3′ PAM sequence, where N is any nucleotide followed by two guanine nucleotides, which is derived from *Streptococcus pyogenes* (…). Streptococcus pyogenes The Cas9 enzyme (SpCas9) recognizes the gene. In some embodiments, the editable template contains 5′-NGG-3′ PAM, and the nuclease is Cas9. Furthermore, Cas9 mutants of Streptococcus pyogenes with altered specificity or recognition of novel PAM sequences have been identified. SaCas9 (from Staphylococcus aureus) Staphylococcus aureus) specifically recognizes short PAM sequences 5'-NGRR(N)-3'. Other Cas nucleases, including Cas9 from other species, recognize longer PAMs or have higher specificity to minimize off-target cleavage. Thus, the appropriate Cas nuclease and corresponding PAM are selected for the reeditable template design. In various embodiments, the reeditable templates of the present application comprise different PAMs associated with Cas9 from different species. For example, N. meningitidis (NmeCas9) specifically recognizes NNNNGATT, C. jejuni (CjCas9) specifically recognizes NNNNRYAC, S. thermophilus (StCas9) recognizes NNAGAAW, Lachnospiraceae bacterium (LbCpf1, Cas12a) recognizes TTTV, Acidaminococcus sp. (AsCpf1, Cas12a) recognizes TTTV, Alicyclobacillus acidophilus (AacCas12b) recognizes TTN, Bovillus vullius (BvCas12b) recognizes ATTN, TTTN, GTTN, and uncultured archea (Cas14) recognizes T-rich PAM sequences, such as TTTA. Neisseria meningitides , NmeCas9) specifically recognizes NNNNGATT, C. jejuni (CjCas9) specifically recognizes NNNNRYAC, S. thermophilus (StCas9) recognizes NNAGAAW, Lachnospiraceae bacterium (LbCpf1, Cas12a) recognizes TTTV, Acidaminococcus sp. (AsCpf1, Cas12a) recognizes TTTV, Alicyclobacillus acidophilus (AacCas12b) recognizes TTN, Bovillus vullius (BvCas12b) recognizes ATTN, TTTN, GTTN, and uncultured archea (Cas14) recognizes T-rich PAM sequences, such as TTTA. Campylobacter jejuni Streptococcus thermophilus , NmeCas9) specifically recognizes NNNNGATT, C. jejuni (CjCas9) specifically recognizes NNNNRYAC, S. thermophilus (StCas9) recognizes NNAGAAW, Lachnospiraceae bacterium (LbCpf1, Cas12a) recognizes TTTV, Acidaminococcus sp. (AsCpf1, Cas12a) recognizes TTTV, Alicyclobacillus acidophilus (AacCas12b) recognizes TTN, Bovillus vullius (BvCas12b) recognizes ATTN, TTTN, GTTN, and uncultured archea (Cas14) recognizes T-rich PAM sequences, such as TTTA. Lachnospiraceae Acidaminococcus , NmeCas9) specifically recognizes NNNNGATT, C. jejuni (CjCas9) specifically recognizes NNNNRYAC, S. thermophilus (StCas9) recognizes NNAGAAW, Lachnospiraceae bacterium (LbCpf1, Cas12a) recognizes TTTV, Acidaminococcus sp. (AsCpf1, Cas12a) recognizes TTTV, Alicyclobacillus acidophilus (AacCas12b) recognizes TTN, Bovillus vullius (BvCas12b) recognizes ATTN, TTTN, GTTN, and uncultured archea (Cas14) recognizes T-rich PAM sequences, such as TTTA. Alicyclobacillus acidiphilus Bacillus , NmeCas9) specifically recognizes NNNNGATT, C. jejuni (CjCas9) specifically recognizes NNNNRYAC, S. thermophilus (StCas9) recognizes NNAGAAW, Lachnospiraceae bacterium (LbCpf1, Cas12a) recognizes TTTV, Acidaminococcus sp. (AsCpf1, Cas12a) recognizes TTTV, Alicyclobacillus acidophilus (AacCas12b) recognizes TTN, Bovillus vullius (BvCas12b) recognizes ATTN, TTTN, GTTN, and uncultured archea (Cas14) recognizes T-rich PAM sequences, such as TTTA. hisashii

[0110] Some PAM sequences are engineered to expand the library of Cas9 targets, for example, F. novicida Cas9 recognizes the canonical 5'-NGG-3' PAM, but is engineered to recognize 5'-YG-3', where Y is any pyrimidine. In addition to CRISPR-Cas9, F. novicida CRISPR-Cpf1 recognizes PAM 5'-TTTN-3' or 5'-YTN-3'. CRISPR-Cas13a (C2c2) is an RNA-guided CRISPR system that does not rely on PAM recognition sequences, but instead requires a protospacer flanking site (PFS), which is typically a nucleotide other than guanine, known to reduce efficacy. Francisella novicida

[0111] Thus, in some embodiments, the reeditable templates of the present application have no substantial sequence similarity to any coding region of the genome, have specificity recognized by a different desired genome editing system than the genome editing system used to insert them into the target locus, and have various lengths, for example, 10-500 nt, comprising an exogenous sequence of interest that is not normally expressed at the locus. In some embodiments, the exogenous sequence is a non-coding sequence. ​​​​

[0112] In some embodiments, the re-editable template is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to ATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCCAGGTCCTAATGATTAGCTGTGCTCGCCCTGCTCTCTCTGTCTGGCCTGGAGGCTATTCAGCGTGAGTCTCTCCTACCCTCCCGCTCTGGTCCTTCCTCTCCCGCTCTGCACCCTCTGTGGCCCT (SEQ ID NO: 5), or

[0113] AAAACGGGAAAGTCCCTCTCTCTAACCTGGCACTGCGTCGCTGGCTTGGAGACAGGTGACGGTCCCTGCGGGCCTTGTCCTGATTGGCTGGGCACGCGTTTAATATAAGTGGAGGCGTCGCGCTGGCGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCGTAGAGCGTGTGACTAGCTGTACTGGAGCTGTGAAGCTAATCCGGTCTGGAAGCCATTCAGCGTGAGTCTCTCCTACCCTCCCGCTCTGGTCCTTCCTCTCCCGCTCTGCACCCTCTGTGGCCCTCGCTGTGCTCTCTCGCTCCGTGACTTCCCTTCTCCAAGTTCTCCTTGGT (SEQ ID NO: 6).

[0114] In some embodiments, the re-editable template is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to AAATGTAAACACTTGGTGCCTGATATAGCTTGACACCAAGTTAGCCCCAAGTGAAATACCCTGGCAATATTAATGTGTCTTTTCCCGATATTCCTCAGGTACCCCCTAGATCCAATAGTAGAGTAGGTGACCAGCCTAGAACGGAGCCTGTAGGGTGAACCACGTGACCCTGTAACAGTGGGGTAAGTCTTACATTCTTTTGTAAGCTGCTGAAAGTTGTGTATGAGTAGTCATATCATAAAGCTGCTTTGATATAAAAAAGGTCTATGGCCATACTACCC (SEQ ID NO: 12).

[0115] In some embodiments, the re-editable template is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to TTCTGCCTCTTTCCAACACCCTGTGAGGTGACTGAGCATTGTCTTCCCTCCCAGGCAGTTCCCAGTGTGCTACCATGGAGTTGTGACCCCTATAATGAGACCTGGCTGGAGAAGAAGAGATTGAGCTCTACTCAGGTGGGCCCTCCTCC (SEQ ID NO: 18).

[0116] In some embodiments, the re-editable template is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to AAATTTCCTTCTTCATCCAAGGGACTTTTCCTCCCAGAACCCGACACAGACACCATCAACTGCGACCAGTTCAGCTGACTGATGTAAGACTAGTAAGGTGATGAAGAGACCAGGGAGGCTTATGCCAATATCGGTGAGGAAGCACCTGAGCCCAGAAAAGGACAATCAAGGGCAAGAGTTCTTTGCTGCCACTTGTCA (SEQ ID NO: 21).

[0117] Generating a re-editable target locus by introducing a re-editable template

[0118] The present disclosure provides a method of engineering a re-editable target locus in a cell, the method comprising inserting an exogenous re-editable template sequence into the target locus, wherein the template sequence has no substantial sequence similarity to any region in the genome, and wherein the template sequence is recognizable by a genome editing system.

[0119] Exogenous re-editable template refers to a sequence other than the sequence that is endogenous to the locus, i.e., the sequence that is normally present at the target locus in the genome. In some embodiments, the exogenous re-editable template comprises a wild-type sequence that is expressed at another locus, or in the genome of another species, or in another cell of the same or different species. In some embodiments, the exogenous re-editable template further comprises a modified or engineered recombinant sequence. In some embodiments, the exogenous re-editable template comprises a gene that encodes a protein.

[0120] In some embodiments, the re-editable template sequence is flanked by two homology arms, such that the re-editable template sequence is inserted into the target locus by homologous recombination.

[0121] Homologous recombination is a type of genetic recombination in which nucleotide sequences are exchanged between two similar or identical DNA molecules, i.e., flanking homology arms. In brief, homologous recombination is initiated by a double-strand break, which is repaired by the cell. For example, genome editing induces a DNA break at one or more sites, such as a double-strand break (DSB) at a target locus in a genome (or a target genomic region). DNA cleavage results in the repair of the break by the cell enzymes through an error-prone non-homologous end joining pathway (NHEJ) or an error-free homology directed repair (HDR) pathway.

[0122] In NHEJ, DNA damage is repaired by fusing the two ends of a DNA break in a series of enzymatic processes involving Ku70 / 80 heterodimer and DNA-dependent protein kinase (DNA-PKc) enzymes. The repair mechanism involves tethering and alignment of the two DNA ends, excision, extension, and ligation, resulting in the formation of small insertion or deletion mutations (indels) at the break site. Indels introduced into a gene coding sequence can cause a premature stop codon or a frameshift mutation, resulting in the production of a non-functional truncated protein. Indels generated using NHEJ to knock out gene expression can create two unique alleles in a gene.

[0123] Homology directed repair (HDR) is another mechanism by which cells repair double-stranded DNA breaks. HDR requires an HDR donor template, which contains sequences homologous to specific sequences flanking the cleavage site, defined as “homology arms”. The HDR pathway involves repair proteins such as Rad51, which stimulate strand invasion of the donor repair template for base insertion or gene replacement. HDR allows the introduction of exogenous DNA templates for DNA editing within the genome.

[0124] The optimal length of homology arms has been reported to be as small as 30 nt on either side of the DSB, and it has been demonstrated that asymmetric donor oligonucleotides can improve HDR. HDR efficiency is highest when the edit is expected to be placed near the DSB, and greatly reduced at loci far from the event. Furthermore, reports suggest that it is preferable to utilize donor oligonucleotides with complementary or non-complementary sequences to the gRNA.

[0125] Because CRISPR-Cas re-cutting of dsDNA reduces HDR efficiency, a block mutation is incorporated. Thus, HDR with a homozygous frameshift mutation (e.g., an indel that results in a premature stop codon) and a silent block mutation produces two identical alleles. HDR occurs at very low frequency during the S and G2 phases of DNA replication. The most common form of HDR is homologous recombination. Cells can use the HDR mechanism when a homologous piece of DNA is present in the nucleus, primarily in the G2 and S phases of the cell cycle. Other examples of homology directed repair include single strand annealing and break-induced replication.

[0126] The intervening reeditable template sequence herein integrates into the genome via homologous recombination, thereby creating a reeditable target locus comprising the reeditable template and flanking homology arms. The two homology arms can be the same or different in size relative to one another.

[0127] In some embodiments, the homology arm is between about 50 nt to 500 nt. In some embodiments, the homology arm is 30 nt. In some embodiments, the homology arm is about 50 nt. In some embodiments, the homology arm is about 100 nt in length. In some embodiments, the homology arm is about 150 nt in length. In some embodiments, the homology arm is about 200 nt in length. In some embodiments, the homology arm is about 250 nt in length. In some embodiments, the homology arm is about 300 nt in length. In some embodiments, the homology arm is about 350 nt in length. In some embodiments, the homology arm is about 400 nt in length. In some embodiments, the homology arm is about 450 nt in length. In some embodiments, the homology arm is about 500 nt in length.

[0128] In some embodiments, the subsequent modification uses a gRNA-guided Cas nuclease to create a double-strand break and integrate an exogenous protein-coding gene into the target locus.

[0129] Target locus

[0130] The target locus of the present invention is any genomic locus into which a reeditable template is inserted to allow for subsequent modification of the genome at the desired locus. For example, the target gene locus or target locus is a locus in which the function of a gene is knocked out and subsequently genome edited to integrate an exogenous gene. In some embodiments, the target locus is a locus in which the function of a gene is not disrupted or knocked out.

[0131] In some embodiments, the target locus is at least one locus selected from the group consisting of a pan-expressed gene, a cell division-associated gene, and a gene expressed limited to a specific cell type. In some embodiments, the target locus is a pan-expressed gene, such as an HLA class I gene, such as a B2M gene. HLA class I molecules are expressed on the surface of nearly all nucleated cells. In some embodiments, the target locus is a cell division-associated gene, such as a cell cycle checkpoint gene. In some embodiments, the target locus is a gene expressed limited to a specific cell type, such as an HLA class II gene. HLA class II molecules are expressed only on B-lymphocytes, antigen-presenting cells (monocytes, macrophages, and dendritic cells), and activated T-lymphocytes.

[0132] Loci involved in rejection of transplanted foreign cells are known as the major histocompatibility complex (MHC). The MHC encodes highly polymorphic cell surface molecules. The human MHC is also known as the HLA (human leukocyte antigen) system, as these antigens were first identified and characterized using alloantibodies against leukocytes. Molecular HLA allelotyping is routinely performed to match HLA class I and II alleles in allogeneic stem cell transplantation to avoid graft rejection. HLA molecules play a role in the immune regulation and detection of self versus non-self antigens. In some embodiments, the target locus is a class I or class II HLA gene. In some embodiments, the target locus is B2M. In some embodiments, the target locus is CIITA.

[0133] In some embodiments, the target locus is a safe harbor locus, which is a location in the genome that allows expression of a foreign gene without risk of affecting neighboring endogenous genes, such as ROSA26, AAVS1, CLYBL, H11, COL1A1, CCR5, collagen, HTRP, GAPDH, ACTB, ACTG1, TCR, RUNX1, POLR2a. In some embodiments, the target locus is a locus required for gene disruption, such as TAP1, TAP2, or tapasin, beta-2 microglobulin (B2M), NLRC5, PD1, LAG3, TIM3, RFXANK, CIITA, RFX5, RFXAP, and the like.

[0134] In some embodiments, the target locus is an attachment site for a recombinase or integrase in the genome, such as an attP or attB site in the genome. In some embodiments, the integrase is a bacteriophage-derived integrase. In some embodiments, the target locus is a pseudo attP or attB site in the genome. In some embodiments, the target is a minimal attP or attB sequence.

[0135] In some embodiments, the integrase is BxB1. In some embodiments, the BxB1 attP site is GTCGTGGTTTGTCTGGTCAACCACCgcggtctcAGTGGTGTACGGTACAAACCCCGA (SEQ ID NO: 26). In some embodiments, the BxB1 attB site is TCGGCCGGCTTGTCGACGACGgcggtctcCGTCGTCAGGATCATCCGGGC (SEQ ID NO: 27).

[0136] In some embodiments, the integrase is phiC31. In some embodiments, the phiC31 attP site is GTGCCCCAACTGGGGTAACCTttGAGTTCTCTCAGTTGGGGG (SEQ ID NO: 28). In some embodiments, the phiC31 attB site is TGCGGGTGCCAGGGCGTGCCCttGGGCTCCCCGGGCGCGTACTCC (SEQ ID NO: 29).

[0137] Bold and lower case are core nucleotides essential for synapse formation during recombination between attP and attB sequences (by homologous integrase), while flanking sequences promote recognition / binding by integrase.

[0138] Foreign gene

[0139] A foreign gene is a gene that is not normally present at or expressed from the locus. In some embodiments, a foreign gene is a protein-encoding gene. In some embodiments, a foreign gene is a non-coding gene. Foreign genes include any gene that expresses a protein that is otherwise expressed at other loci or other cells, and includes wild-type sequences. For example, foreign genes include PD-L1, FASL, CD47, CD24, B2M, HLA-E, HLA-G, CD200, CCL21, MFGE8, H2-M3, SPI6, and the like.

[0140] In some embodiments, the exogenous gene encodes a safety switch and expresses a protein that causes cell death, wherein the gene is selected from the group consisting of: Herpes Simplex Virus Thymidine Kinase (HSV-tk), iCaspase8, iCaspase9, iCaspase3, iCaspase7, cytosine deaminase, modified EGFR, B-cell CD20, and the like. In some embodiments, the safety switch is linked to endogenous gene expression (e.g., via a cleavable 2A linker or IRES). In some embodiments, the safety switch is linked to endogenous gene expression via a cleavable 2A linker. In some embodiments, the safety switch is linked to endogenous gene expression via an internal ribosome entry site (IRES) element. In some embodiments, the safety switch is driven by a synthetic promoter (e.g., EF1A, CAG). In some embodiments, the safety switch is driven by an EF1A promoter. In some embodiments, the safety switch is driven by a CAG promoter.

[0141] Stimulating suicide genes are important for killing cancer cells, unwanted cells or other proliferating cells in tissues and organs, and for making cells more sensitive to chemotherapy. Most suicide genes mediate this process by encoding viral or bacterial enzymes that convert an inactive drug into a toxic antimetabolite that inhibits nucleic acid synthesis. In some embodiments, the exogenous gene expresses a suicide gene that is activated by an inducing molecule and triggers cell death of the hypoimmunogenic iPSC or cells derived therefrom. For example, Herpes Simplex Virus (HSV)-tk is triggered by ganciclovir. The E. coli cytosine deaminase gene (EC-CD) is triggered by 5-fluorocytosine (5-FC). Suicide genes must be introduced in very specific cells and at targeted loci, such that they do not have off-target effects. In some embodiments of the application, providing suicide genes in the reeditable template provides a means of controlling expression at precise loci in cells and at desired times.

[0142] In some embodiments, the protein-encoding gene is a masking gene that protects the cell from being recognized by NK cells, thereby producing hypoimmunogenic cells (e.g., iPSCs (e.g., undifferentiated iPSCs, and in some embodiments, including progenitor and / or differentiated cells), stem cells, progenitor cells, immune cells (including T cells and NK cells), or any other differentiated cell). In some embodiments, the protein-encoding gene triggers cell termination in the presence of an inducing molecule. In some embodiments, the protein-encoding gene expresses one or more proteins that increase the efficacy of a chimeric antigen receptor (CAR) product.

[0143] The exogenous gene can include a gene encoding a transcription factor, a receptor, a signaling molecule, a pharmaceutically active peptide, or a gene encoding a protein that promotes various cellular functions including, but not limited to, trafficking, homing, engraftment, self-renewal, persistence, viability, and / or survival of iPSCs or iPSC-derived cells used in tissue engineering.

[0144] In some embodiments, the exogenous gene encodes an RNA product, including but not limited to siRNA, shRNA, microRNA, antisense nucleic acid, circRNA, and IncRNA. In some embodiments, the re-editable template includes one or more constitutive promoters, inducible promoters, time-specific promoters, and / or tissue or cell type-specific promoters to drive expression of the exogenous gene.

[0145] Genome editing system

[0146] Double-strand breaks greatly increase the efficiency of homology-dependent repair in mammalian cells, and RNA- or protein-directed targeted nucleases are used in genome editing systems to create modifications at precise target sites. Genome editing systems include protein-directed systems, such as zinc finger nucleases or TALENs, and RNA-directed systems, such as

[0147] Zinc finger nuclease (ZFN)

[0148] In some embodiments of the present application, the re-editable template is designed to be recognized by a zinc finger nuclease (ZFN) system. ZFNs comprise a site-specific DNA binding domain and a non-sequence-specific cleavage domain. The zinc finger domain comprises a modular array of Cys2His2 zinc fingers, each zinc finger being about 30 amino acids and recognizing three base pairs of DNA. Target recognition is determined by the amino acid sequence of each zinc finger, the number of zinc fingers in the array, and the interaction with the Fokl endonuclease domain. Two ZFN molecules bind the target site in the appropriate orientation, requiring recognition of 6 sites to be cleaved by the zinc nuclease DNA containing a fusion of Fokl and zinc fingers, creating a double-strand break at the specific locus, leading to subsequent endogenous NHEJ or HDR repair systems. Zinc finger nucleases are optimized by engineering the DNA binding and catalytic domains. In some embodiments, ZFNs containing 3-6 zinc fingers can interact with 9-18 nt of DNA, so precise target recognition is specified by 18-36 nt of DNA at each cleavage site. Furthermore, linkers spanning the zinc finger-zinc finger and zinc finger-Fokl cleavage domain junction greatly increase the number of ZFN configurations for targeted precise genome editing.

[0149] Transcription activator-like effector nuclease (TALEN)

[0150] In some embodiments of the invention, the editable template is designed to be recognizable by the TALEN system. TALEN is derived from Xanthomonas (…). Xanthomonas This is a fusion protein of bacterial TALE protein and FokI endonuclease. The TALE motif contains 33-35 amino acid repeating domains, each recognizing a nucleotide in DNA. A series of TALEs can bind to DNA segments, such as 30-40 nt, with specificity indicated by the TALE binding site starting with a T base. The TALE protein has two highly variable amino acids, called repeating variable diresidues, which provide specificity. The FokI endonuclease requires dimerization and binding of TALENs on the opposite strand of the target DNA for cleavage.

[0151] Clustered regularly interspaced short palindromic repeats (CRISPR)-Cas endonuclease

[0152] In some embodiments of the invention, the re-editable template is designed to be recognized by the CRISPR-Cas system. The CRISPR genome editing system is an RNA-guided editing system comprising a Cas nuclease, a trans-activating crRNA (tracrRNA), and a CRISPR RNA (crRNA) that recognizes the target sequence. The target sequence must be followed by a protospacer adjacent motif (PAM). Typically, the CRISPR-Cas system recognizes sequences between 20 and 25 nt, such as 22 nt, and PAM sequences. Each Cas9 protein has a specific PAM sequence; for example, Cas9 recognizes 5′-NGG-3′ and produces double-strand breaks. Mutant Cas9 variants, called nickases, produce single-strand breaks. Because target recognition in the CRISPR-Cas system is RNA-guided, such gRNAs can be designed for any genomic target, with the standard being minimal off-target editing. Furthermore, multiple sites can be modified simultaneously in multiple ways if desired.

[0153] Cas9 variants and homologs, such as CRISPR-Cas12 (Cpf1) and CRISPR-Cas13a (C2c2), recognize different PAMs. In some embodiments, the Cas protein is Cas9, Cas12a, or Cas12b. In some embodiments, the Cas protein is an enzymatically inactive Cas protein or a nickase. In some embodiments, the nickase is Cas9 D10A. Furthermore, in some embodiments, the Cas9 protein is fused with a FokI endonuclease.

[0154] Design of guide RNA

[0155] RNA guide and guide RNA are used interchangeably herein. Appropriate guide RNA sequences are carefully designed based on the location and sequence of the target locus. The guide RNA must have high activity and have high efficiency while also minimizing off-target editing. In some embodiments, the guide RNA comprises about 20 nt followed by a specific PAM sequence, e.g., for SpCas9, 20 nt followed by 5'-NGG-3'. For homology dependent repair, the gRNA sequence recognizes the DNA sequence within about 30 nt of the desired edit site.

[0156] In some embodiments, appropriate guide RNAs are selected to include 20 nt followed by a PAM sequence comprising greater than 2 mismatches. In some embodiments, the guide RNAs are selected to include 20 nt followed by a PAM sequence comprising 3 mismatches. For example, in some embodiments, the guide RNAs are selected using tools known in the art for guide RNA selection using a standard of greater than 50% on-target efficiency and no protein-coding genes in the list of predicted off-targets with less than 3 mismatches. Target sites having 70% or greater homology within the human genome are excluded, i.e., gRNAs target sites with less than 70% homology to another region in the genome, thereby reducing off-target cleavage. Target sites having 70%, 75%, 80%, 85%, 90%, 95% or greater homology within the human genome are excluded. Various gRNA design tools are known in the art, including but not limited to E-CRISP, CHOP-CHOP, CRISPR-ERA, Broad gRNA, Addgene, IDT Sequence Checker, Benchling, and DesktopGenomics, which are used in various embodiments for guide RNA design. In some embodiments, the guide RNAs are designed to target within 50 nt to 500 nt of the transcription start site for CRISPR activation technology, near the transcription start site for CRISPR interference, within a specific exon, within an intron sequence for knock-in genes, and within a protein-coding exon for knock-out sequences.

[0157] In some embodiments, the gRNA that directs the double-strand break to insert the re- editable template in the B2M exon 1 locus has 70%, 80%, 90%, 95%, 99%, or 100% identity to GAGTAGCGCGAGCACAGCTA (SEQ ID NO: 1), AGGGTAGGAGAGACTCACGC (SEQ ID NO: 2), or GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 3).

[0158] In some embodiments, the gRNA that directs a double strand break to insert a re- editable template in the B2M exon 1 locus has 70%, 80%, 90%, 95%, 99%, or 100% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that directs a double strand break to insert a re-editable template in the B2M exon 1 locus has 70% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that directs a double strand break to insert a re-editable template in the B2M exon 1 locus has 80% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that directs a double strand break to insert a re-editable template in the B2M exon 1 locus has 90% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that directs a double strand break to insert a re-editable template in the B2M exon 1 locus has 95% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that directs a double strand break to insert a re-editable template in the B2M exon 1 locus has 99% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4). In some embodiments, the gRNA that directs a double strand break to insert a re-editable template in the B2M exon 1 locus has 100% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4).

[0159] In some embodiments, the gRNA that directs a double strand break to insert a re- editable template in the B2M exon 2 locus has 70%, 80%, 90%, 95%, 99%, or 100% identity to AAGTCAACTTCAATGTCGGA (SEQ ID NO: 7), AGTCACATGGTTCACACGGC (SEQ ID NO: 8), or ACTTGTCTTTCAGCAAGGAC (SEQ ID NO: 9).

[0160] In some embodiments, the gRNA that directs a double strand break to insert a re- editable template in the B2M exon 2 locus has 70%, 80%, 90%, 95%, 99%, or 100% identity to CCTAGATCCAATAGTAGAGT (SEQ ID NO: 10) or GGTCACGTGGTTCACCCTAC (SEQ ID NO: 11).

[0161] In some embodiments, the gRNA that directs a double-strand break to insert a re- editable template in exon 2 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15). In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in exon 2 of the CIITA locus is 70% identical to ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15). In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in exon 2 of the CIITA locus is 80% identical to ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15). In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in exon 2 of the CIITA locus is 90% identical to ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15). In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in exon 2 of the CIITA locus is 95% identical to ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15). In some embodiments, the gRNA that directs a double-strand break to insert a re-editable template in exon 2 of the CIITA locus is 99% identical to ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15).In some embodiments, the gRNA that directs a double-strand break to insert a re- editable template in exon 2 of the CIITA locus has 100% identity to ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15).

[0162] In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 70% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 80% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 90% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 95% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 99% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17). In some embodiments, the gRNA that recognizes the editable template inserted in the CIITA exon 2 locus is 100% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17).

[0163] In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 70% identical to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 80% identical to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 90% identical to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 95% identical to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 99% identical to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19). In some embodiments, the gRNA that directs a double-strand break for insertion of a re-editable template in exon 3 of the CIITA locus is 100% identical to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19).

[0164] In some embodiments, the gRNA that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to TGACTGATGTAAGACTAGTA (SEQ ID NO: 20). In some embodiments, the gRNA that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 70% identical to TGACTGATGTAAGACTAGTA (SEQ ID NO: 20). In some embodiments, the gRNA that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 80% identical to TGACTGATGTAAGACTAGTA (SEQ ID NO: 20). In some embodiments, the gRNA that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 90% identical to TGACTGATGTAAGACTAGTA (SEQ ID NO: 20). In some embodiments, the gRNA that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 95% identical to TGACTGATGTAAGACTAGTA (SEQ ID NO: 20). In some embodiments, the gRNA that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 100% identical to TGACTGATGTAAGACTAGTA (SEQ ID NO: 20).

[0165] Cells and applications

[0166] In some embodiments, provided herein are engineered cells comprising a re-editable target locus, wherein the re-editable target locus comprises an exogenous re-editable template sequence that does not have substantial sequence similarity to any region in the rest of the genome, and wherein the re-editable template sequence is recognizable by a genome editing system.

[0167] In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a cultured cell. In some embodiments, the cell is a primary cell. In some embodiments, the cell is a non-dividing cell. In some embodiments, the cell is an immune cell. In some embodiments, the cell is a B cell, a T cell, a monocyte, a macrophage, or an NK cell. In some embodiments, the cell is a B cell. In some embodiments, the cell is a T cell. In some embodiments, the cell is a monocyte. In some embodiments, the cell is a macrophage. In some embodiments, the cell is an NK cell. In some embodiments, the cell is a stem cell or progenitor cell. In some embodiments, the cell is a stem cell. In some embodiments, the cell is a progenitor cell. In some embodiments, the cell is an induced pluripotent stem cell (iPSC).

[0168] In some embodiments, provided herein is a cell, wherein the genome editing system is a CRISPR-Cas associated nuclease system, a transcription activator-like effector nuclease (TALEN) system, or a zinc finger nuclease (ZFN) system. In some embodiments, the Cas protein is Cas9, Casl2a, or Casl2b. In some embodiments, the Cas protein is a catalytically inactive Cas protein or a nickase. In some embodiments, the Cas protein is Cas9 D10A.

[0169] The cells provided herein comprise a re-editable template flanked by homology arms and introduced into a re-editable locus as described in other parts of the application. In some embodiments, the re-editable template is less than about 500 nt. In some embodiments, the homology arms are between about 50 nt to 500 nt.

[0170] In some embodiments, provided herein is a method of modifying a locus in an engineered cell, the method comprising contacting the engineered cell with a genome editing system comprising: a nucleic acid encoding a recombinant nuclease protein or a Cas protein, and a guide RNA that specifically recognizes a PAM sequence comprised in a re-editable template, wherein the recombinant nuclease protein or the Cas protein is capable of binding the guide RNA and editing the locus.

[0171] In some embodiments, the nucleic acid encoding the Cas protein is fused to an adenine or cytosine deaminase, wherein the Cas protein fusion is capable of binding the guide RNA and performing base editing on the re-editable template.

[0172] Generating a re-editable hypoimmunogenic iPSC cell line

[0173] Hypoinmune induced pluripotent stem cells are deficient in one or more immune antigens that can elicit an immune response, such as HLA class I and II antigens, and are modified to evade phagocytosis or cytotoxicity caused, for example, by the release of granzymes and / or perforin by immune cells, resulting in a persistently increased cell in vivo. In addition, hypoinmune cells avoid the need for HLA matching in adoptive cell therapy, thus providing a universal off-the-shelf source for the production of a variety of therapeutic cell types, thereby reducing costs and labor. This cell platform can be used to generate specific cell products to generate specific tissues and organs for regenerative therapies.

[0174] Human leukocyte antigen (HLA) class I and II genes.

[0175] In some embodiments, one or more genes selected from HLA class I and HLA class II genes are knocked out in the iPSC. In some embodiments, one or more genes selected from the group consisting of B2M, A2AR, LAG3, TIM3, TAP1, TAP2, Tapasin, NLRC5, PD1, RFKANK, CIITA, RFX5, and RFXAP are knocked out in the iPSC.

[0176] Beta-2 microglobulin (B2M): B2M is ubiquitously expressed in somatic cells and is generally considered a “housekeeping” gene. It is transcriptionally active in all cells, with varying expression levels. In some embodiments, the B2M gene of the hypoinmune iPSC cells of the present application is deleted or knocked out, thereby lacking B2M protein expression. In some embodiments, the hypoinmune iPSC cells of the present application are B2M gene deficient, thereby reducing B2M protein expression. In some embodiments, the target locus is B2M.

[0177] Class II, major histocompatibility complex, transactivator (CTIIA): CIITA is a human gene that functions in HLA class II genes by activating the transcription factor RFX5. The CIITA protein contains one acidic transcriptional activation domain, 4 leucine-rich repeats (LRRs), and one GTP-binding domain. CIITA binds GTP and translocates to the nucleus, where it promotes class II HLA gene transcription. Expression of CIITA is induced by IFN-g. In some embodiments, the target locus is CIITA.

[0178] The present application introduces a re-editable template that knocks out expression of B2M or CIITA, while integrating a unique sequence that can be used to further modify the locus, such as by using a unique gRNA. Introduction of the re-editable template in the B2M or CIITA locus disrupts expression of the wild-type gene and results in truncation of the coding region.

[0179] Genetically engineering hypoimmune cells requires preventing cell surface expression of Class I and Class II HLA genes, for example, preventing expression of B2M Positioning to the cell surface is important for reducing HLA Class I molecule presentation of alloantigens. In some embodiments, Class I and Class II genes are knocked out and replaced with a reeditable template, for example, an induced pluripotent stem cell (iPSC) is engineered to knock out exemplary HLA Class I and Class II genes and generate a reeditable B2M and CIITA locus that can be subsequently modified. For example, a “housekeeping gene” locus (e.g., B2M) is subsequently used to express a protein-coding gene of interest from that locus in all future somatic cells. In some embodiments, the CIITA locus is used to express a gene of interest in cell types that express HLA Class II antigens. In some embodiments, the locus is modified with a reeditable template that does not comprise an exogenous gene encoding a protein.

[0180] In some embodiments, the reeditable template comprises a chimeric antigen receptor (CAR) gene for CAR-T therapy. Chimeric antigen receptor T cells are cells that are genetically engineered to express a new receptor, so they can bind to and kill cancer cells. In some embodiments, the present invention provides hypoimmune pluripotent stem cells containing a nucleic acid encoding a CAR. In some embodiments, the hypoimmune cells expressing a CAR are homozygous null for the B2M gene and / or the CIITA gene. Each CAR T cell therapy is directed against a specific kind of cancer antigen expressed in different cells. One of the applications of the present invention is that it provides a simple method to quickly generate cells for CAR T therapies targeting, for example, different antigens.

[0181] The guide RNA sequences that direct double-strand breaks in exemplary loci, the guide RNA sequences that recognize reeditable templates for subsequent editing, the reeditable loci, and the corresponding wild-type loci are provided in Tables 1-4 below.

[0182] Table 1. B2M Exon 1

[0183] Table 2. B2M Exon 2

[0184] Table 3. CIITA Exon 2

[0185] Table 4. CIITA Exon 3

[0186] Examples

[0187] Example 1. Exemplary re-editable template design and integration into a target locus

[0188] This example illustrates exemplary re-editable templates integrated into target loci to form re-editable target loci.

[0189] Briefly, in this example, gRNAs were designed to direct double-strand breaks to insert re-editable templates in exemplary target loci: B2M exon 1, B2M exon 2, CIITA exon 2, and CIITA exon 3.

[0190] Unique re-editable templates were designed that have no substantial sequence similarity to any region in the genome and where the template sequence can be recognized by genome editing systems, such as CRISPR-Cas, transcription activator-like effector nucleases (TALENs), or zinc finger nucleases (ZFN) systems. In some embodiments, the re-editable template is a sequence of less than about 100 nt. In some embodiments, where the genome editing tool is CRISPR-Cas, the re-editable template comprises a protospacer adjacent motif (PAM) that can be recognized by a specific Cas nuclease. In some embodiments, the re-editable template comprises a 5'-NGG-3' PAM and the nuclease is SpCas9.

[0191] In this example, for SpCas9, gRNA spacer regions were designed to be about 20 nt followed by a 5'-NGG-3' PAM sequence with greater than 2 mismatches. A gRNA check tool was used, whose criteria are that the proposed target sequence (20 nt) should have a predicted on-target efficiency score of greater than 50% and no protein-coding genes in the predicted off-target list with less than 3 mismatches. No target sites with 100% homology (e.g., 0 mismatches) were identified in the human reference genome.

[0192] In some embodiments, there is no off-target editing.

[0193] Using a gene editing tool, such as CRISPR-Cas, the re-editable templates flanked by site-specific homology arms are integrated into the target loci by homology-directed repair. In some embodiments, the homology arms are between about 50 nt to 500 nt. In some embodiments, the homology arms are about 100 nt. The homology arms were designed for each target locus taking into account GC content, structural repeats, etc. Exemplary guide RNAs and re-editable target loci are provided below.

[0194] Re-editable B2M exon 1 locus

[0195] In some embodiments, the gRNA that directs a double-strand break to insert a re- editable template in the B2M exon 1 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to GAGTAGCGCGAGCACAGCTA (SEQ ID NO: 1), AGGGTAGGAGAGACTCACGC (SEQ ID NO: 2), or GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 3). In some embodiments, the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4).

[0196] The re-editable locus is defined by a sequence that is 70%, 80%, 90%, 95%, 99%, or 100% identical to ATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCCAGGTCCTAATGATTAGCTGTGCTCGCCCTGCTCTCTCTGTCTGGCCTGGAGGCTATTCAGCGTGAGTCTCTCCTACCCTCCCGCTCTGGTCCTTCCTCTCCCGCTCTGCACCCTCTGTGGCCCT (SEQ ID NO: 5) or AAAACGGGAAAGTCCCTCTCTCTAACCTGGCACTGCGTCGCTGGCTTGGAGACAGGTGACGGTCCCTGCGGGCCTTGTCCTGATTGGCTGGGCACGCGTTTAATATAAGTGGAGGCGTCGCGCTGGCGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCGTAGAGCGTGTGACTAGCTGTACTGGAGCTGTGAAGCTAATCCGGTCTGGAAGCCATTCAGCGTGAGTCTCTCCTACCCTCCCGCTCTGGTCCTTCCTCTCCCGCTCTGCACCCTCTGTGGCCCTCGCTGTGCTCTCTCGCTCCGTGACTTCCCTTCTCCAAGTTCTCCTTGGT (SEQ ID NO: 6).

[0197] The bolded sequence represents the re-editable template, while the flanking sequences are homology arms.

[0198] Re-editable B2M exon 2 locus

[0199] In some embodiments, the gRNA that directs a double-strand break to insert a re- editable template in the B2M exon 2 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to AAGTCAACTTCAATGTCGGA (SEQ ID NO: 7), AGTCACATGGTTCACACGGC (SEQ ID NO: 8), or ACTTGTCTTTCAGCAAGGAC (SEQ ID NO: 9).

[0200] The gRNA that recognizes the re-editable template inserted in the B2M exon 2 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to CCTAGATCCAATAGTAGAGT (SEQ ID NO: 10) or GGTCACGTGGTTCACCCTAC (SEQ ID NO: 11).

[0201] The re-editable locus is defined by a sequence that is 70%, 80%, 90%, 95%, 99%, or 100% identical to AAATGTAAACACTTGGTGCCTGATATAGCTTGACACCAAGTTAGCCCCAAGTGAAATACCCTGGCAATATTAATGTGTCTTTTCCCGATATTCCTCAGGTACCCCCTAGATCCAATAGTAGAGTAGGTGACCAGCCTAGAACGGAGCCTGTAGGGTGAACCACGTGACCCTGTAACAGTGGGGTAAGTCTTACATTCTTTTGTAAGCTGCTGAAAGTTGTGTATGAGTAGTCATATCATAAAGCTGCTTTGATATAAAAAAGGTCTATGGCCATACTACCC (SEQ ID NO: 12). The bolded sequence represents the re-editable template, while the flanking sequences are homology arms.

[0202] Re-editable CIITA exon 2 locus

[0203] In embodiments, the gRNA that directs a double-strand break to insert a re- editable template in exon 2 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15).

[0204] In some embodiments, the gRNA that recognizes the re-editable template inserted in the CTIIA exon 2 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17).

[0205] The re-editable locus is defined by a sequence that is at least 70%, 80%, 90%, 95%, 99%, or 100% identical to TTCTGCCTCTTTCCAACACCCTGTGAGGTGACTGAGCATTGTCTTCCCTCCCAGGCAGTTCCCAGTGTGCTACCATGGAGTTGTGACCCCTATAATGAGACCTGGCTGGAGAAGAAGAGATTGAGCTCTACTCAGGTGGGCCCTCCTCC (SEQ ID NO: 18).

[0206] The bolded sequence represents the re-editable template, while the flanking sequences are homology arms. Introduction of the re-editable template in the CIITA exon 2 locus removes the alternative splice site and disrupts wild-type gene expression.

[0207] Re-editable CIITA exon 3 locus

[0208] The gRNA that directs the double-strand break to insert the re-editable template in exon 3 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19).

[0209] The gRNA that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to TGACTGATGTAAGACTAGTA (SEQ ID NO:20).

[0210] The re-editable locus is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to AAATTTCCTTCTTCATCCAAGGGACTTTTCCTCCCAGAACCCGACACAGACACCATCAACTGCGACCAGTTCAGCTGACTGATGTAAGACTAGTAAGGTGATGAAGAGACCAGGGAGGCTTATGCCAATATCGGTGAGGAAGCACCTGAGCCCAGAAAAGGACAATCAAGGGCAAGAGTTCTTTGCTGCCACTTGTCA (SEQ ID NO: 21).

[0211] The bolded sequence represents the re-editable template, while the flanking sequences are homology arms.

[0212] In summary, the unique re-editable templates designed in this example use gRNAs designed for each target to integrate into a specific target locus to form a re-editable target locus that can be recognized by genome editing tools. Provided herein are guide RNAs that specifically recognize the re-editable loci for subsequent genome modification. Based on the methods provided herein, one of ordinary skill can design unique re-editable templates with no substantial sequence similarity to any other region of the genome and gRNAs specific to any locus to produce any re-editable target locus that can be specifically recognized by one or more genome editing systems for subsequent modification.

[0213] Example 2: Generation of an exemplary re-editable cell

[0214] This example illustrates the production of an exemplary re-editable cell comprising an exogenous re-editable template flanked by two homology arms that is integrated into a target locus by homologous recombination as described in Example 1.

[0215] Briefly, the re-editable templates designed in Example 1 are introduced into a cell by methods known in the art, such as transfection, transduction, transformation, conjugation, and especially include techniques such as electroporation, biolistic methods, microinjection, etc. of nucleic acids (e.g., vectors, plasmids, minicircles, circular single-stranded DNA, linear double-stranded or linear single-stranded DNA).

[0216] The homology arms designed in Example 1 for each specific locus flank the re-editable template and the exogenous re-editable template sequence is introduced into the target locus by homologous recombination, thereby producing a cell comprising a re-editable template locus that can be recognized by one or more genome editing systems for subsequent modification.

[0217] Exemplary cells of the present embodiments are human iPSC cells comprising a re- editable Class I and / or Class II HLA locus. For example, an iPSC cell line comprising a B2M re- editable locus is generated by the methods of the present embodiments. In another embodiment, an iPSC cell comprising a CIITA re-editable locus is generated by the methods of the present embodiments. In another embodiment, an iPSC cell comprising a B2M re-editable locus and a CIITA re-editable locus is generated by the methods of the present embodiments.

[0218] Based on the methods described in the present embodiments, a person of ordinary skill can generate any cell comprising a unique re-editable template that has no substantial sequence similarity to any other region of the genome to generate any re-editable target locus that can be specifically recognized by one or more genome editing systems for subsequent modification. For example, the cell is a mammalian cell, a human cell, a cultured cell, a primary cell, a non-dividing cell, or an immune cell. Exemplary immune cells are B cells, T cells, monocytes, macrophages, or NK cells. In some embodiments, the cell is a stem cell. In some embodiments, the cell is a cell line used to generate a platform that can be rapidly modified for various uses.

[0219] Example 3: Generation of a hypoimmunogenic iPSC cell line

[0220] Briefly, in the present embodiments, the methods described in embodiments 1 and 2 are used to generate hypoimmunogenic iPSC cell lines.

[0221] Induced pluripotent stem cells (iPSCs) are engineered to knockout exemplary HLA Class I and Class II genes and generate re-editable B2M and CIITA loci that can be subsequently modified.

[0222] In exemplary embodiments, the subsequent modification uses gRNA-guided Cas nucleases to generate double-strand breaks and integrate a protein-coding gene. In some embodiments, the protein-coding gene is a masking gene that protects the cell from recognition by NK cells, thereby generating hypoimmunogenic iPSCs. In some embodiments, the protein-coding gene triggers cell termination in the presence of an inducing molecule. In some embodiments, the protein-coding gene expresses one or more proteins that increase the efficacy of a CAR product.

[0223] While several embodiments of the application have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the functions and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the embodiments described herein. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the application described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that within the scope of the appended claims and equivalents thereto, the application can be practiced otherwise than as specifically described and claimed.

Claims

1. A method of engineering a re-editable target locus in a cell, the method comprising inserting an exogenous re-editable template sequence into the target locus, wherein the template sequence has no substantial sequence similarity to any region in the genome, and wherein the template sequence is recognizable by a genome editing system.

2. A method of engineering a re-editable cell, the method comprising introducing an exogenous re-editable template sequence flanked by two homology arms such that the re-editable template sequence is inserted into a target locus by homologous recombination, wherein the template sequence has no substantial sequence similarity to any region in the genome, and wherein the template sequence is recognizable by a genome editing system.

3. The method of any one of the preceding claims, wherein the genome editing system is a CRISPR-Cas associated nuclease system, a transcription activator-like effector nuclease (TALEN) system, or a zinc finger nuclease (ZFN) system.

4. The method of claim 3, wherein the Cas protein is Cas9, Casl2a, or Casl2b.

5. The method of claim 4, wherein the Cas protein is a catalytically inactive Cas protein or a nickase.

6. The method of claim 5, wherein the Cas protein is Cas9 D10A or Cas9 H480A.

7. The method of claim 3, wherein the Cas protein, TALEN, or ZFN is fused to a Fokl nuclease or a related nuclease domain.

8. The method of any one of the preceding claims, wherein each homology arm flanking the re-editable template is between about 50 nt to 500 nt.

9. The method of claim 8, wherein the homology arms are about 100 nt.

10. The method of any one of the preceding claims, wherein the re-editable template is less than about 500 nt.

11. The method of any one of the preceding claims, wherein the re-editable template is between about 10-500 nt.

12. The method of claim 11, wherein the re-editable template is about 100 nt.

13. The method of claim 11, wherein the re-editable template is about 500 nt.

14. The method of any one of the preceding claims, wherein the re-editable template comprises a protospacer adjacent motif (PAM).

15. The method of claim 10, wherein the re-editable template comprises a 5'-NGG-3' PAM and the nuclease is Cas9.

16. The method of any one of the preceding claims, wherein any coding region in the genome contains at least 3 mismatches relative to a sequence in the re-editable template that is recognizable by a guide RNA.

17. The method of claim 16, wherein there is no off-target editing.

18. The method of any one of the preceding claims, wherein the cell is a mammalian cell. ​ 19. The method of claim 18, wherein the cell is a human cell.

20. The method of claim 18, wherein the cell is a cultured cell.

21. The method of claim 18, wherein the cell is a primary cell.

22. The method of claim 18, wherein the cell is a non-dividing cell.

23. The method of claim 18, wherein the cell is an immune cell.

24. The method of claim 23, wherein the cell is a B cell, a T cell, a monocyte, a macrophage, or an NK cell.

25. The method of claim 18, wherein the cell is a stem cell or progenitor cell.

26. The method of claim 25, wherein the cell is an induced pluripotent stem cell (iPSC).

27. The method of any one of the preceding claims, wherein the target locus is at least one locus selected from the group consisting of a pan-expressed gene, a cell division- associated gene, and a gene expressed exclusively in a specific cell type.

28. The method of claim 27, wherein the target locus is a Class I or Class II HLA gene.

29. The method of claim 28, wherein the target locus is B2M.

30. The method of claim 29, wherein the gRNA directing the double-strand break to insert the re-editable template in the B2M exon 1 locus has 70%, 80%, 90%, 95%, 99%, or 100% identity to GAGTAGCGCGAGCACAGCTA (SEQ ID NO: 1), AGGGTAGGAGAGACTCACGC (SEQ ID NO: 2), or GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 3).

31. The method of claim 30, wherein the re-editable locus is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to ATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCCAGGTCCTAATGATTAGCTGTGCTCGCCCTGCTCTCTCTGTCTGGCCTGGAGGCTATTCAGCGTGAGTCTCTCCTACCCTCCCGCTCTGGTCCTTCCTCTCCCGCTCTGCACCCTCTGTGGCCCT (SEQ ID NO: 5) or AAAACGGGAAAGTCCCTCTCTCTAACCTGGCACTGCGTCGCTGGCTTGGAGACAGGTGACGGTCCCTGCGGGCCTTGTCCTGATTGGCTGGGCACGCGTTTAATATAAGTGGAGGCGTCGCGCTGGCGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCGTAGAGCGTGTGACTAGCTGTACTGGAGCTGTGAAGCTAATCCGGTCTGGAAGCCATTCAGCGTGAGTCTCTCCTACCCTCCCGCTCTGGTCCTTCCTCTCCCGCTCTGCACCCTCTGTGGCCCTCGCTGTGCTCTCTCGCTCCGTGACTTCCCTTCTCCAAGTTCTCCTTGGT (SEQ ID NO: 6).

32. The method of claim 29, wherein the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 2 locus has 70%, 80%, 90%, 95%, 99%, or 100% identity to AAGTCAACTTCAATGTCGGA (SEQ ID NO: 7), AGTCACATGGTTCACACGGC (SEQ ID NO: 8), or ACTTGTCTTTCAGCAAGGAC (SEQ ID NO: 9).

33. The method of claim 29, wherein the gRNA that recognizes the re-editable template inserted in the B2M exon 2 locus has 70%, 80%, 90%, 95%, 99%, or 100% identity to CCTAGATCCAATAGTAGAGT (SEQ ID NO: 10) or GGTCACGTGGTTCACCCTAC (SEQ ID NO: 11), or the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 70%, 80%, 90%, 95%, 99%, or 100% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4).

34. The method of claim 33, wherein the re-editable locus is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to AAATGTAAACACTTGGTGCCTGATATAGCTTGACACCAAGTTAGCCCCAAGTGAAATACCCTGGCAATATTAATGTGTCTTTTCCCGATATTCCTCAGGTACCCCCTAGATCCAATAGTAGAGTAGGTGACCAGCCTAGAACGGAGCCTGTAGGGTGAACCACGTGACCCTGTAACAGTGGGGTAAGTCTTACATTCTTTTGTAAGCTGCTGAAAGTTGTGTATGAGTAGTCATATCATAAAGCTGCTTTGATATAAAAAAGGTCTATGGCCATACTACCC (SEQ ID NO: 12).

35. The method of claim 28, wherein the target locus is CIITA.

36. The method of claim 35, wherein the gRNA that directs a double-strand break to insert a re-editable template in exon 2 of the CIITA locus has 70%, 80%, 90%, 95%, 99%, or 100% identity to ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15).

37. The method of claim 35, wherein the gRNA that recognizes the re-editable template inserted in exon 2 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17).

38. The method of claim 36, wherein the re-editable locus is defined by a sequence that is 70%, 80%, 90%, 95%, 99%, or 100% identical to TTCTGCCTCTTTCCAACACCCTGTGAGGTGACTGAGCATTGTCTTCCCTCCCAGGCAGTTCCCAGTGTGCTACCATGGAGTTGTGACCCCTATAATGAGACCTGGCTGGAGAAGAAGAGATTGAGCTCTACTCAGGTGGGCCCTCCTCC (SEQ ID NO: 18).

39. The method of claim 38, wherein the gRNA that directs a double-strand break to insert a re-editable template in exon 3 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19).

40. The method of claim 35, wherein the gRNA that recognizes the re-editable template inserted in exon 3 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to TGACTGATGTAAGACTAGTA (SEQ ID NO: 20).

41. The method of claim 40, wherein the re-editable locus is defined by a sequence that is 70%, 80%, 90%, 95%, 99%, or 100% identical to AAATTTCCTTCTTCATCCAAGGGACTTTTCCTCCCAGAACCCGACACAGACACCATCAACTGCGACCAGTTCAGCTGACTGATGTAAGACTAGTAAGGTGATGAAGAGACCAGGGAGGCTTATGCCAATATCGGTGAGGAAGCACCTGAGCCCAGAAAAGGACAATCAAGGGCAAGAGTTCTTTGCTGCCACTTGTCA (SEQ ID NO: 25).

42. The method of any of the preceding claims, wherein the re-editable template comprises an exogenous protein-coding gene.

43. The method of claim 42, wherein the exogenous gene is an immunomodulatory gene or a masking gene.

44. The method of claim 42, wherein the exogenous gene expresses a protein that causes cell death, wherein the gene is selected from the group consisting of HSV-TK, iCaspase8, and iCaspase9.

45. The method of any of the preceding claims, wherein the re-editable template comprises a chimeric antigen receptor (CAR) gene.

46. An isolated cell engineered by the method of any of the preceding claims.

47. An engineered cell comprising a re-editable target locus, wherein the re-editable target locus comprises an exogenous re-editable template sequence that has no substantial sequence similarity to any region in the rest of the genome, and wherein the re-editable template sequence is recognizable by a genome editing system.

48. The cell of claim 47, wherein the genome editing system is a CRISPR-Cas associated nuclease system, a transcription activator-like effector nuclease (TALEN) system, or a zinc finger nuclease (ZFN) system.

49. The cell of claim 48, wherein the Cas protein of the CRISPR-Cas associated nuclease system is Cas9, Casl2a, or Casl2b.

50. The cell of claims 47-49, wherein the Cas protein is a catalytically inactive Cas protein or a nickase.

51. The cell of claim 50, wherein the Cas protein is Cas9 D10A or Cas9 H840A.

52. The cell of any of the preceding claims, wherein the re-editable template is flanked by homology arms, wherein the homology arms are between about 50 nt to 500 nt.

53. The cell of claim 52, wherein the homology arms are about 100 nt.

54. The cell of any of the preceding claims, wherein the re-editable template is less than about 500 nt.

55. The cell of any of the preceding claims, wherein the re-editable template is less than about 100 nt.

56. The cell of any of the preceding claims, wherein the re-editable template comprises a protospacer adjacent motif (PAM).

57. The cell of claim 56, wherein the re-editable template comprises a 5'-NGG-3' PAM and the nuclease is Cas9.

58. The cell of any of the preceding claims, wherein the coding region in the genome that is recognizable by a guide RNA contains at least 3 mismatches.

59. The cell of claim 58, wherein there is no off-target editing.

60. The cell of any of the preceding claims, wherein the cell is a mammalian cell.

61. The cell of claim 60, wherein the cell is a human cell.

62. The cell of claim 60, wherein the cell is a cultured cell.

63. The cell of claim 60, wherein the cell is a primary cell.

64. The cell of claim 60, wherein the cell is a non-dividing cell.

65. The cell of claim 60, wherein the cell is an immune cell.

66. The cell of claim 65, wherein the cell is a B cell, a T cell, a monocyte, a macrophage, or an NK cell.

67. The cell of claim 60, wherein the cell is a stem cell.

68. The cell of claim 67, wherein the cell is an induced pluripotent stem cell (iPSC).

69. The cell of any one of the preceding claims, wherein the target locus encodes an immune gene.

70. The cell of claim 69, wherein the target locus encodes a class I or class II HLA gene.

71. The cell of claim 70, wherein the target locus is B2M.

72. The cell of claim 71, wherein the gRNA that directs a double-strand break to insert a re- editable template in the B2M exon 1 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to GAGTAGCGCGAGCACAGCTA (SEQ ID NO: 1), AGGGTAGGAGAGACTCACGC (SEQ ID NO: 2), or GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 3).

73. The cell of claim 72, wherein the re-editable locus is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to ATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCCAGGTCCTAATGATTAGCTGTGCTCGCCCTGCTCTCTCTGTCTGGCCTGGAGGCTATTCAGCGTGAGTCTCTCCTACCCTCCCGCTCTGGTCCTTCCTCTCCCGCTCTGCACCCTCTGTGGCCCT (SEQ ID NO: 5) or AAAACGGGAAAGTCCCTCTCTCTAACCTGGCACTGCGTCGCTGGCTTGGAGACAGGTGACGGTCCCTGCGGGCCTTGTCCTGATTGGCTGGGCACGCGTTTAATATAAGTGGAGGCGTCGCGCTGGCGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCGTAGAGCGTGTGACTAGCTGTACTGGAGCTGTGAAGCTAATCCGGTCTGGAAGCCATTCAGCGTGAGTCTCTCCTACCCTCCCGCTCTGGTCCTTCCTCTCCCGCTCTGCACCCTCTGTGGCCCTCGCTGTGCTCTCTCGCTCCGTGACTTCCCTTCTCCAAGTTCTCCTTGGT (SEQ ID NO: 6).

74. The cell of claim 73, wherein the gRNA that recognizes the re-editable template inserted in the B2M exon 1 locus has 70%, 80%, 90%, 95%, 99%, or 100% identity to GAGCGTGTGACTAGCTGTAC (SEQ ID NO: 4).

75. The cell of claim 73, wherein the gRNA that directs a double-strand break to insert a re-editable template in the B2M exon 2 locus has 70%, 80%, 90%, 95%, 99%, or 100% identity to AAGTCAACTTCAATGTCGGA (SEQ ID NO: 7), AGTCACATGGTTCACACGGC (SEQ ID NO: 8), or ACTTGTCTTTCAGCAAGGAC (SEQ ID NO: 9).

76. The cell of claim 73, wherein the gRNA recognizing the re-editable template inserted in the B2M exon 2 locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to CCTAGATCCAATAGTAGAGT (SEQ ID NO: 10) or GGTCACGTGGTTCACCCTAC (SEQ ID NO: 11).

77. The cell of claim 76, wherein the re-editable locus is defined by a sequence that is 70%, 80%, 90%, 95%, 99%, or 100% identical to AAATGTAAACACTTGGTGCCTGATATAGCTTGACACCAAGTTAGCCCCAAGTGAAATACCCTGGCAATATTAATGTGTCTTTTCCCGATATTCCTCAGGTACCCCCTAGATCCAATAGTAGAGTAGGTGACCAGCCTAGAACGGAGCCTGTAGGGTGAACCACGTGACCCTGTAACAGTGGGGTAAGTCTTACATTCTTTTGTAAGCTGCTGAAAGTTGTGTATGAGTAGTCATATCATAAAGCTGCTTTGATATAAAAAAGGTCTATGGCCATACTACCC (SEQ ID NO: 12).

78. The cell of claim 70, wherein the target locus is CIITA.

79. The cell of claim 78, wherein the gRNA directing a double-strand break to insert a re-editable template in exon 2 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to ATGGAGTTGGGGCCCCTAGA (SEQ ID NO: 13), CTACCACTTCTATGACCAGA (SEQ ID NO: 14), or GTGGCACACTGTGAGCTGCC (SEQ ID NO: 15).

80. The cell of claim 78, wherein the gRNA recognizing the re-editable template inserted in exon 2 of the CIITA locus is 70%, 80%, 90%, 95%, 99%, or 100% identical to GTGACCCCTATAATGAGACC (SEQ ID NO: 16) or CAGTTCCCAGTGTGCTACCA (SEQ ID NO: 17).

81. The cell of claim 78, wherein the re-editable locus is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to TTCTGCCTCTTTCCAACACCCTGTGAGGTGACTGAGCATTGTCTTCCCTCCCAGGCAGTTCCCAGTGTGCTACCATGGAGTTGTGACCCCTATAATGAGACCTGGCTGGAGAAGAAGAGATTGAGCTCTACTCAGGTGGGCCCTCCTCC (SEQ ID NO: 18).

82. The cell of claim 78, wherein the gRNA that directs a double-strand break to insert a re-editable template in exon 3 of the CIITA locus has 70%, 80%, 90%, 95%, 99%, or 100% identity to AGGCTGTTGTGTGACATGGA (SEQ ID NO: 19).

83. The cell of claim 78, wherein the gRNA that recognizes the re-editable template inserted in exon 3 of the CIITA locus has 70%, 80%, 90%, 95%, 99%, or 100% identity to TGACTGATGTAAGACTAGTA (SEQ ID NO: 20).

84. The cell of claim 82, wherein the re-editable locus is defined by a sequence having 70%, 80%, 90%, 95%, 99%, or 100% identity to AAATTTCCTTCTTCATCCAAGGGACTTTTCCTCCCAGAACCCGACACAGACACCATCAACTGCGACCAGTTCAGCTGACTGATGTAAGACTAGTAAGGTGATGAAGAGACCAGGGAGGCTTATGCCAATATCGGTGAGGAAGCACCTGAGCCCAGAAAAGGACAATCAAGGGCAAGAGTTCTTTGCTGCCACTTGTCA (SEQ ID NO: 25).

85. The cell of any of the preceding claims, wherein the re-editable template comprises an exogenous protein-coding gene.

86. The cell of claim 85, wherein the exogenous protein-coding gene is an immunomodulatory gene or a masking gene.

87. The cell of claim 85, wherein the exogenous protein-coding gene expresses a protein that causes cell death.

88. The cell of any of the preceding claims, wherein the re-editable template comprises a chimeric antigen receptor (CAR) gene.

89. A method of modifying a locus in an engineered cell, the method comprising contacting the engineered cell of claim 46 or 47 with a genome editing system comprising: a nucleic acid encoding a recombinant nuclease protein or a Cas protein, and a guide RNA that specifically recognizes a PAM sequence comprised in the re- editable template, wherein the recombinant nuclease protein or Cas protein is capable of binding the guide RNA and editing the locus.

90. The method of claim 89, wherein the nucleic acid encoding a Cas protein is fused to an adenine or cytosine deaminase, and wherein the Cas protein fusion is capable of binding the guide RNA and performing base editing on the re-editable template.

91. A re-editable template sequence, wherein the template sequence has no substantial sequence similarity to any region in a genome, and wherein the template sequence is capable of being recognized by a genome editing system.

Images