Nitrate reducing bacillus DSSR-1, biocontrol inoculant and application of biocontrol inoculant
By using the DSSR-1 biocontrol agent of Bacillus nitrate-reducing, the problem of slowed plant growth under low temperature and drought stress was solved, thereby promoting plant growth, improving stress resistance, and enhancing plant quality and yield.
Patent Information
- Application Number
- CN202511336969.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-18
- Publication Date
- 2025-12-12
AI Technical Summary
When plants face low temperature and drought stress, their growth slows down, their resistance to adverse conditions decreases, and their growth, development and yield are affected.
Using Bacillus nitrate-reducing DSSR-1 as a biocontrol agent, the application of live bacterial solution promotes plant growth and enhances drought and cold resistance.
It promotes plant growth and development, increases germination rate, root length and root quantity, enhances drought resistance, reduces bud drop rate, and increases fruit set rate and yield.
Smart Images

Figure CN121109218A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, specifically to a reducing nitrate Bacillus DSSR-1, a biocontrol agent, and their applications. Background Technology
[0002] Plants develop adaptability and resistance to adverse environments during their growth and evolution; this is known as plant stress resistance. With the intensification of global climate change and environmental degradation, plant stress resistance has become a crucial issue for sustainable agricultural development.
[0003] Low temperature stress slows plant growth, disrupts the plant's water balance, leading to dehydration and wilting; increases cell membrane permeability, causing organic matter to leak out and resulting in metabolic disorders; inhibits chlorophyll synthesis, causing leaves to yellow and lose their green color; suppresses photosynthetic enzyme activity, reducing the photosynthetic rate; reduces protein synthesis; and increases the content of endogenous hormones, severely affecting plant growth and development. Drought stress causes significant changes in plant physiological and morphological characteristics, inhibits plant growth, and leads to changes in root structure, severe oxidative stress, and alterations in osmotic pressure.
[0004] Therefore, there is an urgent need to discover a product that can effectively improve plant growth and stress resistance. Summary of the Invention
[0005] To explore a microorganism for promoting plant growth and stress resistance, this invention provides a reducing nitrate Bacillus DSSR-1, a biocontrol agent, and their applications. The reducing nitrate Bacillus DSSR-1 provided by this invention can promote plant growth and development, improve plant drought and cold resistance, thereby increasing plant quality and yield.
[0006] This invention provides a reducing nitrate Bacillus ( Bacillusnitratireducens DSSR-1, the Bacillus nitrate-reducing strain DSSR-1, was deposited on July 8, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 31206, and classified as Bacillus nitrate-reducing. Bacillusnitratireducens .
[0007] The Bacillus nitrate-reducing DSSR-1 provided by this invention can promote plant growth and development, improve the drought resistance and cold tolerance of plants, thereby improving plant quality and yield.
[0008] The present invention also provides a biocontrol agent, wherein the biocontrol agent uses the aforementioned Bacillus nitrate-reducing DSSR-1 as the sole effective component.
[0009] Furthermore, the viable concentration of Bacillus nitrate-reducing DSSR-1 in the biocontrol agent is 1×10⁻⁶. 4CFU / mL ~ 1×10 12 CFU / mL.
[0010] This invention provides the application of the aforementioned Bacillus nitrate-reducing DSSR-1 or the aforementioned biocontrol agent in promoting plant growth and development.
[0011] Furthermore, the plant is a medicinal herb, a fruit tree, a crop, or a vegetable.
[0012] Furthermore, the application is as follows: the biocontrol agent is used to promote the germination rate of wheat seeds and increase the length of shoots, roots, and the number of roots.
[0013] The present invention also provides the application of the aforementioned Bacillus nitrate-reducing DSSR-1 or the aforementioned biocontrol agent in improving plant stress resistance.
[0014] Furthermore, the stress resistance refers to drought resistance or cold resistance.
[0015] Furthermore, the plant is a medicinal herb, a fruit tree, a crop, or a vegetable.
[0016] Furthermore, the medicinal plant mentioned is Salvia miltiorrhiza, Scutellaria baicalensis, Schisandra chinensis, or Panax notoginseng.
[0017] Furthermore, the fruit trees are strawberry, grape, apple, citrus, cherry, or melon.
[0018] Furthermore, the crops mentioned are wheat, corn, rice, soybeans, or sorghum.
[0019] Furthermore, the vegetables mentioned are leafy greens, cucumbers, pumpkins, peppers, eggplants, tomatoes, or potatoes.
[0020] Furthermore, the application is as follows: the biocontrol agent is used to reduce the bud drop rate of fruit trees and increase the fruit set rate.
[0021] Compared with the prior art, the beneficial effects of the present invention are as follows: The Bacillus nitrate-reducing DSSR-1 provided by this invention can promote plant growth and development; it can also induce drought and cold resistance in plants, thereby promoting efficient plant growth and significantly improving plant yield and quality. This is achieved by spraying with a viable bacterial count of 1×10⁻⁶. 5 CFU / mL ~ 1×10 6 Fermentation broth of Bacillus nitrate-reducing at CFU / mL DSSR-1 promotes wheat seed germination rate, increases shoot length, root length, and root quantity, and increases proline accumulation in pepper seedlings, thereby alleviating damage to pepper seedlings. In other words, Bacillus nitrate-reducing at CFU / mL DSSR-1 can improve plant drought resistance. It also enhances apple tree resistance to adverse conditions, reducing bud drop and increasing fruit set to some extent.
[0022] Information on the Preservation of Biological Materials DSSR-1, referred to in this application as *Bacillus nitrate-reducing* DSSR-1, was deposited on July 8, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 31206. The address of the depository is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China. Its classification name is *Bacillus nitrate-reducing*. Bacillusnitratireducens . Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 The results show the ability of strain DSSR-1 to secrete indoleacetic acid (IAA). CK is the blank control, and DSSR-1 is the result of the colorimetric reaction between strain DSSR-1 and Salkowski chromogenic solution.
[0025] Figure 2 The results show the siderophore production capacity of strain DSSR-1.
[0026] Figure 3 The figure shows the results of enzyme production capacity determination for strain DSSR-1; from left to right, the figures represent amylase production, protease production, cellulase production, chitinase production, and enzyme production. β Results of the determination of -1,3-glucanase.
[0027] Figure 4 The results show the phosphorus solubility of strain DSSR-1; the left figure shows the phosphorus solubility of insoluble organic phosphorus in strain DSSR-1; the right figure shows the phosphorus solubility of insoluble inorganic phosphorus in strain DSSR-1.
[0028] Figure 5 Morphological identification of strain DSSR-1; In the figure, A is a colony plate diagram of strain DSSR-1; B shows the Gram staining results of strain DSSR-1.
[0029] Figure 6 Phylogenetic tree of strain DSSR-1.
[0030] Figure 7The figure shows the growth-promoting effect of different concentrations of DSSR-1 fermentation broth on wheat; from top to bottom, the figures represent the blank control (CK), DSSR-1 viable cell count (1×10⁻⁶), and so on. 8 cfu / mL, DSSR-1 viable count 1×10⁻⁶ 6 cfu / mL and DSSR-1 viable count 2×10⁻⁶ 4 cfu / mL. Detailed Implementation
[0031] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.
[0032] Example 1: Isolation and identification of Bacillus nitrate-reducing DSSR-1.
[0033] I. Isolation of strain DSSR-1 The rhizosphere soil of the medicinal herbs was collected from Yanping Town, Shanyang County, Shangluo City, Shaanxi Province (110°7′E, 33°18′N, altitude 980m), on August 3, 2022. The specific separation method is as follows:
[0034] Remove the roots of healthy Schisandra chinensis plants, gently shake off any large clumps of soil attached to the roots, and place the root tissue in an Erlenmeyer flask containing an appropriate amount of sterile water. Shake thoroughly and allow to settle. After sedimentation, collect 1 mL of the supernatant, and then dilute it sequentially with sterile water in 10 mL centrifuge tubes to prepare dilutions of 10, 10, and 10 times. 2 10 3 and 10 4 A soil suspension diluted 10 times. Take samples of the solution diluted 10 times... 3 and 10 4 100 μL of a soil dilution was spread onto LB medium supplemented with 100 μg / mL of actinomycete ketone. Each treatment was repeated three times. The medium was incubated upside down at 28°C until a moderate number of clearly visible single colonies grew. Single colonies were then picked and purified until the colony morphology was stable and consistent.
[0035] II. Determination of biological characteristics of strain DSSR-1 1. Determination of the strain's ability to secrete indoleacetic acid (IAA) Methods: DSSR-1 strain was inoculated into LB liquid medium containing 100 mg / L L-tryptophan and cultured in a shaker at 28℃ and 200 r / min for 24 h to obtain a bacterial suspension. 500 μL of the bacterial suspension was dropped into a blank test tube, and an equal volume of Salkowski chromogenic solution was added simultaneously to initiate a colorimetric reaction (DSSR-1). A blank control (CK) was prepared by replacing the bacterial suspension with an equal volume of LB liquid medium. The test tubes were placed at room temperature in the dark, and observed after 30 min. A red color indicated the production of IAA.
[0036] Results: The supernatant of strain DSSR-1 turned redder than the control group after being mixed with Salkowski's reagent, and the qualitative test result was positive, indicating that strain DSSR-1 has the ability to secrete IAA, which is one of the reasons why this strain has a promoting effect on plant growth.
[0037] 2. Determination of iron-carrying capacity Method: The strain DSSR-1 was inoculated onto CAS solid medium and cultured at 28℃ for 7 days. If an orange-yellow halo appeared around the colony, it indicated that the strain had the ability to produce siderophores.
[0038] Results: After 7 days of culture on CAS plates, strain DSSR-1 developed a yellow halo ( Figure 2 The qualitative test result was positive, indicating that the strain has the ability to produce siderophores.
[0039] 3. Determination of enzyme production capacity Methods: Strain DSSR-1 was inoculated onto amylase, protease, cellulase, and... β Enzyme production was measured on a 1,3-glucanase-specific detection medium.
[0040] Results: All qualitative test results were positive. Figure 3 This indicates that the strain produces amylase, protease, cellulase, and... β The ability of -1,3-glucanase.
[0041] 4. Determination of phosphorus solubility Method: The strain DSSR-1 was inoculated onto culture media containing insoluble organic phosphorus and insoluble inorganic phosphorus, respectively. The strain with phosphorus-solubilizing ability grew normally on the culture medium.
[0042] Results: After 7 days of culture in both insoluble organic phosphorus and insoluble inorganic phosphorus media, strain DSSR-1 showed normal growth, and qualitative tests were positive in both media. Figure 4 This indicates that the strain has the ability to dissolve both organic and inorganic phosphorus.
[0043] III. Identification of strain DSSR-1 1. Morphological identification Morphological observation results showed that strain DSSR-1 formed pale yellow to yellow colonies on NA medium, which were opaque with irregular edges and a radial spread. Figure 5 (A). DSSR-1 strain is Gram-positive, and the cells are irregularly rod-shaped ( Figure 5 B).
[0044] 2. Molecular biological identification Phylogenetic analysis of the 16S rDNA sequence of strain DSSR-1 Figure 6 The results showed that this bacterium was related to Bacillus nitrate-reducing (Bacillus). Bacillusnitratireducens They have a high degree of homology.
[0045] Based on the above test results, combined with morphological and biological characteristics, strain DSSR-1 was identified as *Bacillus nitrate-reducing* and named *Bacillus nitrate-reducing* DSSR-1. The 16S rDNA sequence of *Bacillus nitrate-reducing* DSSR-1 is shown in SEQ ID NO.1. ilvD Dihydroxy acid dehydratase ( Dihydroxyacid dehydratase , ilvD The sequence is shown in SEQ ID NO.2.
[0046] SEQ ID NO.1: SEQ ID NO.2: AGAGGGGGATTACGTATATTAAAAGGAAACCTTGCGAAAGACGGAGCGGTTATTAAAAGCGGGGCAACAGAGGTAAAACGATTTGAAGGACCTTGCGTTATTTTTAATTCACAAGATGAGGCGCTTGCGGGCATTATGCTTGGAAAAGTGAAAAAAGGAGATGTCGTTGTTATTCGTTATGAAGGACCAAGAGGCGGCCCTGGTATGCCAGAAATGTTAGCTCCGACGTCAGCAATTGCCGGCATGGGA TTAGGTGCTGATGTTGCGCTATTAACGGATGGACGTTTCTCCGGTGCTTCACGTGGTATTTCGGTAGGGCATATTTCACCGGAAGCAGCTGCAGGTGGAACGATTGCTCTTCTTGAGAAAGGGGA TATAGTTTGTATTGATGTTGAAGAACGTTTGTTAGAAGTAAGGGTGAGTGATGAAGAATTAAATAAGCGTAAAAAAGAATGGAAACGACCAGAACCGAAAGTGAAAACTGGCTGGCTTGGGCGTT Example 2: Application of Bacillus nitrate-reducing DSSR-1 in promoting plant growth.
[0047] After sterilization, wheat seeds (Xiaoyan 22) were divided into four groups and soaked in sterile water and DSSR-1 live bacteria at 1×10⁻⁶ oz. 12 cfu / mL, 1×10 10 cfu / mL, 1×10 8 cfu / mL, 1×10 6 cfu / mL, 2×10 4 cfu / mL and 1×10 4 The wheat seeds were dried naturally for 24 hours at CFU / mL. After air drying, the seeds were placed on sterilized filter paper to promote germination and cultured in a 25℃ constant temperature incubator, with timely water replenishment. After 7 days, the germination status was observed, and the sprout and root lengths of the germinated seeds were measured and averaged. The germination results of the wheat seeds are shown in Table 1.
[0048] Table 1. Analysis of the growth-promoting effects of Bacillus nitrate-reducing DSSR-1 on wheat. Table 1 shows that Bacillus nitrate-reducing DSSR-1 can promote the germination rate of wheat seeds and increase shoot length, root length, and root quantity, indicating that Bacillus nitrate-reducing DSSR-1 has a good growth-promoting effect on wheat. The growth-promoting effect of Bacillus nitrate-reducing DSSR-1 on wheat is concentration-dependent: higher concentrations (1×10⁻⁶) result in a lower growth rate. 12 CFU / mL had a certain inhibitory effect on germination rate, but no significant promoting effect on shoot length, root length, or root number; moderate concentrations (2×10⁻⁶) showed a certain inhibitory effect on germination rate. 4 cfu / mL~1×10 8 (cfu / mL) can significantly improve germination rate, promote the growth of buds and roots, and increase the number of roots, with the most obvious growth-promoting effect; low concentration (1×10) 4 While DSSR-1 (cfu / mL) also has some growth-promoting effect, the effect is not significant. Based on the overall data, the growth-promoting effect is best when the viable bacterial count is 1.0 × 10⁶ CFU / mL. The typical morphology is 2 × 10⁶ CFU / mL. 4 cfu / mL, 1×10 6 cfu / mL and 1×10 8 Germination of wheat seeds in the CFU / mL group is as follows: Figure 7 .
[0049] Example 3: Application of Bacillus nitrate-reducing DSSR-1 in improving plant drought resistance.
[0050] Select chili seedlings of similar growth, water them uniformly until the soil is thoroughly soaked, and then stop watering. When the potted soil dries out, divide the seedlings into a control group (inoculated with sterile water) and an experimental group (inoculated with DSSR-1 fermentation broth). Spray the seedlings with the pesticide. Each pot in the experimental group is inoculated with 5 mL of Bacillus nitrate-reducing DSSR-1 fermentation broth (1×10⁻⁶). 6 The control group was replaced with an equal volume of sterile water. No watering was carried out during the treatment period until drought stress occurred.
[0051] The investigation was conducted when seedlings showed signs of drought stress. In this experiment, significant drought occurred 10 days after pesticide application. The damage index of pepper seedlings was investigated, and the proline content in the seedlings was measured. The results are shown in Table 2. The calculation formula and damage level grading criteria are as follows:
[0052] Grade 0: Seedlings are growing well and show no symptoms; Grade 1: The plant stands upright, but less than 20% of the leaves are wilted; Level 2: The plant stands upright, but less than 50% of the leaves are wilted; Level 3: The plant stands upright, but more than 50% of the leaves are wilted; Level 4: The plant cannot stand upright, and all leaves are wilting; Level 5: The entire seedling dies.
[0053] Table 2. Effects of Bacillus nitrate-reducing DSSR-1 on drought resistance in chili peppers. Note: Data in the table are mean ± standard deviation; * indicates that the mean ± standard deviation is used. P The difference was statistically significant at levels <0.05.
[0054] As shown in Table 2 above, under drought stress, exogenous spraying of Bacillus nitrate-reducing fermentation broth DSSR-1 can alleviate the damage to pepper seedlings by increasing the accumulation of proline in the seedlings. In other words, Bacillus nitrate-reducing fermentation broth DSSR-1 can improve the drought resistance of plants.
[0055] Example 3: Application of Bacillus nitrate-reducing DSSR-1 in improving plant cold resistance.
[0056] The experiment was conducted from March 2022 to March 2023 at the Apple Experiment and Demonstration Station in Qingcheng County, Gansu Province (36°0′13″N, 107°54′56″E). Located in the central part of the Loess Plateau in eastern Gansu, this area has a temperate continental monsoon climate, an altitude of 1285 m, an average annual rainfall of 507 mm, an average annual temperature of 9.4℃, an extreme winter low of -25.1℃, an average frost-free period of 166 days, and an average annual sunshine duration of 2420 h. The soil is loess soil with a pH of 7.4–8.4. The orchard soil is uniformly fertile. The rows were clean-cultivated and covered with black ground cover, and clover was planted between the rows. Fertilization, irrigation, and pest and disease control were consistent with conventional management practices. Five-year-old Fuji apples were used as experimental material. The row spacing was 4 m × 2 m, with a uniform exposed length of 10 cm after ridging. The tree shape was slender and spindle-shaped.
[0057] The experiment employed a randomized block design, selecting apple trees of similar growth vigor as experimental materials. Apple tree flower buds typically emerge in March and April; a sudden drop in temperature during this period can cause frost damage to the flower buds and flower drop, severely impacting apple tree yield. In this experiment, the pesticide was applied during the apple tree flowering period (March 15, 2022), with 3 trees per replicate and each treatment replicated 3 times. The experimental group was sprayed with Bacillus nitrate-reducing fermentation broth DSSR-1 (1×10⁻⁶). 6 (CFU / mL) The control group was sprayed with an equal amount of sterile water, enough to completely wet the leaves without dripping. On April 14, 2022, a low-temperature freezing injury occurred, with the ground temperature dropping to around -6℃ and the temperature remaining below 0℃ for more than 8 hours. Before the cold wave arrived, a total of 3 sprays were applied, with an interval of 7 days between each application. Water and fertilizer management were uniform. For each tree in each treatment group, a branch with a similar number of flower buds was selected from four directions and marked. Before the third application, the number of flower buds on each branch was counted.
[0058] After the cold wave (April 18th), once the temperature rose, the total number of flower buds on the marked branches in each treatment group was counted, and the bud drop rate was calculated. After the young fruit had set (May 15th), the number of fruits on the marked branches was investigated, and the fruit set rate was calculated. The calculation formula is as follows:
[0059] Table 3. Effect of Bacillus nitrate-reducing DSSR-1 on cold resistance of apples Note: Data in the table are mean ± standard deviation; * indicates that the mean ± standard deviation is used. P The difference was statistically significant at levels <0.05.
[0060] Table 3 shows that apple blossoms exposed to cold waves without any protective measures suffer severe damage to the buds, resulting in a large number of flower drops, with a bud drop rate of 41.03%, which also has a certain impact on the subsequent fruit set. Spraying Bacillus nitrate-reducing fermentation liquid DSSR-1 before the cold wave can enhance the resistance of apple trees to adverse conditions, reduce the bud drop rate to a certain extent, and improve the fruit set rate.
[0061] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.
[0062] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. A nitrate-reducing Bacillus ( Bacillus nitratireducens DSSR-1, characterized in that, The nitrate-reducing Bacillus DSSR-1 was deposited on July 8, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 31206, and classified as *Bacillus nitrate-reducing*. Bacillus nitratireducens .
2. A biocontrol agent, characterized in that, The biocontrol agent uses Bacillus nitrate-reducing DSSR-1 as the sole effective component as described in claim 1.
3. The biocontrol agent according to claim 2, characterized in that, The viable bacterial concentration of Bacillus nitrate-reducing DSSR-1 in the biocontrol agent is 1×10⁻⁶. 4 CFU / mL ~ 1×10 12 CFU / mL.
4. The application of the Bacillus nitrate-reducing DSSR-1 as described in claim 1 or the biocontrol agent as described in any one of claims 2 to 3 in promoting plant growth and development.
5. The application according to claim 4, characterized in that, The plants mentioned are medicinal plants, fruit trees, crops, or vegetables.
6. The application according to claim 5, characterized in that, The application is as follows: the biocontrol agent is used to promote the germination rate of wheat seeds and increase the length of shoots, roots, and the number of roots.
7. The application of the Bacillus nitrate-reducing DSSR-1 as described in claim 1 or the biocontrol agent as described in any one of claims 2 to 3 in improving plant stress resistance.
8. The application according to claim 7, characterized in that, The aforementioned resistance refers to drought resistance or cold resistance.
9. The application according to claim 8, characterized in that, The plants mentioned are medicinal plants, fruit trees, crops, or vegetables.
10. The application according to claim 8, characterized in that, The application is as follows: the biocontrol agent is used to reduce the bud drop rate of fruit trees and increase the fruit set rate.