Active peptide with hypoglycemic function as well as preparation method and application of active peptide
The bioactive peptides produced by fermentation of Bifidobacterium lactis subsp. B12 have solved the adverse reaction problem of traditional hypoglycemic drugs, achieving safe and effective blood glucose and blood lipid management, improving insulin sensitivity and intestinal flora imbalance in patients with type 2 diabetes, and showing significant hypoglycemic and lipid-lowering effects.
Patent Information
- Application Number
- CN202511408248.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-29
- Publication Date
- 2025-12-12
AI Technical Summary
Existing oral hypoglycemic drugs have adverse reactions such as hypoglycemia, gastrointestinal discomfort, and liver and kidney toxicity when used for a long time. Furthermore, traditional strategies are difficult to provide a safe and effective long-term hypoglycemic regimen. Intestinal flora imbalance in patients with type 2 diabetes makes blood glucose management difficult.
The bioactive peptides produced by fermentation of Bifidobacterium lactis subsp. B12 improve insulin sensitivity and regulate intestinal flora balance by inhibiting α-amylase and α-glucosidase. The peptides contain amino acid sequences such as SEQ ID NO:1 and SEQ ID NO:2, have a molecular weight of <3kDa, and are prepared by fermentation, freeze drying and other steps.
The bioactive peptides significantly inhibit α-amylase and α-glucosidase, improve insulin resistance, lower blood sugar, regulate insulin signaling pathways, and have significant hypoglycemic and lipid-lowering effects, while alleviating diabetes-related inflammation and liver damage.
Smart Images

Figure CN121108263A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of functional microbial application technology, specifically relating to an active peptide with hypoglycemic function, its preparation method, and its application. Background Technology
[0002] Type 2 diabetes mellitus (T2DM) is a chronic disease caused by insufficient insulin secretion or insulin resistance, leading to disordered glucose metabolism. In recent decades, due to genetic, environmental factors, and unhealthy lifestyle and dietary habits, T2DM and its complications have continued to rise globally, becoming a serious threat to human health. Traditional oral hypoglycemic agents (such as sulfonylureas, biguanides, and DPP-4 inhibitors) often cause adverse reactions such as hypoglycemia, gastrointestinal discomfort, and liver and kidney toxicity during long-term use. Therefore, developing safe, effective, and long-term usable novel hypoglycemic strategies is an urgent need.
[0003] In recent years, significant progress has been made in the application of probiotics in blood glucose management. Their hypoglycemic mechanism is mainly based on regulating the balance of gut microbiota. Studies have shown that gut microbiota dysbiosis is common in patients with type 2 diabetes, and probiotics can improve metabolism by increasing the number of beneficial bacteria (such as lactobacilli and bifidobacteria) and inhibiting the growth of harmful bacteria. Specific pathways include: (1) Improving insulin sensitivity: Probiotics and their metabolites (such as short-chain fatty acids) can reduce systemic low-grade inflammation, repair intestinal barrier function, reduce endotoxin entry into the blood, and thus enhance insulin signal transduction. (2) Inhibiting intestinal absorption of sugar: Some strains can delay carbohydrate digestion and reduce postprandial blood glucose fluctuations. (3) Regulating incretin secretion: Affecting the release of hormones such as GLP-1 and promoting insulin secretion. In the future, the application of probiotics in diabetes prevention and control will become more diversified. Summary of the Invention
[0004] The purpose of this invention is to provide an active peptide with hypoglycemic function, its preparation method, and its application.
[0005] To achieve the above-mentioned objectives, the following technical solution is adopted: This invention provides an active peptide derived from Bifidobacterium animalis subsp. lactis (… Bifidobacterium animalis subsp. lactis Produced by fermentation.
[0006] The aforementioned Bifidobacterium animalis subsp. lactis B12 was deposited on August 12, 2024, at the China General Microbiological Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 31656.
[0007] The molecular weight of the active peptide is <3kDa.
[0008] The active peptide comprises a polypeptide with an amino acid sequence as shown in SEQ ID NO:1.
[0009] The active peptide comprises a polypeptide with an amino acid sequence as shown in SEQ ID NO:2.
[0010] The preparation method of the active peptide includes the following steps: (1) Preparation of fermentation supernatant Bifidobacterium animalis subsp. lactis B12 was inoculated into MRS medium and cultured in an anaerobic incubator at 37°C for 30 h; centrifuged at 4000 rpm for 10 min to obtain the fermentation supernatant of Bifidobacterium animalis subsp. lactis B12. (2) Crude extraction and fractionation of bioactive peptides The fermentation supernatant of Bifidobacterium animalis subsp. lactis B12 was filtered through a 0.22 μm pore size filter. 65% saturated ammonium sulfate was slowly added to the supernatant, and the mixture was incubated overnight under cold conditions with continuous stirring. The supernatant was then centrifuged at 3500 rpm for 30 min at 4 °C to obtain a precipitate, which was the peptide extract. The peptide extract was recovered using a Tris-HCl buffer solution at pH 7.0, and desalted using a dialysis bag. Dialysis was performed overnight, and the crude active peptide extract was collected. The crude active peptide extract was fractionated using ultrafiltration to obtain an active peptide solution with a molecular weight <3 kDa. (3) Freeze-drying The active peptide solution with a molecular weight <3kDa is freeze-dried to prepare a freeze-dried powder, which is the active peptide described in this invention.
[0011] The concentration of the active peptide is not less than 2 mg / mL.
[0012] The present invention also provides the application of the said active peptide in the preparation of products with blood sugar lowering function.
[0013] The product is a health product or a medicine.
[0014] The present invention also provides the use of the said active peptide in the preparation of a medicine for treating diabetes.
[0015] Compared with the prior art, the beneficial effects of the present invention are reflected in: (1) This invention is the first to isolate an active peptide (molecular weight <3kDa) with hypoglycemic effect from the fermentation supernatant of Bifidobacterium animalis subsp. lactis B12 (CGMCC No. 31656). Its inhibition rates against α-amylase and α-glucosidase reached 46.69±1.33% and 55.13±2.95%, respectively. (2) The active peptides provided by the present invention have the effects of improving glucose metabolism, oxidative stress and activating the IRS / PI3K / AKT signaling pathway in insulin-resistant HepG2 cells; (3) The active peptides provided by this invention contain two peptide segments with strong inhibitory activity against α-amylase and α-glucosidase, with amino acid sequences of AGIGIGAIVMALFGM and VSGPDDWNGKLAAPLP, respectively. These two active peptide segments have a strong binding affinity to AKT1 protein and have the potential to regulate the insulin signaling pathway.
[0016] In summary, the bioactive peptides derived from Bifidobacterium animalis described in this invention have broad application prospects in health products and pharmaceuticals for regulating blood sugar. Attached Figure Description
[0017] Figure 1 A comparison chart of fasting blood glucose levels in mice from each group; Figure 2 A comparison chart of the serum levels of total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) in mice of different groups; where A represents total cholesterol (TC), B represents triglycerides (TG), C represents low-density lipoprotein cholesterol (LDL-C), and D represents high-density lipoprotein cholesterol (HDL-C). Figure 3 A comparison of the levels of interleukin-6 (IL-6) and interleukin-10 (IL-10) in the serum of mice in each group; where A represents interleukin-6 (IL-6) and B represents interleukin-10 (IL-10). Figure 4 A comparison chart of liver indices in mice from different groups; Figure 5 A comparative chart showing the levels of total cholesterol (TC), triglycerides (TG), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP) in the livers of mice in each group; where A represents total cholesterol (TC), B represents triglycerides (TG), C represents alanine aminotransferase (ALT), D represents aspartate aminotransferase (AST), and E represents alkaline phosphatase (ALP). Figure 6 HE staining images of mouse livers in each group; Figure 7 A comparison chart of the heart weight / body weight ratio of mice in each group; Figure 8 The graph shows the changes in fasting blood glucose in each group of mice; Figure 9 A comparison chart of insulin tolerance in mice of different groups; Figure 10A comparison of the levels of creatine kinase (CK), lactate dehydrogenase (LDH), and aspartate aminotransferase (AST) in the myocardium of mice in each group; where A represents creatine kinase, B represents lactate dehydrogenase, and C represents aspartate aminotransferase.
[0018] Figure 11 The effects of fermentation time, ammonium sulfate saturation and pH on the concentration of bioactive peptides of Bifidobacterium animalis subsp. lactis B12 were investigated. Figure 12 Conditional response surface methodology and contour plots for the extraction of bioactive peptides from Bifidobacterium lactis subsp. B12; Figure 13 Determination of the inhibitory capacity of Bifidobacterium lactis subsp. B12 active peptides on α-amylase and α-glucosidase; Figure 14 The effect of Bifidobacterium lactis subsp. B12 bioactive peptide on glucose consumption in insulin-resistant HepG2 cells; Figure 15 The effect of Bifidobacterium lactis subsp. B12 bioactive peptides on the activity of HK (hexokinase) and PK (pyruvate kinase) in insulin-resistant HepG2 cells; Figure 16 The effects of Bifidobacterium lactis subsp. B12 bioactive peptides on CAT (catalase) activity, MDA (malondialdehyde) content and SOD (superoxide dismutase) activity in insulin-resistant HepG2 cells; Figure 17 The effect of Bifidobacterium lactis subsp. B12 bioactive peptides on the activities of ALT (alanine aminotransferase) and AST (aspartate aminotransferase) in insulin-resistant HepG2 cells. Figure 18 The effect of bioactive peptides from Bifidobacterium lactis subsp. B12 on the expression levels of genes related to the IRS / PI3K / AKT signaling pathway in insulin-resistant HepG2 cells; Figure 19 Molecular docking diagram of the AM-1 active peptide fragment of Bifidobacterium lactis subsp. B12 and AKT1 protein; Figure 20 This is a molecular docking diagram of the active peptide fragment VP-9 of Bifidobacterium lactis subsp. B12 and the AKT1 protein. Detailed Implementation
[0019] The technical solution of the present invention will be described more comprehensively below through specific embodiments. The following embodiments are for illustrative purposes only and are not intended to limit the present invention. In addition, unless otherwise specified, methods without specific conditions or steps are conventional methods, and the reagents and materials used are commercially available.
[0020] Example 1: Screening, identification and functional evaluation of Bifidobacterium animalis subsp. lactis B12 This invention screened a lactic acid bacterium with a significant hypoglycemic effect from the feces of healthy infants and young children. It was identified as Bifidobacterium animalis subsp. lactis and named Bifidobacterium animalis subsp. lactis B12. It was deposited at the China General Microbiological Culture Collection Center on August 12, 2024, at Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 31656.
[0021] Bifidobacterium animalis subsp. lactis B12 inhibited α-amylase and α-glucosidase by 89.50 ± 3.31% and 31.25 ± 0.94%, respectively.
[0022] Bifidobacterium animalis subsp. lactis B12 showed strong survival ability in simulated gastrointestinal fluid, with a viability rate exceeding 100% after 3 hours of treatment. This indicates that the strain has strong acid and bile salt resistance and can effectively resist the influence of gastrointestinal fluid.
[0023] Bifidobacterium animalis subsp. lactis B12 has strong antioxidant capacity. Both its bacterial suspension and fermentation supernatant can effectively scavenge DPPH free radicals, ABTS free radicals, and superoxide anion free radicals. In particular, the scavenging rates of DPPH free radicals, ABTS free radicals, and superoxide anion free radicals in the fermentation supernatant of Bifidobacterium animalis subsp. lactis B12 are as high as 96.76±1.46%, 95.14±2.38%, and 83.06±0.94%, respectively.
[0024] Bifidobacterium animalis subsp. lactis B12 has a strong reducing ability, with the reducing power of its fermentation supernatant and bacterial suspension reaching 74.82±0.20% and 38.06±0.39%, respectively.
[0025] Example 2: Application of Bifidobacterium animalis subsp. lactis B12 in improving the health status of diabetic mice 1. Preparation of bacterial suspension Bifidobacterium animalis subsp. lactis B12 was inoculated into MRS liquid medium and anaerobically cultured at 37°C for 24 h. After centrifugation at 5000 r / min, 4°C for 10 min, the supernatant was discarded, and the bacterial pellet was obtained. The bacterial pellet was then resuspended in sterile physiological saline. Based on its OD... 600nm Based on absorbance and plate count results, adjust the bacterial count to 1×10⁻⁶. 9 CFU / mL bacterial suspension.
[0026] 2. Establishment and grouping of diabetes models Male 6-8 week old KKAy and C57BL / 6J mice were acclimatized for 1 week with free access to water and food. KKAy mice were fed a high-fat, high-protein diet, while C57BL / 6J mice were fed a normal diet.
[0027] Mice were divided into four groups: blank control group (NC), model group (DM), positive control group (MET), and Bifidobacterium lactis subsp. B12 group (B12), with 8 mice in each group. The positive control group was given metformin 200 mg / kg, and the Bifidobacterium lactis subsp. B12 group was given 1×10⁻⁶ mg / kg. 9 The mice were given a bacterial suspension of CFU, while the other two groups received an equal volume of sterile saline. All mice received the intervention once daily at the same time for 5 weeks.
[0028] 1. Fasting blood glucose test The fasting blood glucose levels of mice at week 5 were measured as follows: Figure 1 The model group mice showed a significant increase in fasting blood glucose levels. Compared with the model group, Bifidobacterium animalis subsp. lactis B12 significantly reduced fasting blood glucose levels. These results indicate that Bifidobacterium animalis subsp. lactis B12 has a preliminary ameliorative effect on diabetes.
[0029] 2. Blood lipid test Blood was collected from mouse eyeballs and allowed to stand at room temperature for 60 min, then centrifuged at 3000 r / min for 10 min. The supernatant was collected, aliquoted into centrifuge tubes, and stored at -80℃. The serum levels of total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) were determined according to the kit instructions.
[0030] Figure 2 A shows the effect of *Bifidobacterium lactis* subsp. B12 on serum total cholesterol (TC) in diabetic mice. Compared with the control group, the TC content in the model group was significantly increased (P<0.05). After intervention with *Bifidobacterium lactis* subsp. B12, the serum total cholesterol content in diabetic mice decreased significantly, indicating that *Bifidobacterium lactis* subsp. B12 has a good cholesterol-lowering effect.
[0031] Figure 2 B represents the effect of *Bifidobacterium lactis* subsp. B12 on serum triglyceride (TG) levels in diabetic mice. Compared with the control group, the TG levels in the model group were significantly increased (P<0.05). After intervention with *Bifidobacterium lactis* subsp. B12, the serum triglyceride levels in diabetic mice significantly decreased, indicating that *Bifidobacterium lactis* subsp. B12 has a good triglyceride-lowering effect.
[0032] Figure 2C represents the effect of *Bifidobacterium lactis* subsp. B12 on serum low-density lipoprotein cholesterol (LDL-C) in diabetic mice. Compared with the control group, the LDL-C level in diabetic mice was significantly increased (P<0.05), while the serum LDL-C level in the *Bifidobacterium lactis* subsp. B12 group was significantly decreased, indicating that *Bifidobacterium lactis* subsp. B12 can significantly reduce LDL-C levels in diabetic mice.
[0033] Figure 2 D represents the effect of Bifidobacterium animalis subsp. lactis B12 on serum high-density lipoprotein cholesterol (HDL-C) in diabetic mice. Compared with the control group, the HDL-C level in diabetic mice was significantly decreased (P<0.05), while the serum HDL-C level in the Bifidobacterium animalis subsp. lactis B12 group was significantly increased (P<0.05).
[0034] The above results indicate that Bifidobacterium animalis subsp. lactis B12 can significantly reduce serum total cholesterol, triglycerides, and low-density lipoprotein levels in diabetic mice, while increasing serum high-density lipoprotein levels, demonstrating a good lipid-lowering effect.
[0035] 3. Detection of serum IL-6 and IL-10 levels Blood was collected from mouse eyeballs and allowed to stand at room temperature for 60 min, then centrifuged at 3000 r / min for 10 min. The supernatant was collected, aliquoted into centrifuge tubes, and stored at -80℃. Serum IL-6 and IL-10 levels were determined according to the kit instructions.
[0036] Figure 3 A shows the effect of Bifidobacterium lactis subsp. B12 on serum interleukin-6 (IL-6) in diabetic mice. Compared with the control group, the IL-6 level in the model group was significantly increased (P<0.05). After intervention with Bifidobacterium lactis subsp. B12, the serum IL-6 level in diabetic mice decreased significantly, second only to the positive control group.
[0037] Figure 3 B represents the effect of *Bifidobacterium lactis* subsp. B12 on serum interleukin-10 (IL-10) in diabetic mice. Compared with the control group, the IL-10 level in the model group was significantly decreased (P<0.05). After intervention with *Bifidobacterium lactis* subsp. B12, the serum IL-10 level in diabetic mice was significantly increased.
[0038] The above results indicate that Bifidobacterium animalis subsp. lactis B12 has the effect of significantly reducing the pro-inflammatory factor IL-6 and significantly increasing the anti-inflammatory factor IL-10. It can alleviate diabetes-related inflammatory damage by regulating the levels of inflammatory factors.
[0039] 4. Liver function test After collecting blood from the mouse eyeballs, the mouse liver was collected, weighed, and the levels of total cholesterol (TC), triglycerides (TG), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP) in the liver were determined according to the kit instructions.
[0040] Figure 4 This study investigated the effect of Bifidobacterium animalis subsp. lactis B12 on liver indices in diabetic mice. Measuring liver indices allows for the determination of liver size and assessment of its physiological state, which is significant for studying liver function and disease mechanisms in mice. Compared to the control group, the liver indices in the model group were significantly elevated. Intervention with Bifidobacterium animalis subsp. lactis B12 significantly improved liver indices, and the beneficial effect was not significantly different from that in the metformin group.
[0041] Figure 5 A shows the effect of *Bifidobacterium lactis* subsp. B12 on total cholesterol (TC) in the liver of diabetic mice. Compared with the control group, the TC content in the model group was significantly increased (P<0.05). After intervention with *Bifidobacterium lactis* subsp. B12, the TC content in the liver of diabetic mice decreased significantly and was comparable to that in the positive control group, indicating that *Bifidobacterium lactis* subsp. B12 has a good TC-lowering effect.
[0042] Figure 5 B represents the effect of *Bifidobacterium lactis* subsp. B12 on liver triglyceride (TG) levels in diabetic mice. Compared with the control group, the TG content in the model group was significantly increased (P<0.05). After intervention with *Bifidobacterium lactis* subsp. B12, the liver TG content in diabetic mice decreased significantly and was comparable to that in the positive control group, indicating that *Bifidobacterium lactis* subsp. B12 can significantly reduce TG content in diabetic mice.
[0043] Alanine aminotransferase (ALT) is mainly distributed in the cytoplasm of hepatocytes, and elevated ALT reflects damage to the hepatocyte membrane; aspartate aminotransferase (AST) is mainly distributed in the cytoplasm and mitochondria of hepatocytes, and its elevation suggests that hepatocyte damage has reached the organelle level. Figure 5 C represents the effect of *Bifidobacterium lactis* subsp. B12 on hepatic alanine aminotransferase (ALT) in diabetic mice. Compared with the control group, the ALT level in the model group was significantly increased (P<0.05). After intervention with *Bifidobacterium lactis* subsp. B12, the ALT level in the liver of diabetic mice significantly decreased. Figure 5 D represents the effect of *Bifidobacterium lactis* subsp. B12 on liver aspartate aminotransferase (AST) in diabetic mice. Compared with the control group, the AST content in the model group was significantly increased (P<0.05). Intervention with *Bifidobacterium lactis* subsp. B12 significantly reduced liver AST content in diabetic mice, indicating that *Bifidobacterium lactis* subsp. B12 can significantly alleviate liver damage.
[0044] Alkaline phosphatase (ALP) in the liver is used to assess liver health. Figure 5 E represents the effect of *Bifidobacterium lactis* subsp. B12 on hepatic ALP in diabetic mice. Compared to the control group, the model group showed significantly elevated ALP levels. Intervention with *Bifidobacterium lactis* subsp. B12 significantly alleviated ALP levels in the mouse liver.
[0045] The above results indicate that Bifidobacterium animalis subsp. lactis B12 can alleviate diabetic liver damage by reducing the levels of total cholesterol, triglycerides, alanine aminotransferase, aspartate aminotransferase, and alkaline phosphatase in the liver of mice.
[0046] 5. Liver tissue damage detection Mice were fasted for 12 hours but allowed free access to water. Blood was collected from their eyeballs, and they died from cervical dislocation. Liver sections were prepared, stained with hematoxylin and eosin (HE), and observed under a light microscope for morphological examination and photographing. Pathological evaluation was then performed. The specific steps are as follows: (1) Tissue fixation: Mouse liver tissue was fixed in 4% paraformaldehyde solution for about 36 h.
[0047] (2) Trimming and washing: Trim the fixed tissue into small squares and rinse with running water overnight.
[0048] (3) Dehydration: Take out the rinsed tissue block and dehydrate it with 70%, 80%, 85%, 90%, 95%, 100% I, and 100% II ethanol in sequence for 1 h, 1 h, 1 h, 1 h, 0.5 h and 0.5 h respectively.
[0049] (4) To make it clear: Mix 1 / 2 pure alcohol and 1 / 2 xylene for 10 min, xylene I for 10 min, xylene II for 10 min (until it becomes clear). (5) Wax impregnation: The wax impregnation is carried out twice, soaking in soft wax and hard wax for 1.5 h respectively.
[0050] (6) Embedding: The paraffin-impregnated tissue is embedded using an embedding machine.
[0051] (7) Sectioning: Correct the paraffin block, clamp the paraffin block with the mold on the microtome, start with coarse cutting (20 μm), and switch to fine cutting (5 μm) after cutting into the tissue.
[0052] (8) Mounting, spreading and baking: Spread the cut tissue slices flat in the water tank of the biological tissue baking machine (about 40°C), use a glass slide to pick up the wax slide, gently shake off the water droplets on the glass slide, and place it on the baking machine to bake until the surface is dry and water-free.
[0053] (9) Dewaxing: Treat with xylene I and xylene II for 10 min and 8 min respectively.
[0054] (10) Rehydration: After treatment with anhydrous ethanol I and anhydrous ethanol II for 3 min in sequence, treatment with 95%, 90%, 80%, 70%, 60% and 50% ethanol for 5 min in sequence.
[0055] (11) Hematoxylin staining: Wash twice with distilled water (5 min each time), then stain with hematoxylin for 8 min.
[0056] (12) Decolorization and blueing: Wash twice, 5 min each time; after immersing the slices in 1% hydrochloric acid alcohol solution for 2 to 5 s to decolorize, quickly transfer the slices to PBS for blueing for 5 min.
[0057] (13) Eosin staining: Wash twice with distilled water (5 min each time), then stain with eosin for 3 min.
[0058] (14) Dehydration and mounting: Soak in 75%, 85%, 95%, 100% I and 100% II for 5 min in sequence; then soak in xylene I and xylene II for 5 min; remove the slide and mount with neutral resin.
[0059] (15) Microscopic examination: use an automatic slice scanner to take pictures and scan.
[0060] From the experimental results Figure 6 It can be seen that the hepatocytes of normal mice are neatly arranged, radiating outward from the central vein to form hepatic plates, with clear and orderly hepatocyte cords and no vacuoles. In the model group, the number of hepatocytes is reduced, the arrangement is loose, vacuoles appear inside and between cells, and the cell nuclei are displaced. Compared with the model group, the hepatocyte arrangement of Bifidobacterium lactis subsp. B12 group is improved and the number of vacuoles is reduced, indicating that Bifidobacterium lactis subsp. B12 has a certain protective effect on the liver.
[0061] In summary, the Bifidobacterium lactis subsp. B12 provided by this invention can effectively reduce blood glucose and blood lipid levels in diabetic mice, alleviate diabetes-related inflammatory damage and liver damage, and achieve unexpected technical effects.
[0062] Example 3: Application of Bifidobacterium lactis subsp. B12 in improving the health status of diabetic cardiomyopathy mice 1. Preparation of bacterial suspension Bifidobacterium animalis subsp. lactis B12 was inoculated into MRS liquid medium and cultured anaerobically at 37°C for 24 h. After centrifugation at 5000 r / min for 10 min at 4°C, the supernatant was discarded, and the bacterial cells were suspended in sterile physiological saline. The suspension was then determined based on its OD value.600nm Based on absorbance and plate count results, adjust the bacterial count to 1×10⁻⁶. 9 CFU / mL bacterial suspension.
[0063] 2. Establishment and grouping of a diabetic cardiomyopathy model Male 6-8 week old KKAy and C57BL / 6J mice were acclimatized for 1 week with free access to water and food. KKAy mice were fed a high-fat, high-protein diet, while C57BL / 6J mice were fed a normal diet.
[0064] Mice were randomly divided into four groups: blank control group (NC), model group (DM), positive control group (MET), and Bifidobacterium animalis subsp. lactis B12 group (B12), with 8 mice in each group. The positive control group (MET) was given metformin 200 mg / kg, and the Bifidobacterium animalis subsp. lactis B12 group (B12) was given 1×10 9 The mice were given a bacterial suspension of CFU, while the other two groups received an equal volume of sterile saline. All mice received the intervention once daily at the same time for 5 weeks.
[0065] 1. Heart weight / body weight measurement Heart weight / body weight (CW / BW) can reflect the condition of pathological myocardial hypertrophy. For example... Figure 7 As shown, the CW / BW ratio of mice in the blank control group was 3.26±0.21 mg / g, while that in the model group was 6.67±0.79 mg / g. Compared with the normal control group, the CW / BW ratio of the model group was significantly higher. The CW / BW ratio of mice treated with Bifidobacterium lactis subsp. B12 was 4.86±0.16 mg / g, a decrease of 27.14% compared to the model group, significantly improving the pathological condition of myocardial hypertrophy in diabetic cardiomyopathy mice, indicating that Bifidobacterium lactis subsp. B12 has the ability to alleviate diabetic cardiomyopathy.
[0066] 2. Fasting blood glucose test Fasting blood glucose in mice was measured weekly at the same time: Mice were fasted overnight for 8 hours, and their tails were gently rubbed to engorge the blood vessels. Blood was collected by tail clipping and a blood glucose meter was used to measure fasting blood glucose. During measurement, the first drop of blood was discarded, and the second drop was used to measure blood glucose. The process was gentle to avoid causing stress-induced hyperglycemia.
[0067] Fasting blood glucose level such as Figure 8 As shown in the figure, the fasting blood glucose level in the model group was significantly higher than that in the control group. Compared with the model group, the fasting blood glucose level in the Bifidobacterium animalis subsp. lactis B12 group was lower than that in the model group throughout the intervention period. The results indicate that Bifidobacterium animalis subsp. lactis B12 has a mitigating effect on hyperglycemia in diabetic cardiomyopathy and can significantly reduce its fasting blood glucose level.
[0068] 3. Insulin tolerance test The insulin tolerance test (ITT) is used to measure insulin resistance or decreased insulin sensitivity. Mice are fasted for 8 hours with their bedding changed, but are allowed free access to water during this period. The tails are disinfected with alcohol, and the tail tips are cut off with sterilized scissors. The first drop of blood is discarded, and blood glucose levels are measured using a Sinocare blood glucose meter and test strips. The blood glucose value is recorded as 0 min. Mice are then injected intraperitoneally with insulin (0.65 U / kg body weight). Timing begins immediately after insulin injection, and blood glucose levels are measured and recorded at 30 min, 60 min, 90 min, and 120 min (Note: a blood glucose level above the upper limit of the blood glucose meter, 33.3 mmol / L, is recorded as 33.3 mmol / L).
[0069] Depend on Figure 9 It was found that after fasting insulin injection in mice, the blood glucose level in the blank group dropped to its lowest point at 30 minutes, then slowly rose to return to normal levels. In contrast, the blood glucose level in the model group dropped rapidly after insulin administration and failed to return to its original level after 120 minutes, indicating impaired insulin sensitivity in diabetic mice. Compared to the model group, the overall blood glucose level in the Bifidobacterium animalis subsp. lactis B12 group was lower than that in the model group, and the blood glucose level decreased slowly, approaching its original level after 90 minutes. This suggests that Bifidobacterium animalis subsp. lactis B12 has a certain effect on alleviating insulin resistance.
[0070] 4. Detection of myocardial three enzyme levels The three myocardial enzymes LDH (lactate dehydrogenase), CK (creatine kinase), and AST (aspartate aminotransferase) were measured according to the kit instructions. Peripheral venous blood was drawn from experimental animals, and serum or plasma was separated as the test samples, ensuring the samples were uncontaminated. The test samples were added to the corresponding wells of the ELISA plate, followed by the corresponding reaction solution, and gently mixed. The reaction was allowed to proceed fully at the set temperature and time. The absorbance and fluorescence intensity changes of the reaction solution were measured at a specific wavelength using an ELISA reader. Finally, the measured absorbance or fluorescence intensity changes were converted into the corresponding enzyme activity units.
[0071] Myocardial three enzymes can reflect the degree of damage to myocardial cells and are important indicators for assessing cardiomyopathy. Figure 10 The results showed that Bifidobacterium lactis subsp. B12 was used to inhibit creatine kinase in diabetic cardiomyopathy mice. Figure 10 A) Lactate dehydrogenase ( Figure 10 B) and aspartate aminotransferase ( Figure 10C) Effects on levels. All three indicators showed that the levels of myocardial three enzymes were significantly higher in the model group mice compared to the control group mice, while the intervention of Bifidobacterium lactis subsp. B12 significantly alleviated the levels of myocardial three enzymes, demonstrating that Bifidobacterium lactis subsp. B12 has the ability to alleviate diabetic cardiomyopathy.
[0072] In summary, the Bifidobacterium lactis subsp. B12 provided by this invention can significantly improve the pathological condition of myocardial hypertrophy in diabetic cardiomyopathy mice, reduce their fasting blood glucose levels, alleviate insulin resistance, and has the ability to alleviate diabetic cardiomyopathy.
[0073] Example 4: Culture of Bifidobacterium animalis subsp. lactis B12 and preparation of fermentation supernatant Take Bifidobacterium animalis subsp. lactis B12 stored at -80℃, inoculate it into MRS medium, and incubate it in an anaerobic incubator at 37℃ for 18-30 h; centrifuge at 4000 rpm for 10 min, and transfer the fermentation supernatant to a sterile centrifuge tube to obtain the fermentation supernatant of Bifidobacterium animalis subsp. lactis B12.
[0074] The culture medium preparations involved in the examples are as follows: MRS medium (g / L): 10g tryptone, 10g beef extract, 5g yeast extract, 20g glucose, 2g anhydrous sodium acetate, 0.5g magnesium sulfate heptahydrate, 0.25g manganese sulfate monohydrate, 2g diammonium citrate, 2g dipotassium hydrogen phosphate trihydrate, 1mL Tween-80, 0.5g L-cysteine hydrochloride, dissolved in 1L distilled water, and adjusted to pH 6.7±0.2. The medium must be autoclaved at 121℃ for 20 min before use.
[0075] Example 5: Crude extraction and separation of bioactive peptides from Bifidobacterium lactis subsp. B12 1. Crude extraction and separation of bioactive peptides from fermentation supernatant The fermentation supernatant of *Bifidobacterium animalis* subsp. *lactam* B12 collected in Example 1 was filtered through a 0.22 μm pore size filter. The pH was adjusted, and a certain degree of ammonium sulfate saturation was added. The mixture was incubated overnight under refrigeration with constant stirring. Centrifugation was performed at 3500 rpm for 30 min at 4°C. The peptide extract was recovered using Tris-HCl buffer (pH 7.0), desalted using a dialysis bag, and dialyzed overnight to collect the active peptide solution.
[0076] 2. Single-factor experiment Using the concentration of active peptides as the detection index, the effects of fermentation time, ammonium sulfate saturation and pH value on the yield of active peptides were investigated, and the concentration of active peptides in the samples was determined by the BCA method.
[0077] (1) Effect of fermentation time on the yield of bioactive peptides Fermentation times for *Bifidobacterium animalis* subsp. *lactamase* B12 were set at 12 h, 18 h, 24 h, 30 h, and 36 h. Extraction conditions were fixed at 65% ammonium sulfate saturation and pH 7.0. The concentration of active peptides was measured to determine the effect of fermentation time on the yield of active peptides. Figure 11 As shown in Figure A, the concentration of extracted active peptides gradually increases when the fermentation time is between 12 h and 30 h, and decreases after 30 h. Therefore, a fermentation time of 30 h is selected as the optimal extraction condition.
[0078] (2) Effect of ammonium sulfate saturation on the yield of bioactive peptides The ammonium sulfate saturation was set at 55%, 60%, 65%, 70%, and 75%, with a fixed fermentation time of 24 h and a pH of 7.0. The concentration of active peptides was measured to determine the effect of ammonium sulfate saturation on the yield of active peptides. Figure 11 As shown in Figure B, the concentration of active peptides was lowest when the ammonium sulfate saturation was 55%. Increasing the amount of ammonium sulfate resulted in the highest concentration of active peptides at a saturation of 65%. As the saturation continued to increase, the concentration of active peptides gradually decreased. Therefore, an ammonium sulfate saturation of 65% was selected as the optimal extraction condition.
[0079] (3) Effect of pH value on the yield of bioactive peptides The pH values were set to 5.0, 6.0, 7.0, 8.0, and 9.0, with a fixed fermentation time of 24 h and an ammonium sulfate saturation of 65%. The concentration of active peptides was measured to determine the effect of pH value on the yield of active peptides. Figure 11 As shown in Figure C, pH affects the extraction rate of bioactive peptides. The concentration of bioactive peptides is lowest at pH 5.0 and 9.0, and the concentration increases as the pH approaches neutral, reaching its highest at pH 7.0. Therefore, pH 7.0 is selected as the optimal extraction condition.
[0080] 3. Response surface optimization experiment Based on the single-factor experiments described above, a Box-Behnken central composite experimental design was conducted using Design-Expert 13 software. Fermentation time (A), ammonium sulfate saturation (B), and pH (C) were set to three levels: high (+1), medium (0), and low (-1), respectively. The evaluation index was the yield of bioactive peptides. The factor level table is shown in Table 1. The Box-Behnken experimental results are shown in Table 2. The analysis of variance for the response surface methodology results is shown in Table 3.
[0081] Table 1 Response Surface Factor Level Table
[0082] Table 2 Results of the Box-Behnken test Test No. A: Fermentation time (h) B: Ammonium sulfate saturation (%) C: pH value Y: Active peptide concentration (mg / mL) 1 0 -1 1 1.983 2 0 -1 -1 2.131 3 -1 1 0 1.402 4 0 0 0 2.483 5 -1 -1 0 1.282 6 1 -1 0 1.427 7 1 0 1 1.658 8 -1 0 1 1.279 9 1 1 0 1.427 10 0 0 0 2.435 11 0 0 0 2.598 12 1 0 -1 1.638 13 0 1 -1 2.065 14 0 1 1 1.896 15 -1 0 -1 1.472 16 0 0 0 2.413 17 0 0 0 2.672 Table 3. Analysis of variance of response surface methodology results project sum of squares Degrees of freedom Mean Square F value p-value Significance Model 3.754574 9 0.417175 37.09774 <0.0001 ** A-Fermentation time 0.063903 1 0.063903 5.682655 0.0486 * β-Ammonium sulfate saturation 0.000136 1 0.000136 0.012105 0.9155 C-pH value 0.030013 1 0.030013 2.668894 0.1463 AB 0.0036 1 0.0036 0.320134 0.5892 AC 0.011342 1 0.011342 1.008622 0.3487 BC 0.00011 1 0.00011 0.009804 0.9239 <![CDATA[A 2 ]]> 2.840488 1 2.840488 252.5935 <0.0001 ** <![CDATA[B 2 ]]> 0.416067 1 0.416067 36.99922 0.0005 ** <![CDATA[C 2 ]]> 0.147395 1 0.147395 13.1073 0.0085 ** residual 0.078717 7 0.011245 Missing item 0.029486 3 0.009829 0.798585 0.555668 Not significant Pure error 0.049231 4 0.012308 sum 3.833292 16 Note: *Significant ( p <0.05); **Highly significant ( p <0.01) Table 3 shows that the F-value of the response surface model is 37.09774, and the P-value is <0.0001, proving that the model is highly significant (p<0.05). 2 B 2 C 2 The term with the highest significance (p < 0.01) is the model term. The F-value for the lack-of-fit term is 0.798585, and the P-value is 0.555668, indicating that the lack-of-fit term is not significant and the model is reasonably constructed. Predicted R 2 The R² value is 0.8569, and the Adjusted R² value is 0.9531. The difference is less than 0.2, which proves that the model can make good predictions and analyses.
[0083] Multiple regression analysis was performed on the concentration measurements of 17 groups of active peptides. The regression equation is as follows: Y=2.52+0.0894A-0.0041B-0.0612C-0.0300AB+0.0533AC-0.0053BC-0.8214A 2 -0.3144B 2 -0.1871C 2 In the formula: Y is the predicted response value of active peptide concentration; A is the coded value of fermentation time; B is the coded value of ammonium sulfate saturation; and C is the coded value of pH.
[0084] Based on the above regression equation, response surface analysis plots and contour plots can be drawn, such as... Figure 12 As shown in the figure. According to model prediction, the optimal extraction conditions for bioactive peptides are a fermentation time of 30.295 h, an ammonium sulfate saturation of 64.965%, and a pH of 6.843. Under these conditions, the predicted bioactive peptide extraction concentration is 2.527 mg / mL.
[0085] Validation experiments were conducted based on the optimal extraction conditions optimized by response surface methodology. Under these conditions, the concentration of the active peptide was determined to be 2.494 mg / mL, which is close to the predicted result, demonstrating that the model was well-established and the conditions were reliable.
[0086] Example 6: Fractionation and isolation of bioactive peptides from Bifidobacterium animalis subsp. lactis B12 Ultrafiltration was used to fractionate the bioactive peptide samples obtained after response surface methodology-optimized extraction conditions, separating bioactive peptides with molecular weights <3kDa and >3kDa. The unfractionated and fractionated bioactive peptide samples were freeze-dried separately to prepare lyophilized powders, which were stored at -80°C. A 1 mg / mL solution of the bioactive peptide samples was prepared using sterile PBS buffer, and the inhibition rates of α-amylase and α-glucosidase were measured to screen for the peptide range with the optimal hypoglycemic effect.
[0087] Depend on Figure 13 As shown in A, compared with the unfractionated intact bioactive peptide samples, the bioactive peptide samples with a molecular weight <3kDa showed a slightly higher inhibition rate against α-amylase, reaching 46.69±1.33%; while the bioactive peptide samples with a molecular weight >3kDa showed a significantly lower inhibition rate against α-amylase. p <0.05).
[0088] Depend on Figure 13 As shown in B, the unfractionated intact active peptide samples showed the highest inhibition rate against α-glucosidase, at 58.83±1.51%, followed by active peptide samples with a molecular weight <3kDa, at 55.13±2.95%, while active peptide samples with a molecular weight >3kDa showed the lowest inhibition rate, at 10.32±1.72%.
[0089] The results above indicate that the bioactive peptides with a molecular weight <3kDa produced by fermentation of Bifidobacterium animalis subsp. lactis B12 mainly play a role in lowering blood sugar.
[0090] Example 7: Effects of Bifidobacterium animalis subsp. lactis B12 bioactive peptides on glucose metabolism and oxidative stress in insulin-resistant HepG2 cells. 1. Effect of insulin concentration on HepG2 cell viability HepG2 cells were cultured at 37°C and 5% CO2 for 24 h, and then... 5 Cells were seeded at a density of 100 cells / mL in 96-well plates and cultured until a monolayer adhered. Cells were divided into three groups: a zero-cell group (cell-free, serum-free medium), a control group (serum-free medium), and an experimental group (medium-contained insulin at a concentration of 10 mg / mL). -5 10 -6 10 -7 10 -8Cells were cultured in serum-free medium (5% mol / L) with 6 wells per group. After 24 h of incubation at 37℃ in a 5% CO2 incubator, 10 μL of 5 mg / mL MTT was added to each well, and incubation continued for 4 h. The supernatant was discarded, and the cells were washed twice with PBS. 100 μL of DMSO was added to each well to terminate the culture. After shaking for 10 min, the absorbance at 570 nm was read using a microplate reader. Cell viability was calculated; the closer the value is to 100%, the less damage insulin causes to cells. The formula for calculating cell viability is as follows: Cell viability (%) = 100 × (A2 - A0) / (A1 - A0).
[0091] In the formula: A0 is the zeroing group, A1 is the control group, and A2 is the experimental group.
[0092] 2. Effect of insulin concentration on glucose consumption in HepG2 cells The cultured cells were then cultured at a ratio of 10 × 10 5 Cells were seeded at a density of 100 cells / mL in 24-well plates and cultured until approximately 80% confluence. The supernatant was discarded, and the cells were washed twice with PBS. Samples were then added according to the assigned groups: blank group (cell-free, serum-free medium), control group (serum-free medium), and experimental group (containing insulin at a concentration of 10...). -5 10 -6 10 -7 10 -8 Serum-free medium (mol / L). Six wells per group. After incubation, the supernatant was collected, and the glucose content in the supernatant was determined using a glucose kit. The glucose consumption was calculated. Lower consumption indicates stronger insulin resistance. The formula for calculating glucose consumption is as follows: Glucose consumption (mmol / g prot) = A0 - A1.
[0093] In the formula: A0 is the glucose content in the supernatant of the blank group; A1 is the glucose content in the supernatant of the control group or the experimental group.
[0094] Table 4. Effects of insulin concentration on cell viability and glucose consumption. Insulin concentration (mol / L) control group <![CDATA[10 -5 ]]> <![CDATA[10 -6 ]]> <![CDATA[10 -7 ]]> <![CDATA[10 -8 ]]> Cell viability (%) <![CDATA[100.00±1.05 c ]]> <![CDATA[79.35±0.54 d ]]> <![CDATA[100.45±1.94 c ]]> <![CDATA[105.55±2.55 b ]]> <![CDATA[112.19±2.18 a ]]> Glucose consumption (mmol / g prot) <![CDATA[6.5572±0.1572 a ]]> <![CDATA[4.3678±0.2247 c ]]> <![CDATA[4.5467±0.2621 c ]]> <![CDATA[5.8962±0.0836 b ]]> <![CDATA[6.0266±0.3422 b ]]> As shown in Table 4, after 24 hours of culture, the insulin concentration was 10... -5 At a concentration of 10 mol / L, glucose consumption is minimal, but this concentration inhibits cell viability. -6 10 -7 10 -8 mol / L has no effect on cell viability, of which a concentration of 10 mol / L is particularly effective. -6 At mol / L, glucose consumption is the lowest, second only to 10.-5 mol / L. Therefore, an insulin concentration of 10 mol / L was chosen. -6 mol / L was used as the condition for establishing the insulin-resistant HepG2 cell model.
[0095] 3. Selection of active peptide concentration Using the same method as described above, the effects of active peptides (lyophilized active peptide powder with a molecular weight <3kDa prepared in Example 3) at concentrations of 1 mg / mL, 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, and 0.0625 mg / mL on the activity and glucose consumption of HepG2 cells were determined.
[0096] Table 5. Effects of active peptide concentration on cell viability and glucose consumption. Active peptide concentration (mg / mL) 1 0.5 0.25 0.125 0.0625 Cell viability (%) <![CDATA[60.16±0.75 a ]]> <![CDATA[70.73±1.11 b ]]> <![CDATA[100.11±0.81 c ]]> <![CDATA[124.34±0.95 d ]]> <![CDATA[153.15±1.69 e ]]> Glucose consumption (mmol / g prot) <![CDATA[6.5738±0.0762 e ]]> <![CDATA[7.0234±0.1093 c ]]> <![CDATA[7.9389±0.0316 a ]]> <![CDATA[7.2382±0.0827 b ]]> <![CDATA[6.7834±0.0428 d ]]> Table 5 shows that the bioactive peptides at concentrations of 1 mg / mL and 0.5 mg / mL impaired cell viability, while concentrations of 0.25 mg / mL, 0.125 mg / mL, and 0.0625 mg / mL did not inhibit cell viability. The highest glucose consumption was observed at a bioactive peptide concentration of 0.25 mg / mL; therefore, 0.25 mg / mL was chosen as the concentration for subsequent experiments.
[0097] 4. Effects of bioactive peptides on glucose metabolism in insulin-resistant HepG2 cells The cultured HepG2 cells were divided into groups of 20 × 10⁻⁶. 5 Cells were seeded at 1 / mL in 6-well plates and cultured at 37°C in a 5% CO2 incubator. When the cell confluence reached 80%, insulin was added according to the established insulin-resistant HepG2 cell model. After 24 h of culture, metformin or bioactive peptides (lyophilized bioactive peptide powder with a molecular weight <3kDa) were added.
[0098] The experimental groups were: normal group (no insulin), model group (insulin resistance), positive control group (insulin resistance + 50 μg / mL metformin solution), and peptide treatment group (insulin resistance + 0.25 mg / mL active peptide solution). Cells were incubated at 37℃ in a 5% CO2 incubator for 24 h. After 24 h, adherent cells were digested with trypsin, and the cells were collected into 1.5 mL centrifuge tubes. The cells were centrifuged at 1000 rpm for 10 min, the supernatant was discarded, and the cells were retained. The cells were washed twice with sterile PBS buffer, centrifuged at 1000 rpm for 10 min, the supernatant was discarded, and the cell pellet was resuspended in 0.5 mL of sterile PBS buffer. The prepared cell suspension was sonicated on ice (300 W, 3-5 seconds / blastson, 30-second interval, repeated 5 times). The glucose content of the prepared cell lysate was determined using a glucose content assay kit produced by Nanjing Jiancheng Biotechnology Institute, and the glucose consumption was calculated. The contents of HK and PK in cell lysates of each group were determined using a hexokinase (HK) and pyruvate kinase (PK) kit to analyze the effects of bioactive peptide samples on cellular glucose metabolism and synthesis.
[0099] Figure 14 The results showed that the glucose consumption of cells in the model group was significantly lower than that in the normal group, indicating that the cells had developed insulin resistance and their ability to take up glucose was reduced. Intervention with 0.25 mg / mL of bioactive peptide significantly improved glucose uptake and utilization in insulin-resistant HepG2 cells.
[0100] Figure 15 A showed that, compared with the normal group, the HK viability of the model group cells was significantly reduced. Compared with the model group, the HK viability of the active peptide-treated group was significantly increased. Figure 15 B showed that cells in the insulin-resistant state had significantly reduced PK activity, affecting cellular glucose metabolism. Intervention with bioactive peptide samples significantly improved this state, and the improvement effect was not significantly different from that of the positive control group.
[0101] In summary, the bioactive peptides provided by this invention significantly improve the activity of enzymes related to glucose metabolism and synthesis pathways in insulin-resistant HepG2 cells (p<0.05).
[0102] 5. Effects of bioactive peptides on oxidative stress in insulin-resistant HepG2 cells Decreased catalase (CAT) and total superoxide dismutase (SOD) activities, and increased propylene glycol (MDA) content, lead to disruption of redox balance, causing cellular oxidative stress and apoptosis. The activities of CAT and SOD, as well as the content of MDA, in cell lysates from each group were measured using a Nanjing Jiancheng reagent kit to analyze the ameliorative effect of bioactive peptides on oxidative stress in insulin-resistant HepG2 cells.
[0103] Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) are important indicators of hepatocellular damage, and they are often significantly elevated in the context of oxidative stress-induced liver injury, thus also being regarded as indirect indicators of oxidative stress. Cell lysates were prepared for each group, and the contents of AST and ALT were measured using a Nanjing Jiancheng reagent kit to analyze the ameliorative effect of bioactive peptides on liver injury in insulin-resistant HepG2 cells.
[0104] Figure 16 A showed that the CAT activity of normal cells was 48.40±1.68 U / mg prot, while the CAT activity of the model group was significantly reduced to 29.09±3.79 U / mg prot. Intervention with bioactive peptides significantly increased the CAT activity of insulin-resistant HepG2 cells, and the improvement was significantly greater than that of the positive control group, at 39.20±1.22 U / mg prot. Figure 16 B showed that the MDA content in the model group cells was significantly higher than that in the normal group cells, indicating that insulin-resistant HepG2 cells suffered from oxidative stress damage. The active peptide treatment group significantly reduced the MDA content in the model group cells compared with the positive control group, but there was no significant difference between the two groups (p<0.05). Figure 6 C showed that insulin resistance reduced SOD activity in HepG2 cells, while bioactive peptides significantly increased SOD activity in insulin-resistant HepG2 cells, indicating that bioactive peptides improved cellular antioxidant capacity.
[0105] Figure 17 A showed that, compared with normal cells, insulin treatment significantly increased ALT activity in HepG2 cells, indicating that the cells developed insulin resistance and caused damage. Compared with the model group cells, intervention with bioactive peptides significantly reduced ALT activity in insulin-resistant HepG2 cells. Figure 17 B showed that, compared with the normal group, the AST activity level in the model group cells was significantly increased. The intervention of metformin or active peptides significantly reduced the AST activity in insulin-resistant HepG2 cells, thus alleviating cell damage.
[0106] In summary, the active peptides provided by this invention can significantly improve oxidative stress damage in insulin-resistant HepG2 cells.
[0107] 6. Regulatory effects of bioactive peptides on the insulin signaling pathway in insulin-resistant HepG2 cells. After culturing the cells, discard the culture medium. Add 1 mL of Trizol lysis buffer to each well to cover the cells, repeatedly pipette to lyse the cells, and transfer the homogenate sample to an enzyme-free 1.5 mL centrifuge tube. After vigorous shaking, incubate at room temperature for 5 min. Extract RNA and perform reverse transcription and RT-qPCR reactions. The relevant primer gene sequences are shown in Table 6.
[0108] Table 6. Related primer gene sequences Primers Upstream sequence (5'-3') Downstream sequence (5'-3') TGACGTGGACATCCGCAAAG CTGGAAGGTGGACAGCGAGG CATTGCTGCAGAGGAGGTGA CACTTTGGCACTCTGGTTGC CTTCTTCATCATGCCAGCGC TGTTCATGTCGGGAAGGCTC CAGCACTGCCTCCTAAACCA AATGCTTTACTTCGCCGTCC AGTTCTCTCTTGACCCCTGC GTCAAAAGCCTGTGGATGCA GCCCTTTAGCCTGGATGTGT GCTAACACCTTGCGGCAAAA After the reaction is complete, according to 2 -ΔΔCT Calculate mRNA expression levels.
[0109] IRS1 It is an insulin receptor substrate that transduces receptor-activated signals to downstream effector molecules in the insulin signaling pathway, specifically activating the PI3K / AKT signaling pathway. Figure 18 A indicates that HepG2 cells in an insulin-resistant state... IRS1 Expression levels were significantly lower than in the normal group, and metformin intervention increased [the expression level]. IRS-1 The expression level of [the substance] was significantly higher in the peptide-treated group than in the normal group, and the peptide treatment group also significantly increased the expression level of insulin-resistant HepG2 cells. IRS-1 The expression level was significantly different from that of the normal group.
[0110] Activation of the insulin signaling pathway can promote GYS1 Phosphorylation of glycogen plays a role in regulating glycogen synthesis. GYS1 Functional anomalies will promote the development of T2DM. (By...) Figure 18 B indicates that, compared to the normal group, the model group GYS1 Expression levels were significantly reduced, and the addition of metformin or peptide samples increased expression. GYS1 The level.
[0111] PIK3R1 It is a linker that interacts with insulin receptor substrate (IRS) proteins and growth factor receptors. Insulin resistance reduces PI3K activity, thereby affecting the regulatory subunits of PI3K. PIK3R1 The expression of [something] is suppressed. [This is due to...] Figure 18 C indicates that the peptide sample improved insulin-resistant HepG2 cells. PIK3R1 The expression level was not significantly different from that of the normal group.
[0112] AKT It is a downstream effector molecule of the insulin signaling pathway. AKT Activation can regulate glucose transport, glycogen synthesis, and protein synthesis. Figure 18 D indicates that the model group cells AKT The level was significantly lower than that in the normal group, indicating that cells in a state of insulin resistance... AKT Decreased phosphorylation levels lead to impaired function. Intervention with peptide samples restored function. AKT The level was not significantly different from that of the normal group and the positive control group.
[0113] GLUT4 It is closely associated with metabolic diseases such as type 2 diabetes, obesity, and insulin resistance. Figure 18 E indicates that the model group reduced GLUT4 The expression level of peptide samples significantly recovered in the peptide sample treatment group, resulting in... GLUT4 The expression level was not significantly different from that of the normal group.
[0114] In summary, insulin resistance significantly inhibits the transduction of the IRS / PI3K / AKT signaling pathway, while peptide intervention can significantly improve the expression level of related mRNAs (p<0.05), regulate cellular glucose metabolism and utilization, and alleviate insulin resistance.
[0115] Example 8: Sequence identification, virtual screening, and molecular docking of the bioactive peptide B12 from Bifidobacterium animalis subsp. lactis. 1. Sequence identification of bioactive peptides Active peptides with a molecular weight <3kDa were lyophilized and sent to Beijing Biotech Biotechnology Co., Ltd. for peptide sequence identification and analysis by liquid chromatography-tandem mass spectrometry (LC-MS / MS).
[0116] 2. Virtual screening of bioactive peptides The identified peptide sequences were screened using online computer tools. First, the peptide ranker tool was used to screen peptides; peptides with a score ≥0.8 (higher scores indicate better bioactivity) were designated as bioactive peptides. The ProtParam tool was used to assess peptide instability; an instability index <40 indicated a stable peptide. The ToxinPred tool was used to assess peptide toxicity, and non-toxic peptides were screened. The AllerTOP v1.1 tool was used to assess peptide sensitization, and peptides without sensitizing agents were screened. The Novopro tool was used to predict peptide solubility; a result less than 40% indicated insoluble, 40%–70% weakly soluble, 70%–90% moderately soluble, and greater than 90% soluble. The admetSAR tool was used to screen peptides with good absorption capacity in the human gut, denoted as HIA+. The screened peptides are shown in Table 7.
[0117] Table 7. Sequence, physicochemical properties, biological activity, safety, solubility, instability index, and intestinal absorption capacity of polypeptides. Serial Number name length Molecular mass Bioactivity Instability Index toxicity Allergenicity pI soluble Human intestinal absorption capacity 1 AGIGIGAAIVMALFGM 16 1491.86 0.885224 -4.14 Non-Toxin NON-ALLERGEN 5.57 45% HIA+ (0.8951) 2 KPGDQLLSGSSVISGRCL 18 1817.07 0.852032 26.66 Non-Toxin NON-ALLERGEN 8.22 93% HIA+ (0.6880) 3 GFLFSFGSLGAIAVYGEAAGA 21 2005.23 0.933402 -9.79 Non-Toxin NON-ALLERGEN 4.05 66% HIA+ (0.7021) 4 LTGVPGGMAAGLALGWFHVAW 21 2111.47 0.852238 32.28 Non-Toxin NON-ALLERGEN 6.74 53% HIA+ (0.9210) 5 GAVALPGMALAIGAAFG 17 1486.78 0.820802 18.01 Non-Toxin NON-ALLERGEN 5.53 79% HIA+ (0.9361) 6 SAIFFVP 7 779.92 0.869714 36.09 Non-Toxin NON-ALLERGEN 5.24 96% HIA+ (0.8145) 7 AIGDLASFTLWL 12 1306.51 0.88997 39.18 Non-Toxin NON-ALLERGEN 4.05 58% HIA+ (0.9719) 8 VSGLMMIGLIGGAIFPPLMGLAS 23 2245.81 0.871655 26.73 Non-Toxin NON-ALLERGEN 5.49 36% HIA+ (0.8257) 9 VSGPDDWNGKLAAPLP 16 1636.80 0.825728 16.44 Non-Toxin NON-ALLERGEN 4.21 89% HIA+ (0.8013) 10 QAPLMALMMLM 11 1249.67 0.937408 35.2 Non-Toxin NON-ALLERGEN 5.53 16% HIA+ (0.5312) 11 GLHGGIPFGPSMLLGV 16 1551.85 0.919101 27.58 Non-Toxin NON-ALLERGEN 6.74 83% HIA+ (0.8956) As shown in Table 7, a total of 11 peptides were screened based on the above conditions. The sequence length of these 11 peptides ranges from 7 to 23, the isoelectric point (pI) ranges from 4.05 to 8.22, and the solubility ranges from 16% to 96%.
[0118] (1) Molecular docking of bioactive peptides Next, 3D structure files of α-amylase and α-glucosidase proteins were obtained from the RCSB PDB database. The binding energy of the proteins and active peptides was calculated using AutoDockTools-1.5.6 software and compared with the binding energy of clinical hypoglycemic drugs to screen out peptides with strong binding energy and potential hypoglycemic ability.
[0119] Table 8. Binding energy of peptides to proteins Serial Number name Binding energy with α-amylase (kcal / mol) Binding energy with α-glucosidase (kcal / mol) Average binding energy (kcal / mol) 1 AGIGIGAAIVMALFGM -12.2 -13.5 -12.85 2 KPGDQLLSGSSVISGRCL -10.7 -13.3 -12.0 3 GFLFSFGSLGAIAVYGEAAGA -10.3 -13.6 -11.95 4 LTGVPGGMAAGLALGWFHVAW -8.0 -8.9 -8.45 5 GAVALPGMALAIGAAFG -9.8 -12.6 -11.2 6 SAIFFVP -7.9 -8.7 -8.3 7 AIGDLASFTLWL -11.4 -11.6 -11.5 8 VSGLMMIGLIGGAIFPPLMGLAS -10.9 -12.5 -11.7 9 VSGPDDWNGKLAAPLP -10.4 -15.3 -12.85 10 QAPLMALMMLM -9.9 -10.8 -10.35 11 GLHGGIPFGPSMLLGV -10.6 -12.6 -11.6 The binding energy between acarbose, a currently clinically used hypoglycemic drug, and α-amylase is known to be -8.3 kcal / mol, and the binding energy between acarbose and α-glucosidase is -7.6 kcal / mol. Table 8 shows that the binding energies of these 11 peptides with α-amylase are all less than -7.0 kcal / mol, with 9 peptides exhibiting stronger binding affinity than acarbose. Peptide B12-01, however, has a binding energy less than -12.2 kcal / mol, indicating a very strong binding affinity with α-amylase. The binding energy results between the peptides and α-glucosidase show that all 11 peptides have relatively strong binding affinity, with 7 peptides exhibiting extremely strong binding affinity. Calculating the average binding energies between the peptides and the two proteins reveals that peptide AM-1 has the lowest binding energy and the strongest binding affinity with VP-9.
[0120] Phosphorylation of AKT can activate the IRS / PI3K / AKT signaling pathway, regulating metabolism. Within the AKT protein family, AKT1 is responsible for cell survival and proliferation and is a key participant in the PI3K signaling pathway. Therefore, AutoDockTools-1.5.6 software was used to perform molecular docking between two screened peptides, AM-1 and VP-9, and AKT1 protein, and 3D and 2D molecular docking structure diagrams were constructed to analyze the interaction between the peptides and AKT1. Figure 19 and Figure 20 It is known that peptides AM-1 and VP-9 bind tightly to AKT1 protein mainly through hydrogen bonds, van der Waals forces and hydrophobic interactions, and have the potential to promote AKT1 phosphorylation and regulate insulin signaling pathways.
Claims
1. An active peptide, characterized in that, The active peptide is produced by fermentation of animal bifidobacterium lactis subsp. Bifidobacterium animalis subsp. lactis ) 2. The active peptide according to claim 1, wherein The preservation number of the animal Bifidobacterium lactis is CGMCC No. 31656.
3. The active peptide of claim 2, wherein The molecular weight of the active peptide is < 3 kDa.
4. The active peptide according to claim 3, wherein The active peptide comprises a polypeptide with an amino acid sequence as shown in SEQ ID NO:
1.
5. The active peptide according to claim 3 or 4, characterized in that, The active peptide comprises a polypeptide with an amino acid sequence as shown in SEQ ID NO:
2.
6. The active peptide of claim 3, wherein The preparation method of the active peptide comprises the following steps: (1) Fermentation supernatant preparation Inoculate the animal Bifidobacterium lactis into MRS medium, and culture in an anaerobic incubator at 37°C for 30 h; centrifuge at 4000 rpm for 10 min to obtain fermentation supernatant; (2) Crude extraction and fractionation of active peptide Filter the fermentation supernatant with a filter with a pore size of 0.22 μm; slowly add 65% saturated ammonium sulfate to it, Incubate overnight in a cold storage under continuous stirring; centrifuge at 4°C, 3500 rpm for 30 min to obtain the precipitate, which is the peptide extract; recover the peptide extract with Tris-HCl buffer solution with pH 7.0, and desalt it with a dialysis bag overnight; collect the crude active peptide extract; fractionate the crude active peptide extract by ultrafiltration to obtain an active peptide solution with a molecular weight < 3 kDa; (3) Freeze-drying Freeze-dry the active peptide solution with a molecular weight < 3 kDa to obtain freeze-dried powder, which is the active peptide of the present application.
7. Use of the active peptide of any one of claims 2-6 in the preparation of a product with the function of reducing blood sugar.
8. Use according to claim 7, wherein the compound is ###0002### The product is a health care product or a pharmaceutical product.
9. Use of the active peptide of any one of claims 2-6 in the preparation of a pharmaceutical product for treating diabetes.