Application of TaTN3 gene in regulating wheat stripe rust resistance

Abstract

This invention provides TaTN3 The application of genes in regulating wheat stripe rust resistance belongs to the field of genetic engineering technology. This invention describes... TaTN3 The amino acid sequence encoded by the gene is shown in SEQ ID No. 2 and is located on the cell membrane. This invention also constructed gene-silencing and overexpression strains, and the results showed that silencing the gene in wheat materials... TaTN3 Genes that reduce wheat's resistance to stripe rust; overexpression of the aforementioned gene. TaTN3 Genes that enhance wheat's resistance to stripe rust. This confirms the effectiveness of the TaTN3 protein described in this invention. TaTN3 Genes play a role in regulating wheat stripe rust resistance. This invention provides gene resources and technical ideas for breeding stripe rust-resistant wheat varieties, and has high application value.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically involving TaTN3 Application of genes in regulating wheat stripe rust resistance. Background Technology

[0002] The interleukin-1 receptor-nucleotide-binding site-leucine rich repeat (TNL) is a core component of the plant immune system. It plays a crucial role not only in the plant-specific recognition of avirulent effectors of pathogens but also in the complex immune signaling processes involved in plant-pathogen interactions. Early studies revealed that TNL proteins primarily initiate immune responses by recognizing pathogen effectors, for example, in Arabidopsis thaliana (…). Arabidopsis thaliana The RPM1 receptor of ) can recognize bacteria caused by Pseudomonas ( Pseudomonas syringae The TNL receptor secretes the effector AvrB, while the RPS5 receptor recognizes the AvrPphB effector. These TNL receptors bind to the effectors in specific ways, leading to localized cell death in plants. Recent studies have found that the role of TNL proteins is not limited to directly recognizing pathogen effectors; their mediation of immune signal activation depends on downstream signaling molecules, especially key regulators such as EDS1 (Enhanced Disease Susceptibility 1) and NRG1 (Non-race-specific resistance gene 1). These molecules play important auxiliary roles in TNL-mediated immune responses. Specifically, the TIR domain of TNL can catalyze the production of ADP-ribose or similar nucleotide derivatives. These small molecules bind to the EDS1-SAG101-NRG1 complex, promoting the downward transmission of immune signals. Furthermore, these small molecules also regulate intracellular second messengers such as Ca2+. 2+ The concentration of reactive oxygen species further activates downstream defense responses, ensuring that plants can effectively cope with pathogen infection.

[0003] Studies have found that monocotyledonous plants, especially grasses such as wheat, rice and corn, do not have typical TNL proteins. Therefore, the discovery of atypical TNL proteins, especially those with disease resistance functions, in grasses can help provide new genetic resources for disease resistance breeding of crops. Summary of the Invention

[0004] This invention provides TaTN3 Genes regulate wheat stripe rust ( Puccinia striiformis f.sp.tritici , Pst Application of the gene in resistance TaTN3 It can directly regulate wheat's resistance to stripe rust, providing a solution for breeding disease-resistant wheat.

[0005] This invention provides genes TaTN3 The gene is used in regulating wheat resistance to stripe rust. TaTN3 The amino acid sequence of the encoded protein is shown in SEQ ID No. 2.

[0006] In a preferred embodiment of the present invention, the gene TaTN3 The nucleotide sequence is shown in SEQ ID No. 1.

[0007] This invention also provides a method for improving wheat resistance to stripe rust, including increasing the gene concentration in the wheat genome. TaTN3 The expression level of the gene TaTN3 The amino acid sequence of the encoded protein is shown in SEQ ID No. 2.

[0008] In a preferred embodiment of the present invention, the gene TaTN3 The nucleotide sequence is shown in SEQ ID No. 1.

[0009] This invention also provides genes TaTN3 Application in wheat breeding, suppressing the gene in the wheat genome. TaTN3 The expression or silencing of the gene TaTN3 Subsequently, it reduces wheat's resistance to stripe rust; the gene is overexpressed in the wheat genome. TaTN3 Afterwards, improve wheat's resistance to stripe rust;

[0010] The gene TaTN3 The amino acid sequence of the encoded protein is shown in SEQ ID No. 2.

[0011] This invention also provides a method for breeding wheat resistant to stripe rust, including increasing the gene concentration in the target wheat genome. TaTN3 The expression level of the gene TaTN3 The amino acid sequence of the encoded protein is shown in SEQ ID No. 2.

[0012] This invention also provides a method for breeding a wheat model that reduces resistance to stripe rust, comprising inhibiting genes in the target wheat genome. TaTN3 The expression or silencing of genes in the target wheat genome. TaTN3 The gene TaTN3 The amino acid sequence of the encoded protein is shown in SEQ ID No. 2.

[0013] Beneficial effects: This invention uses genetic engineering to screen a TaTN3 protein with disease resistance from wheat. The amino acid sequence of the protein is shown in SEQ ID No.2, and subcellular localization revealed that the protein is located on the cell membrane.

[0014] This invention also constructed gene-silencing and overexpression strains based on the gene encoding the TaTN3 protein, and found that silencing the gene in wheat materials... TaTN3 Genes that reduce wheat's resistance to stripe rust; overexpression of the aforementioned gene. TaTN3 Genes that enhance wheat's resistance to stripe rust. This confirms the effectiveness of the TaTN3 protein described in this invention. TaTN3 The gene plays a role in regulating wheat stripe rust resistance, based on the above TaTN3 The regulatory characteristics of genes on stripe rust were investigated using genetic engineering techniques to construct overexpression... TaTN3 The recombinant plasmid of the gene was transferred into Agrobacterium and used to transform wheat materials to obtain overexpression. TaTN3 The present invention relates to a transgenic wheat variety that exhibits significantly enhanced resistance to stripe rust. This invention provides genetic resources and technical approaches for the breeding of stripe rust-resistant wheat varieties and has high application value. Attached Figure Description

[0015] Figure 1 for TaTN3 The graph shows the results of transient gene silencing. In the graph, A represents the wheat leaf phenotype; B represents... TaTN3 Gene relative expression statistics; CYR23 represents inoculation with wheat stripe rust fungus CYR23 physiological race, BSMV represents inoculation with barley stripe mosaic virus (BSMV) mediated by... TaTN3 Transient gene silencing; Mock represents a normally growing wheat leaf from WaterSource 11, TaPDS represents a wheat leaf from WaterSource 11 transformed with the TaPDS gene silencing vector, and γ represents a wheat leaf from WaterSource 11 transformed with the BSMV:γ empty vector. TaTN3 -as-1、 TaTN3 -as-2 respectively indicate transfer in TaTN3 Water source 11 wheat leaves; Gene-specific fragment as-1 and as-2 silencing vectors;

[0016] Figure 2 for TaTN3 The graph shows the results of transient gene overexpression. In the graph, A represents the wheat leaf phenotype; B represents the relative biomass of stripe rust fungus / wheat; and C and D represent the results at different time points after stripe rust fungus inoculation. TaPR1 Genes and TaPR2 Gene expression levels; CYR34 indicates inoculation with wheat stripe rust fungus CYR34 physiological race. TaTN3 -OE indicates overexpression. TaTN3In the context of wheat, Fielder refers to normal Fielder wheat, while OE22 and OE27 refer to genetically modified wheat OE22 and OE27, respectively.

[0017] Figure 3 This is a diagram showing the subcellular localization results. Detailed Implementation

[0018] This invention provides genes TaTN3 The gene is used in regulating wheat resistance to stripe rust. TaTN3 The amino acid sequence of the encoded protein is shown in SEQ ID No. 2.

[0019] The wheat described in this invention TaTN3 (Toll / Interleukin-1 receptor-nucleotide bindingsite 3 in Triticum aestivum The gene encodes the interleukin-1 domain TIR (Toll / Interleukin-1 receptor-like) and the nucleotide-binding site NBS (Nucleotide-binding site) domain, but is not rich in leucine-rich repeat (LRR) domains, making it an atypical TNL protein.

[0020] The gene described in this invention TaTN3

[0021] In one embodiment of the present invention, the gene TaTN3 It is obtained by amplification from wheat, and the primer sequences used for amplification are shown in SEQ ID No. 3 and SEQ ID No. 4:

[0022] TaTN3 -F (SEQ ID No.3):ATGGAGCTTCAAGAGGAAAGCTC;

[0023] TaTN3 -R (SEQ ID No. 4): ACTAAGGTGGACATTTGTAAGG.

[0024] This invention represses the gene in the wheat genome. TaTN3 The expression or silencing of the gene TaTN3 Subsequently, it reduces wheat's resistance to stripe rust; the gene is overexpressed in the wheat genome. TaTN3 Subsequently, it improves wheat's resistance to stripe rust. This invention inhibits the gene described above. TaTN3 The expression and silencing of the genes TaTN3 and overexpression of the gene TaTN3 There are no special limitations on the method; conventional genetic transformation methods in this field can be used.

[0025] The present invention also provides the above-mentioned gene. TaTN3 Application in regulating wheat resistance to stripe rust.

[0026] In one embodiment of the present invention, the gene was suppressed by virus-induced gene silencing (VIGS). TaTN3 Expression in wheat, in silent T aTN3 When wheat leaves were inoculated with wheat stripe rust, the biomass of the stripe rust on the leaf surface was significantly higher than that of the control group, and resistance to stripe rust was reduced. In another embodiment of the present invention, the T gene was constructed. aTN3 Overexpressing plants, stably overexpressing TaTN3 The genetically modified wheat material significantly improved resistance to stripe rust, significantly reduced stripe rust sporulation, and also significantly decreased the stripe rust / wheat relative biomass level. Meanwhile, TaTN\(3\) Overexpressing genes in plants can induce higher levels of disease-related genes during stripe rust infection. PR The expression of the pathogenesis-related gene enhances resistance.

[0027] The present invention also provides a biomaterial for improving wheat resistance to stripe rust, wherein the biomaterial promotes the aforementioned genes. TaTN3 Expression in the wheat genome.

[0028] This invention does not specifically limit the type of biological material; it can be a recombinant vector or a recombinant bacterial strain containing the recombinant vector. The base vector of the recombinant vector can be a plant overexpression vector commonly used in the art; the recombinant bacterial strain can be Agrobacterium tumefaciens that mediates genetic transformation and contains the recombinant vector.

[0029] This invention also provides a method for overexpressing the above-mentioned gene. TaTN3 Recombinant carriers.

[0030] In one embodiment of the present invention, the pCUB vector is used as the base vector, and the gene is... TaTN3 Inserted into the pCUB carrier Bam The HI site was used to construct the recombinant vector. The pCUB vector described in this invention originated from the Plant Immunology Research Team of Northwest A&F University and has been previously published in an article (An Efficient Brome mosaic virus-BasedGene Silencing Protocol for Hexaploid Wheat). Triticum aestivum L.), DOI:10.3389 / fpls.2021.685187).

[0031] This invention also provides a method for improving wheat resistance to stripe rust, including increasing the gene concentration in the wheat genome. TaTN3 The expression level of the gene TaTN3 The amino acid sequence of the encoded protein is shown in SEQ ID No. 2.

[0032] In one embodiment of the present invention, the gene is expressed in the wheat genome by overexpression. TaTN3 Increased expression of [a substance] significantly reduced sporulation of stripe rust fungus, and the stripe rust / wheat relative biomass level also decreased significantly. Meanwhile, TaTN3 Gene overexpression in plants can induce higher levels of [something] during stripe rust infection. PR Gene expression, thereby enhancing resistance to stripe rust.

[0033] The present invention also provides the above-mentioned gene. TaTN3 The application of the above-mentioned biological materials or recombinant vectors in wheat breeding.

[0034] Using the gene described in this invention TaTN3 The aforementioned biological materials or recombinant vectors can significantly enhance wheat genes. TaTN3 The level of expression, and the creation of high expression TaTN3 To cultivate new wheat varieties.

[0035] This invention also provides a method for breeding wheat resistant to stripe rust, including increasing the gene concentration in the target wheat genome. TaTN3 The expression level of the gene TaTN3 The amino acid sequence of the encoded protein is shown in SEQ ID No. 2.

[0036] This invention also provides a method for breeding a wheat model that reduces resistance to stripe rust, comprising inhibiting genes in the target wheat genome. TaTN3 The expression or silencing of genes in the target wheat genome. TaTN3 The gene TaTN3 The amino acid sequence of the encoded protein is shown in SEQ ID No. 2.

[0037] This invention utilizes two specific fragments of the TaTN3 protein ( TaTN3 -as1、 TaTN3 Using -as2) as the target, two silencing vectors were obtained by linking them to the BSMV:γ vector: BSMV: TaTN3 -as1 and BSMV: TaTN3 -as2, the sequences of the two silenced vectors are shown in SEQ ID No. 5 and SEQ ID No. 6, respectively.

[0038] BSMV: TaTN3 -as1 (SEQ ID No.5): CAGAAGAAAAGGCCCTGTGAGTGGCTGGTCTGCTAACAATTATGAGCAACTAAATGCAGATACCATCAAGGGAAAGGAACCAGTTTTGTGGAAGGAGACTGAGGAAGGCATTGAGATGCAGAGACTGGGCACTCCACTGCAGCATGGCCGACAACCGAGAGTGAAGAATGGTGGGAGATATGGAAGGAAGAAAAAAAC;

[0039] BSMV: TaTN3 -as2 (SEQ ID No. 6): ATATGCTCGCAAGCGAGGAGGCACAAGAACGGCTCAAGCTGCAGTCCAATCAGTGTACCTCCGAGGATCAATTAAACATTCTTCTGAGCACCTATGGGCTGCCTGCTTCATGGCTTTGGATTTGGTTCTGATCCTTTTCTGGTAGAACTGAGGCCATCTGAGTTGATGTTCTTCGTGAAGCAGATTGTCGTGCCACTTGCGAT is shown.

[0040] In one embodiment of the present invention, the primers used to construct the above two silencing vectors are as follows:

[0041] BSMV: TaTN3 -as1-F (SEQ ID No.7): TAGCTAGCTGATTAATTAACAGAAGAAAAGGCCCTGTGAG;

[0042] BSMV: TaTN3 -as1-R (SEQ ID No.8): TTGCTAGCTGAGCGGCCGCGTTTTTTTCTTCCTTCCATATCTCCC;

[0043] BSMV: TaTN3 -as2-F (SEQ ID No.9): TAGCTAGCTGATTAATTAAATATGCTCGCAAGCGAGGAG;

[0044] BSMV: TaTN3 -as2-R (SEQ ID No. 10): TTGCTAGCTGAGCGGCCGCATCGCAAGTGGCACGACAAT.

[0045] The viral vector BSMV:α / γ was linearized using Mlu I restriction enzyme, and BSMV:β was linearized using Spe I restriction enzyme. The target silencing vector BSMV: TaTN3 -as1 and BSMV: TaTN3 -as2 was linearized using BssH II restriction enzyme, and then the linearized vector was transcribed in vitro according to the instructions of the in vitro transcription kit (Promega). The product of successful in vitro transcription was diluted 2 times with DEPC water, mixed by pipetting, and then used for viral infection.

[0046] The BSMV:γ vector and BSMV:α / γ vector described in this invention both originated from the Plant Immunology Research Team of Northwest A&F University and have been previously published in an article (An Efficient Brome mosaic virus-Based GeneSilencing Protocol for Hexaploid Wheat). Triticum aestivum L.), DOI: 10.3389 / fpls.2021.685187).

[0047] To further illustrate the present invention, the application of the TaTN3 gene provided by the present invention in regulating wheat stripe rust resistance is described in detail below with reference to the embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0048] The wheat material used in the embodiments of the present invention is water source 11; the stripe rust fungus used in the gene transient silencing experiment is CYR23 physiological race; the stripe rust fungus used in the gene overexpression experiment is CYR34 physiological race.

[0049] Example 1

[0050] 1. TaTN3 Cloning: Phanta Max Super-Fidelity DNA Polymerase Kit (Vazyme) was performed according to the manufacturer's instructions. TaTN3 Gene cloning: The following components were added sequentially to a PCR tube: 1 μL cDNA template from wheat material water source 11, 1 μL each of primers (SEQ ID No. 3 / No. 4 provided), 0.5 μL dNTP, 12.5 μL 2×PlantaMax Buffer, 0.5 μL PhantaMax Super-Fidelity DNA Polymerase, and 8.5 μL sterile water. The above system was placed in a PCR instrument, and the program was set as follows: 95℃ pre-denaturation for 3 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 2 min, 32 cycles; 72℃ extension for 10 min. The amplified gene was sequenced. TaTN3 The nucleotide sequence of the gene is shown in SEQ ID No. 1. The TaTN3 gene encodes the TaTN3 protein, and the amino acid sequence of the TaTN3 protein is shown in SEQ ID No. 2.

[0051] 2. TaTN3 Subcellular localization

[0052] The primers for constructing the TaTN3-pCambia1300 vector are:

[0053] TaTN3 -pCambia1300-F (SEQ ID No. 11): ACGGGGGACGAGCTCGGTACCATGGAGCTTCAAGAGGAAAGCTC;

[0054] TaTN3 -pCambia1300-R (SEQ ID No. 12): ATGGTCTTTGTAGTCGTCGACACTAAGGTGGACATTTGTAAG.

[0055] Recombinant plasmids were prepared using the ClonExpress II One Step Cloning Kit (Vazyme) according to the manufacturer's instructions. TaTN3Construction of -pCambia1300: Add the following components to a PCR tube in sequence: 2 μL of cloning product; 1 μL of 5×CEⅡ Buffer; and use... Kpn I and [[ID=1\(0\)6]]SaI 1.5 μL of the linearized vector obtained by double digestion of pCambia1300 with enzyme I; 0.5 μL of Exnase II; after mixing by pipetting, place in a PCR instrument, set the program to 37℃ for 30 min, and transform the product into E. coli and extract the recombinant plasmid.

[0056] The constructed containing TaTN3 plant expression vectors TaTN3 -pCambia1300 was transformed into Agrobacterium GV3101 strain. Single colonies of the transformed Agrobacterium were picked and cultured in 1 mL of LB broth at 28°C and 200 rpm for 24 h. The cells were collected by centrifugation at 5000 rpm for 10 min, and resuspended in infiltration buffer (10 mM MgCl2, 10 mM MES, 150 μM AS, pH=5.6). OD was adjusted. 600 The value was set to 1.0. The treated bacterial suspension was injected into tobacco leaves, and after 48 hours, the subcellular localization of TaTN3 protein under green and red fluorescent backgrounds was observed using confocal microscopy.

[0057] This invention fuses the membrane protein TaWPI6 with an mCherry tag and then... TaTN3 -GFP co-expression. Subcellular localization is as follows: Figure 3 As shown, TaTN3-GFP+mCherry represents the TaTN3 protein containing the GFP tag, serving as a control; TaTN3-GFP+TaWPI6-mcherry represents the TaTN3 protein containing both the GFP tag and the mCherry membrane localization protein TaWPI6. The TaTN3 protein and the mCherry-fused membrane localization protein TaWPI6 are co-localized on the plant cell membrane, exhibiting a combined yellow fluorescence, indicating that the TaTN3 protein is distributed on the cell membrane.

[0058] Example 2

[0059] 1. Amplified as described in Example 1 TaTN3 Detection of relative gene expression levels

[0060] Wheat leaves inoculated with stripe rust fungus CYR23 were collected, ground in liquid nitrogen to fully break them down, and then total RNA was extracted from the wheat using a plant RNA extraction kit (Beijing Huayueyang Biotechnology Co., Ltd., catalog number: ZH120).

[0061] 2. Reverse transcription to synthesize cDNA

[0062] Use the reverse transcription kit (Vazyme) to perform reverse transcription according to the instructions.

[0063] 3. Real-time quantitative PCR (RT-qPCR):

[0064] Design of TaTN3 gene sequence-specific RT-qPCR primers using Primer 5.0 software:

[0065] TaTN3 -qRT-F (SEQ ID No. 13): GGAAGTGTGGCGAACACTA;

[0066] TaTN3 -qRT-R (SEQ ID No. 14): TACTCAGACTTTGCGCTGCA.

[0067] The amplified fragment length is between 200 and 350 bp, the primer Tm value is 60 to 62, and the internal reference gene is... TaEF The internal reference primers are shown below:

[0068] TaEF -qRT-F (SEQ ID No.15):TGGTGTCATCAAGCCTGGTATGGT;

[0069] TaEF -qRT-R (SEQ ID No. 16): ACTCATGGTGCATCTCAACGGACT.

[0070] RT-qPCR reaction system (20μL): 10μL qPCR reagent mixture, 2μL cDNA, 0.5μL each of forward and reverse primers (10μM) and the remainder ddH2O.

[0071] The reaction program was as follows: pre-denaturation at 95℃ for 10 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 20 s, 40 cycles; extension at 72℃ for 10 min; and melting curve analysis. Two [reaction parameters were used]. –ΔΔCt Relative quantitative algorithms were used to analyze the relative expression levels of genes, with each sample being tested in three biological replicates.

[0072] 4. Virus-induced gene silencing (VIGS)

[0073] Using whole-genome BLASTN analysis of wheat, two specific fragments of the TaTN3 protein (TaTN3-as1 and TaTN3-as2) were constructed as targets and ligated into the BSMV:γ vector to obtain two silencing vectors: BSMV: TaTN3 -as1 and BSMV: TaTN3The sequences of the two silencing vectors, -as2 and -as2, are shown in SEQ ID No. 5 and SEQ ID No. 6, respectively. The primers used to construct these two silencing vectors are: BSMV: TaTN3 -as1-F、BSMV: TaTN3 -as1-R、BSMV: TaTN3 -as2-F、BSMV: TaTN3 -as2-R.

[0074] The viral vectors were linearized using specific restriction endonucleases. The viral vectors BSMV:α / γ were linearized using Mlu I restriction enzyme, and BSMV:β were linearized using Spe I restriction enzyme. The target silencing vector was BSMV: TaTN3 And the positive control BSMV:TaPDS (the BSMV:TaPDS vector comes from the Plant Immunology Research Team of Northwest A&F University. It has been published in an article, An Efficient Brome mosaic virus-Based Gene Silencing Protocol for Hexaploid Wheat). Triticum aestivum L.), DOI: 10.3389 / fpls.2021.685187) was linearized using the BssHII restriction enzyme.

[0075] The above system was added sequentially to PCR tubes, thoroughly mixed, and reacted in a metal bath at 37°C for 3 hours. 1 μL was then aspirated for electrophoresis to check for linearization. The linearized vector was transcribed in vitro according to the Promega in vitro transcription kit instructions. The reaction system (10 μL) consisted of: 2 μL 5×T7 in vitro transcription buffer, 0.5 μL rATP, 0.5 μL rUTP, 0.5 μL rCTP, 0.5 μL rGTP, 0.5 μL RNase inhibitor, 0.5 μL in vitro transcription cap, 1 μL in vitro transcriptase (200 U / μL), and 4 μL linearization product.

[0076] The reaction mixture was sequentially added to RNase-free PCR tubes, thoroughly mixed, and incubated at 37°C in a metal bath for 1.5 hours. 1 μL was then taken to check for successful in vitro transcription. The successfully transcribed product was diluted 2-fold with DEPC water, mixed thoroughly, and then used for virus infection. The specific procedure is as follows:

[0077] (1) Select well-grown, plump wheat seeds “Shuiyuan 11” and sow them evenly in small pots, 10-16 seeds per pot, 3 pots per treatment. Cultivate at 16℃ with a photocycle of 16h light / 8h dark. Inoculate the wheat plants with the virus when they grow to the stage of two leaves and one heart.

[0078] (2) Preparation of virus inoculation solution: Mix the above in vitro transcription products BSMV:α, BSMV:β, and BSMV:γ in equal proportions, add an appropriate amount of FES buffer (made by adding 5g sodium pyrophosphate hydrate, 5g bentonite, 5g diatomaceous earth and water to 500mL and then autoclaving at 121℃ for 20min) and mix thoroughly to obtain the virus inoculation solution.

[0079] (3) Divide the virus inoculation solution into several small drops evenly on a clean PE glove, put on a latex glove, dip the drop into the drop, and rub it on the two leaves of the wheat 4 to 6 times to inoculate.

[0080] (4) After inoculation, wheat was cultured in the dark for 24 hours under high temperature and high humidity (70%RH) conditions at 30℃. Then, it was cultured for about 10 to 14 days under a photoperiod of 16 hours of light and 8 hours of darkness to observe its growth. When obvious mosaic phenomenon was observed, it indicated that the virus infection was successful.

[0081] 5. Inoculate with stripe rust fungus

[0082] Fourteen days after virus inoculation, relatively obvious mosaic symptoms can be observed on the third leaf from the bottom of the wheat plant. The next leaf after the appearance of mosaic symptoms, i.e., the fourth leaf from the bottom, is then inoculated with stripe rust fungus. The stripe rust fungus inoculation method is as follows:

[0083] (1) Take an appropriate amount of stripe rust fungus CYR23 physiological race cells and mix them with electronic fluoride solution in a 2mL centrifuge tube. Use a pipette to inoculate the mixture onto the four leaves from the bottom of the wheat plant.

[0084] (2) After inoculation, the wheat was transferred to a low temperature and high humidity (70%RH) culture room at 16℃ and cultured in the dark for 2 days, followed by culture under light for 14-18 days;

[0085] Samples were taken 48 hours after inoculation with stripe rust for identification. TaTN3 Gene silencing efficiency: 14 days after inoculation with wheat stripe rust, wheat leaves inoculated with stripe rust were collected based on the disease incidence on the leaves and mounted on black cardstock for scanning. Simultaneously, leaf samples were cut and stored at -80℃ for DNA extraction and biomass analysis.

[0086] 6. Stripe rust fungus / wheat biomass analysis

[0087] (1) Remove the leaf samples from the -80℃ freezer and completely break them up using a tissue grinder;

[0088] (2) Add 800 μL of CTAB extraction solution (preheated) to each sample tube, mix thoroughly in a vortex mixer, and place in a 65°C oven to stand. Invert and mix once every 10 min, repeat 3 times.

[0089] (3) Add an equal volume of DNA extraction solution (phenol:chloroform:isoamyl alcohol volume ratio = 25:24:1) to the fume hood, mix by inversion, and centrifuge at 13000 rpm for 10 min.

[0090] (4) Pipette 550 μL of supernatant into a new 1.5 mL centrifuge tube, and add an equal volume of isopropanol (pre-cooled) to the tube. Mix by inverting and place in a -20 °C refrigerator for 2 h.

[0091] (5) Centrifuge at 13000 rpm for 10 min and discard the liquid in the tube;

[0092] (6) Add 1 mL of anhydrous ethanol to the tube, and gently tap the centrifuge tube to remove the white precipitate at the bottom;

[0093] (7) Centrifuge at 13000 rpm for 2 min, discard the supernatant, and be careful not to discard the white precipitate at the bottom of the tube;

[0094] (8) Let the centrifuge tube stand with the opening open until the liquid in the tube is completely dry;

[0095] (9) Preheat sterile water to 65℃, add 100μL of preheated sterile water to the centrifuge tube, vortex thoroughly to mix, and the resulting liquid is DNA. After determining the concentration, store it in a -20℃ refrigerator.

[0096] (10) Dilution of DNA was used to prepare a standard curve. A total of 6 concentration gradients were prepared. qPCR detection was performed using TaEF and PstEF as primers and DNA dilution solution as template.

[0097] The primer sequences for TaEF are shown in SEQ ID No. 15 and SEQ ID No. 16.

[0098] PstEF -qRT-F (SEQ ID No. 19): TTCGCCGTCCGTGATATGAGACAA;

[0099] PstEF -qRT-R (SEQ ID No. 20):ATGCGTATCATGGTGGTGGAGTGA.

[0100] (11) The standard curve obtained is used for calculation and analysis, which is the result of stripe rust biomass.

[0101] The results are as follows Figure 1 As shown, TaTN3 The gene was successfully silenced in wheat leaves. TaTN3 wheat leaves with genes ( TaTN3 -as-1、 TaTN3Inoculation with wheat stripe rust fungus CYR23 (as-2) resulted in a significantly higher stripe rust biomass on the leaf surface compared to the control group. Figure 1 (A) Silence TaTN3 After gene delivery, expression levels decreased significantly. Figure 1 (B) indicates transfer in. TaTN3 After the silencing of gene-specific fragments as-1 and as-2 by vectors, wheat leaves TaTN3 Decreased gene expression levels reduce resistance to stripe rust fungi.

[0102] Example 3

[0103] 1. Overexpression of transgenic wheat TaTN3 - Creation of OE

[0104] Build TaTN3 The primers for the -pCUB vector are:

[0105] TaTN3-pCUB-F (SEQ ID No. 17): CAGGTCGACTCTAGAGGATCCATGGAGCTTCAAGAGGAAAGCTC;

[0106] TaTN3-pCUB-R (SEQ ID No. 18): GAGCTCGGTACCCGGGGATCCTCACTTATCATCATCATCCTTATAATCTCCCTTATCATCATCATCCTTATAATCTCCCTTATCATCATCATCCTTATAATCACTAAGGTGGACATTTGTAAGG;

[0107] Using the ClonExpress II One Step Cloning Kit (Vazyme), the recombinant plasmid was constructed according to the instructions: the following components were added to the PCR tube in sequence: 2 μL of cloning product; 1 μL of 5×CE II Buffer; Bam 1.5 μL of the linearized vector obtained by digesting pCUB with HI restriction enzyme; 0.5 μL of Exnase II; after mixing by pipetting, place in a PCR instrument, set the program: 37℃ for 30 min, and transform the product into E. coli and extract the recombinant plasmid.

[0108] Agrobacterium EH105 competent cells were removed from the -80℃ freezer 10 minutes in advance, and 1µg of the constructed cells were aspirated in a clean bench. TaTN3 The -pCUB recombinant plasmid was added to competent cells and placed on ice for 5 min; then cells loaded with Agrobacterium EH105 were mixed with... TaTN31.5 mL centrifuge tubes containing the -pCUB recombinant plasmid were treated in the following sequence: liquid nitrogen for 5 min, 37°C water bath for 5 min, and ice bath for 5 min. After treatment, 700 µL of liquid LB medium was added to a clean bench and incubated at 28°C and 180 rpm for 3 h. The bacterial culture was then evenly spread onto solid LB culture dishes containing rifampicin and kanamycin resistance, and inverted and placed in a 28°C incubator. After 2–3 days of incubation, the plates were sent to the wheat transgenic platform of the National Key Laboratory of Crop Stress Resistance and High-Efficiency Production at Northwest A&F University for transformation and construction of overexpression. TaTN3 Wheat plants containing the gene. After transformation and selection, overexpression was obtained. TaTN3 Genetically modified wheat varieties OE22 and OE27.

[0109] 2. Inoculation with stripe rust fungus

[0110] Following the stripe rust inoculation method described in Example 1, stripe rust fungus CYR34 was inoculated, with Fielder as a control. The following analysis was performed: Leaves from the inoculation site were collected at 24, 48, and 120 hours after inoculation with stripe rust fungus CYR34, and total RNA was extracted and detected. TaPR1 Genes and TaPR2 Gene expression levels,

[0111] TaPR1 -qRT-F (SEQ ID No. 21):GAGAATGCAGACGCCCAAGC;

[0112] TaPR1 -qRT-R (SEQ ID No. 22): CTGGAGCTTGCAGTCGTTGATC;

[0113] TaPR2 -qRT-R (SEQ ID No. 23):AGGATGTTGCTTCCATGTTTGCCG;

[0114] TaPR2 -qRT-R (SEQ ID No. 24): AAGTAGATGCGCATGCCGTTGATG.

[0115] See results Figure 2 C and D in the diagram. The sporulation rate of the stripe rust fungus was photographed and recorded 14 days after inoculation. The results are shown in [the diagram]. Figure 2 A. Separately, wheat leaves from the sporulation region were used to extract total DNA for biomass analysis. The biomass analysis method is described in step 6 of Example 2. The results are shown in […]. Figure 2 B in the middle.

[0116] Depend on Figure 2 It can be seen that stable overexpression TaTN3Wheat materials with the gene (OE22, OE27) significantly improved resistance to stripe rust fungus CYR34, and significantly reduced sporulation of stripe rust fungus. Figure 2 In A), the relative biomass level of stripe rust / wheat also decreased significantly ( Figure 2 (B in the text). Moreover, TaTN3 Compared to the control (Fielder), the gene-overexpressing plants exhibited higher levels of PR gene expression during stripe rust infection. Figure 2 Note: There seems to be a potential issue with the tag where it might be a misprint as it has a backslash in the original text. Also, in , the number 0 is in parentheses which might be an error in the original. These have been preserved as they are in the translation for consistency with the provided text. (C and D in the formula), thereby enhancing resistance.

[0117] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. gene TaTN3 In use in modulating resistance to stripe rust in wheat, characterized in that, The nucleotide sequence of the gene TaTN3 is shown in SEQ ID No. 1 ; The modulation is silencing TaTN3 of a gene that makes the wheat less resistant to stripe rust, overexpression TaTN3 of a gene that makes the wheat more resistant to stripe rust.

2. A method of increasing resistance to stripe rust in wheat, comprising, Including improving the genes in the wheat genome TaTN3 The expression level of the gene TaTN3 The nucleotide sequence is shown in SEQ ID No.

1.

3. A method of breeding a model wheat plant with reduced resistance to stripe rust, comprising, comprising inhibiting expression of a gene TaTN3 in a target wheat genome, or silencing a gene TaTN3 in the target wheat genome; the nucleotide sequence of the gene TaTN3 is shown as SEQ ID No. 1.

Images