Application of AFF1 gene in relieving DON toxicity

Abstract

The invention discloses an application of an AFF1 gene in relieving DON toxicity. According to the gRNA sequence provided by the invention, a C57BL / 6J mouse AFF1 gene can be knocked out by virtue of a CRISPR / Cas9 gene editing technology; the created AFF1 gene knockout mouse model can provide an ideal research model for researching the expression regulation mechanism of the AFF1 gene and related diseases; the AFF1 gene can be used as a potential resistance target of DON to be applied to DON exposure and research of molecular targeting drugs for relieving DON toxicity.

Description

TECHNICAL FIELD

[0001] The application relates to application of an AFF1 gene in relieving DON toxicity and belongs to the field of gene editing and animal model construction. BACKGROUND

[0002] The AFF1 gene belongs to the AF4 / FMR2 protein family, and the protein encoded by the gene plays a key role in transcription elongation regulation, chromatin remodeling and cell differentiation. AFF1 promotes the release of Poll II from the paused state, thereby activating transcription. Studies have shown that abnormal expression of the AFF1 gene is closely related to leukemia, neurodevelopmental disorders and immune system diseases. However, at present, the in-vivo research on the function of the AFF1 gene still lacks an efficient and stable animal model, which limits the exploration of the molecular mechanism and therapeutic targets. The CRISPR / Cas9 gene editing technology is an efficient genome editing tool developed in recent years, which can guide Cas9 nuclease to perform site-specific cleavage on the target gene through the design of specific sgRNA, induce DNA double-strand breaks, and then realize gene knockout, insertion or replacement through non-homologous end joining or homologous recombination repair. The construction of a gene knockout mouse by using the technology has the advantages of short cycle, high efficiency and strong targeting, and has become an important means of functional genomics research. Therefore, based on the CRISPR / Cas9 gene editing technology, establishing a stable and reliable AFF1 gene knockout mouse model has important scientific significance and application value for in-depth study of the biological function of the AFF1 gene and the prevention and treatment of related diseases.

[0003] Grains are often contaminated by fungi during growth, transportation and storage. The secondary metabolites produced by fungi, i.e. mycotoxins, not only cause food waste but also may harm human health. Vomitoxin (DON) is a secondary metabolite produced by fungi such as Fusarium, which causes intestinal damage and symptoms such as vomiting and anorexia after entering the body. High doses of DON can cause hemorrhagic diarrhea and immunosuppression, causing damage to the body. Therefore, exploring the toxicity mechanism of DON and elucidating the potential resistance targets of DON are of great significance for avoiding the toxic damage of DON and developing molecular targeted drugs for relieving the toxicity of DON. SUMMARY

[0004] The technical problem to be solved by the application is to provide application of an AFF1 gene in relieving DON toxicity.

[0005] Technical scheme: In order to solve the above technical problem, the application provides application of an AFF1 gene in preparing a drug for relieving DON toxicity.

[0006] The application also provides application of an AFF1 homozygous knockout model in preparing a drug for relieving DON toxicity.

[0007] The application also provides application of the AFF1 gene in preparation of a drug for improving DON resistance.

[0008] The application also provides application of the AFF1 homozygous knockout model in preparation of a drug for improving DON resistance.

[0009] The preparation method of the AFF1 homozygous knockout model comprises the following steps: knocking out the AFF1 gene by using a gRNA sequence through a CRISPR / Cas9 gene editing technology, obtaining gRNA / Cas9 protein, microinjecting into a mouse fertilized egg, and transplanting into a surrogate mother mouse oviduct, so that the AFF1 homozygous knockout model is obtained.

[0010] The nucleotide sequence of the gRNA is shown in SEQ ID NO. 1 and SEQ ID NO. 2.

[0011] Advantages: Compared with the prior art, the application has the following advantages: (1) the provided gRNA sequence can be used for knocking out the AFF1 gene of a C57BL / 6J mouse through a CRISPR / Cas9 gene editing technology; (2) the created AFF1 gene knockout mouse model can provide an ideal research model for studying the expression regulation mechanism of the AFF1 gene and related diseases; and the AFF1 gene can be used as a potential resistance target of DON and applied to research of DON exposure and a molecular targeted drug for relieving DON toxicity. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 It is a schematic diagram of the CRISPR / Cas9 gene editing technology of the application;

[0013] Figure 2 It is a diagram for karyotype identification of mouse DNA using primer 1 (left) and primer 2 (right) respectively;

[0014] Figure 3 It is detection of the expression level of mouse AFF1 protein;

[0015] Figure 4 It is a schematic diagram of a DON exposure test of a mouse;

[0016] Figure 5 It is monitoring of the growth traits of a mouse;

[0017] Figure 6 It is observation of the intestinal tissue morphology of a mouse;

[0018] Figure 7 It is detection of the apoptosis level of intestinal tissue of a mouse by Tunnel detection;

[0019] Figure 8 It is detection of the apoptosis protein of a mouse intestinal tract. DETAILED DESCRIPTION

[0020] The technical solutions of the present application are further described below with reference to the accompanying drawings.

[0021] 1. AFF1 gene information targeted in the present application:

[0022] The mouse AFF1 gene (Gene Bank accession number: NM_001080798.3) is on the positive strand of chromosome 5, with a full length of 8,323 bb, and a coding region of 979 bp. The mouse AFF1 gene has five transcripts, and the present application refers to the transcript 202 (ENSMUST00000054979.1) on the Ensembl website for the design of related experimental knockout of the gene.

[0023] 2. In the present application, the AFF1 gene of C57BL / 6J mice is edited by CRISPR / Cas9 gene editing technology, and the principle is as shown in Figure 1 . The exon 2 to exon 3 region is selected as the knockout target region, and the gRNA sequence is shown in Table 1. The gRNA / Cas9 protein is microinjected into the mouse zygote, and the microinjected zygote is transplanted into the oviduct of a surrogate mother mouse, and the resulting mouse is the F0 generation mouse.

[0024] Table 1 gRNA primer information of knockout mice

[0025] gRNA Sequence No. PAM Sequence gRNA-1 TGG TGCCTCAGTTGCTGGATCCC (SEQ ID NO. 1) gRNA-2 AGG CCTGGCTAACTGGAAGTCCG (SEQ ID NO. 2)

[0026] Example 1

[0027] The present embodiment provides a method for identifying a mouse model with specific knockout of the AFF1 gene.

[0028] 1. Collect samples from the tail of F0 mice, cut the collected tissues into small pieces, put them into centrifuge tubes, add lysis solution for lysis, use a full-automatic low-temperature grinding instrument, homogenize at 60 Hz for 60 s, interval 10 s, repeat homogenization 10 times. After the tissue is fully homogenized, use a DNA extraction kit (Vazyme, item number: DC112-02) to extract tissue DNA. The PCR primer information for karyotype verification is shown in Table 2. Mouse DNA is used as a template for PCR amplification, and the amplification system is: 1 μL of upstream and downstream primers, 10 μL of Taq MasterMix, 100 ng of DNA, and ddH2O to make up to 20 μL. The reaction program is: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, a total of 35 cycles; 72℃ extension for 5 min. The obtained product is detected by 1% agarose gel electrophoresis, and the result is as shown in Figure 2The band size of 3,140 bp is wild type (WT) and the band size of 371 bp is knockout (KO) for primer 1; the band size of 406 bp is wild type (WT) and the band size of 0 bp is knockout (KO) for primer 2. It is worth noting that for primer 1, if the band of WT is too large, it may not be detected.

[0029] Table 2. Primer information for karyotype verification of knockout mice

[0030]

[0031] 2. The expression of AFF1 protein in F0 generation of homozygous mice was verified by Western blot. The protein in mouse toe tissue was extracted, the protein concentration was determined by BCA method, and 5x non-denaturing protein loading buffer was added according to the protein concentration, and heated at 98℃ for 10 minutes. The protein content of 50 μg was used as the standard loading amount, and polyacrylamide gel electrophoresis (SDS PAGE) was carried out. The protein band was transferred to a 0.22 μm polyvinylidene fluoride membrane (PVDF) at 300 mA for 50 min. After blocking with 5% skim milk, the anti-AFF1 antibody (FineTest, product number: FNab00195) was incubated at 4℃ overnight. 1x TBST was used to wash 4 times on a decolorizing shaker for 5 min each time. The corresponding HRP-conjugated goat anti-rabbit IgG polyclonal antibody (Huabio, product number: HA1001) was incubated at room temperature for 1 h, and 1x TBST was used to wash 4 times on a decolorizing shaker for 5 min each time. The horseradish peroxidase catalyzed chemiluminescent substance was used for chemiluminescence. The results are shown in Figure 3 As shown in the figure, the AFF1 knockout group does not show a band, indicating that the complete knockout of the AFF1 gene in the mouse model provided by the technical solution is achieved.

[0032] 3. The AFF1 gene homozygous knockout mice were selected for propagation to obtain a sufficient number of F1 generation of homozygous mice, and the genotype verification method and protein level verification method were the same as those of F0 generation of mice.

[0033] Example 2

[0034] The present embodiment provides an application of an AFF1 knockout mouse model in DON exposure.

[0035] 1. Wild type C57BL / 6J mice and AFF1 homozygous knockout mice were used for DON challenge test. The test was divided into three groups, namely control group (Control) of corn oil by gavage, DON exposure group (DON) and AFF1 knockout group (DON+ko-AFF1), and the test process was as follows Figure 4The experiment lasted for 19 days. The mice were given 2 mg / kg DON by gavage at 9:00 am every day, and were allowed free access to food and water. In addition, the mice were given 12 h light every day, and the temperature was controlled at 22 ± 2°C and the humidity was controlled at 50 ± 10%. The changes in body weight and food intake of the mice were recorded during the experiment, and the results are shown in Table 1. Figure 5 As shown in Table 1, AFF1 knockout significantly improved the body weight loss caused by DON.

[0036] 2. A 1-2 cm section of mouse jejunum tissue was washed with pre-cooled PBS. The tissue was fixed with 4% paraformaldehyde at 4°C overnight. The tissue was dehydrated with a 30% sucrose solution at 4°C for 24 h. The dehydrated tissue was paraffin-embedded and fixed on a microtome, cut into 5 μm slices, and placed in a 37°C water bath for expansion. After being adsorbed on a glass slide, the slices were placed in a 37°C incubator overnight for drying. After the slices were stained with hematoxylin-eosin, they were dehydrated in 80%, 95%, and anhydrous ethanol for 5 min each. The slices were transparentized in xylene for 5 min each. After the slices were taken out of the xylene and dried, neutral balsam was added to the tissue, a cover glass was placed on top to prevent air bubbles. The slices were observed under an optical microscope, and the villus height and crypt depth of the intestinal tract were analyzed using Image J software. The results are shown in Table 2. Figure 6 As shown in Table 2, the villi of the intestinal tract of the DON group of mice showed significant structural disorder, with a decrease in villus height, and AFF1 knockout effectively reversed the pathological phenotype and restored the villus height of the intestinal tract.

[0037] 3. The sample preparation and slice processing method were the same as above. The slices were treated with 20 μg / mL proteinase K at room temperature for 15 min. The slices were treated with TUNEL equilibration solution and equilibrated at room temperature for 20 min. The TUNEL reaction solution was prepared on ice in the dark by mixing TdT enzyme and labeled dUTP in a certain proportion. The TUNEL reaction solution was added to the slices, covering the tissue, and incubated at 37°C in the dark for 60 min. The slices were washed with PBS for 3 times and then stained with DAPI. The slices were observed using a confocal microscope with an anti-fluorescence quenching mounting medium. The results are shown in Table 3. Figure 7 As shown in Table 3, compared with the Control group, the TUNEL highlighted increase in the jejunum tissue of the DON-treated group of mice indicated that apoptosis was significantly increased, and after AFF1 knockout, the abnormal apoptosis induced by DON was significantly inhibited.

[0038] 4. The expression levels of apoptosis proteins were detected by Western blotting, and the method was the same as in Example 1. The results are shown in Table 4. Figure 8 As shown in Table 4, knockout of AFF1 significantly reduced the expression levels of pro-apoptotic proteins Bax and Caspase 3, and increased the expression level of Bcl2, indicating that knockout of AFF1 alleviated the intestinal tissue apoptosis induced by DON.

Claims

1. Application of AFF1 gene in the preparation of drugs to alleviate DON toxicity.

2. Application of the AFF1 homozygous knockout model in the preparation of drugs to alleviate DON toxicity.

3. The application according to claim 1 or 2, characterized in that, This includes reducing the expression levels of pro-apoptotic proteins Bax and Caspase3, and increasing the expression level of Bcl2.

4. The application according to claim 2, characterized in that, The preparation method of the AFF1 homozygous knockout model includes the following steps: using gRNA sequence to knock out the AFF1 gene through CRISPR / Cas9 gene editing technology to obtain gRNA / Cas9 protein, microinjecting it into mouse fertilized eggs, and transplanting it into the fallopian tube of surrogate mother mice to obtain the AFF1 homozygous knockout model.

5. The application according to claim 4, characterized in that, The nucleotide sequence of the gRNA is shown in SEQ ID NO.1 and SEQ ID NO.

2.

6. Application of AFF1 gene in the preparation of drugs that enhance resistance to DON.

7. Application of the AFF1 homozygous knockout model in the preparation of drugs that enhance resistance to DON.

8. The application according to claim 7, characterized in that, The preparation method of the AFF1 homozygous knockout model includes the following steps: using gRNA sequence to knock out the AFF1 gene through CRISPR / Cas9 gene editing technology to obtain gRNA / Cas9 protein, microinjecting it into mouse fertilized eggs, and transplanting it into the fallopian tube of surrogate mother mice to obtain the AFF1 homozygous knockout model.

9. The application according to claim 7, characterized in that, The nucleotide sequence of the gRNA is shown in SEQ ID NO.1 and SEQ ID NO.2.

Images