Soybean GmCAS gene and application thereof in regulating seed appearance quality

Abstract

The invention discloses a soybean GmCAS gene and application of the soybean GmCAS gene in regulation and control of seed appearance quality. According to the invention, the GmCAS gene is knocked out in soybean Huachun 6 by using a gene editing method, soybean seeds with the gene knocked out are obviously smaller than control Huachun 6, the hundred-grain weight is obviously reduced, the grain length and the grain width are obviously reduced, but the length-width ratio is not obviously changed. Therefore, the GmCAS gene can regulate and control the appearance quality characters such as the grain length and the grain width of the soybean seeds and the grain weight. The invention discloses the biological function of the soybean GmCAS gene for controlling the appearance quality of the seeds for the first time, and the soybean GmCAS gene can be applied to improving the appearance quality of the soybean seeds.

Description

Technical Field

[0001] This invention belongs to the field of biological breeding technology, specifically relating to soybeans. GmCAS Genes and their application in regulating seed appearance quality. Background Technology

[0002] Soybeans Glycine max [L.) Merr.] Soybean is an important dual-purpose crop for grain, oil, and feed, and is also one of the main sources of plant-based protein and oil. The shape and size of soybean seeds—including seed length, width, thickness, and their ratios—are key economic traits affecting yield and appearance. Therefore, breeding soybean varieties with suitable seed morphology has become an important goal of breeding work. Appearance quality, such as seed shape and size, directly determines the market value of soybeans, significantly influencing consumer preferences, market acceptance, and price trends, and is thus of common concern to growers and consumers.

[0003] A highly significant negative correlation exists between 100-seed weight and seed shape, indicating that more attention should be paid to round seed types in breeding practices. Large seeds often have lower germination rates and poorer resistance in the field, and are more susceptible to mechanical damage during harvesting, affecting their appearance and physiological quality. Furthermore, large seeds require more coating agents during processing, increasing transportation costs. On the other hand, soybean bulk density and heat tolerance are both highly significantly positively correlated with seed shape index and specific gravity, but highly significantly negatively correlated with 100-seed weight. Therefore, bulk density can serve as a simple field evaluation indicator for heat tolerance during germination. Classical genetic studies have shown that soybean seed shape is a quantitative trait controlled by multiple genes, possessing stable genetic characteristics, and that seed size and shape are regulated by different genetic factors. In conclusion, in-depth research into the formation mechanism of soybean appearance quality and its relationship with agronomic traits has significant theoretical and practical implications for soybean production and agricultural economic development. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention aims to identify key genes controlling the appearance quality of soybeans and utilize genetic engineering techniques to alter the appearance quality of soybean seeds. Therefore, this invention provides soybeans... GmCAS Genes and their application in regulating seed appearance quality.

[0005] The first objective of this invention is to provide Gm CAS protein, whose amino acid sequence is shown in SEQ ID NO.3.

[0006] The second object of the present invention is to provide GmCAS Genes, which encode the aforementioned Gm CAS protein.

[0007] Preferably, the aforementioned GmCASThe gene, whose nucleotide sequence is shown in SEQ ID NO.1.

[0008] Preferably, the aforementioned GmCAS The gene, whose CDS nucleotide sequence is shown in SEQ ID NO.2.

[0009] The third object of the present invention is to provide the aforementioned GmCAS Application of genes in regulating the appearance quality of soybean seeds.

[0010] The fourth object of the present invention is to provide a method for knocking out the aforementioned GmCAS Application of genes in regulating the appearance quality of soybean seeds.

[0011] Preferably, the method for regulating the appearance quality of soybean seeds is at least one of the following (1)-(3): (1) Reduce soybean seed length; (2) Reduce soybean seed width; (3) Reduce soybean seed weight.

[0012] A fifth object of the present invention is to provide a method for obtaining soybeans with improved seed appearance quality, comprising knocking out the aforementioned GmCAS The steps of gene generation.

[0013] Preferably, the soybean with improved seed appearance quality is a soybean with reduced seed length, width and / or weight.

[0014] Preferably, the method includes the following steps: constructing the target into a CRISPR-Cas9 knockout vector using Golden Gate technology, and obtaining transgenic positive plants and soybean seeds through soybean genetic transformation; wherein the target is target 1 and target 2, the nucleotide sequence of target 1 is shown in SEQ ID NO.4, and the nucleotide sequence of target 2 is shown in SEQ ID NO.5.

[0015] This invention will GmCAS The gene was knocked out in soybean Huachun 6 using gene editing. Soybean seeds with this gene knocked out were significantly smaller and had a significantly lower 100-seed weight than the control Huachun 6. Seed length and width were also significantly reduced, but the length-to-width ratio remained unchanged. This indicates... GmCAS Genes can regulate soybean seed appearance traits such as seed length and width, as well as seed weight. This invention is the first to reveal the properties of soybean seeds. GmCAS The biological functions of genes in controlling seed appearance quality can be applied to improve the appearance quality of soybean seeds. Attached Figure Description

[0016] Figure 1 This refers to the target site editing status of gene-edited positive seedlings; A: GmCAS Gene editing targets and editing methods; B: GmCAS Gene-edited proteins.

[0017] Figure 2 This is a phenotypic analysis of soybean grain appearance; A: grain length; B: grain width; compared with HC6, t The test results showed a highly significant difference. p <0.01.

[0018] Figure 3 This analysis includes soybean 100-seed weight and seed shape; A: 100-seed weight; B: Length-width ratio; compared to HC6. t The test results showed a highly significant difference. p <0.01, no significant difference (ns) p> 0.05. Detailed Implementation

[0019] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0020] Example 1 I. Methods 1. Identification of genetically modified soybean genotypes CRISPR / Cas9 gene editing technology to construct positive transgenic soybeans: Using the CRISPR-P 2.0 online tool (http: / / crispr.hzau.edu.cn / CRISPR2 / ), in GmCAS Gene( GmCAS The nucleotide sequence of the gene is shown in SEQ ID NO.1, its CDS nucleotide sequence is shown in SEQ ID NO.2, and the amino acid sequence encoding the protein is shown in SEQ ID NO.3. Two sgRNA target sequences were designed near the start codon: target 1 is ATAGGGAACGCTTTGAAGCCTGG (SEQ ID NO.4), and target 2 is AACAGGTTCAGTATCAACACCGG (SEQ ID NO.5). The above targets were constructed into a CRISPR-Cas9 knockout vector using the Golden Gate cloning method, and transgenic positive soybean plants were successfully obtained through a soybean (wild-type Huachun 6) genetic transformation system.

[0021] Genomic DNA was extracted from T0 generation positive transgenic soybean plants, and the GmCAS gene fragment containing the target region was amplified by PCR using specific primers CAS-F (CACCCAAGTAATTCTAACAAA, SEQ ID NO.6) and CAS-R (GTGCGGATACAATCATACA, SEQ ID NO.7). The amplified products were sent to a sequencing company for first-generation sequencing. The edit type was analyzed and the genotype of the mutant was identified by comparing the sequence with the reference sequence of the wild-type material Huachun 6 (HC6) soybean.

[0022] 2. Measurement of 100-seed weight and appearance characteristics of soybeans The weight of 100 seeds was determined by randomly selecting 100 plump and undamaged homozygous T1 generation transgenic seeds and control HC6 seeds, weighing them, repeating the process three times, and taking the average value as the final result.

[0023] For the determination of grain shape, 20 seeds were randomly selected from homozygous T1 generation transgenic seeds and control HC6 seeds. The length, width, and thickness of each seed were measured individually using calipers. The average value of each trait was calculated, and the length-to-width ratio was further calculated based on the average length and width. t The significance of the differences between mutant and wild-type materials in terms of 100-grain weight and grain shape was analyzed.

[0024] II. Results 1. GmCAS Edit Knockout Identification Using CRISPR / Cas9 gene editing technology to edit soybeans GmCAS Two mutant materials were successfully obtained through targeted gene knockout. gmcas-1 (cas-1) and gmcas-2 (cas-2). Compared to wild-type Huachun 6 (HC6), gmcas-1 exist GmCAS The insertion of a C base in the second target region of the gene causes the encoded protein to terminate prematurely; gmcas-2 A 131 bp fragment is missing between the first and second target sites, causing a coding sequence error and also leading to premature termination of protein translation. Figure 1 The successful creation of these mutant materials provides a basis for in-depth analysis. GmCAS The function of genes in soybean seed development and their molecular mechanisms provide important genetic material and a research foundation.

[0025] 2. Analysis of the appearance and quality of soybean kernels To explore GmCAS The influence of genes on the appearance quality of soybean seeds gmcas Statistical analysis was performed on the grain length and width of mature seeds from both the mutant and wild-type HC6. Grain length measurement results ( Figure 2 As shown in A), the average grain length of HC6 was 6.87 ± 0.29 mm, while the average grain lengths of cas-1 and cas-2 mutants were 6.63 ± 0.29 mm and 6.58 ± 0.30 mm, respectively. Compared with HC6, the grain lengths of cas-1 and cas-2 mutants were significantly reduced, with decreases of 3.5% and 4.2%, respectively. Grain width determination results ( Figure 2 Figure B) shows that the average grain width of HC6 was 6.02 ± 0.15 mm, while the average grain widths of the cas-1 and cas-2 mutants were 5.68 ± 0.23 mm and 5.72 ± 0.25 mm, respectively. The grain widths of both mutants were significantly smaller than those of HC6, with reductions of 5.6% and 5.0%, respectively. These results indicate that... GmCAS Gene expression was significantly positively correlated with both the length and width of soybean seeds.

[0026] 3. Hundred-grain weight and grain shape analysis To assess the impact of the GmCAS gene on soybean seed development, we measured the 100-seed weight of mature seeds from mutants (cas-1 and cas-2) and wild-type HC6. The results are as follows: Figure 3 As shown in Figure A, the 100-seed weight of HC6 was 14.27 ± 0.51 g, while the 100-seed weights of the cas-1 and cas-2 mutants were 12.33 ± 0.35 g and 12.20 ± 0.57 g, respectively. Compared with HC6, the 100-seed weight of both mutants was significantly reduced, by 13.6% and 14.5%, respectively, indicating that GmCAS plays a positive regulatory role in soybean seed development or nutrient accumulation.

[0027] To further investigate the effect of GmCAS on seed morphology, we compared the length-to-width ratio of mature seeds from mutants (cas-1 and cas-2) with that of wild-type HC6. The results showed that ( Figure 3 The aspect ratio of HC6 (B) was 1.14 ± 0.04, while that of the cas-1 and cas-2 mutants was 1.17 ± 0.03 and 1.15 ± 0.03, respectively, with no significant difference. Combined with the aforementioned results on 100-seed weight and grain shape, it can be concluded that the deletion of the GmCAS gene leads to a significant reduction in soybean seed size, but does not cause a significant change in grain shape.

Claims

1. Gm CAS protein, characterized in that, The amino acid sequence is shown in SEQ ID NO.

3.

2. GmCAS Genes, characterized by, Encoding as claimed in claim 1 Gm CAS protein.

3. The method according to claim 2 GmCAS Genes, characterized by, The nucleotide sequence is shown in SEQ ID NO.

1.

4. The method according to claim 2 GmCAS Genes, characterized by, The CDS nucleotide sequence is shown in SEQ ID NO.

2.

5. The claim 2 GmCAS Application of genes in regulating the appearance quality of soybean seeds.

6. Knockout of claim 2 GmCAS Application of genes in regulating the appearance quality of soybean seeds.

7. The application according to claim 6, characterized in that, The regulation of soybean seed appearance quality is at least one of the following (1)-(3): (1) Reduce soybean seed length; (2) Reduce soybean seed width; (3) Reduce soybean seed weight.

8. A method for obtaining soybeans with improved seed appearance quality, comprising knocking out the [specific ingredient] as described in claim 2. GmCAS The steps of gene generation.

9. The method according to claim 8, characterized in that, The soybeans with improved seed appearance quality are soybeans with reduced seed length, width and / or weight.

10. The method according to claim 8, characterized in that, The method includes the following steps: constructing the target into a CRISPR-Cas9 knockout vector using GoldenGate technology, and obtaining transgenic positive plants and soybean seeds through soybean genetic transformation; the target is target 1 and target 2, the nucleotide sequence of target 1 is shown in SEQ ID NO.4, and the nucleotide sequence of target 2 is shown in SEQ ID NO.5.

Images