PtoERD7 gene related to poplar stomatal density and application of PtoERD7 gene
By overexpressing the PtoERD7 gene in poplar and reducing stomatal density, the problem of growth restriction in poplar under drought stress was solved, thereby enhancing the drought resistance of poplar and accelerating the breeding process.
Patent Information
- Application Number
- CN202511265742.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-05
- Publication Date
- 2025-12-12
AI Technical Summary
The lack of effective genetic modification genes for stomatal density in existing technologies leads to limited growth of poplar trees under drought stress, affecting forestry production efficiency and the ecological environment.
By identifying and overexpressing the PtoERD7 gene, the stomatal density of poplar trees can be reduced, thereby enhancing their drought resistance. The specific method involves constructing a recombinant vector for overexpressing the PtoERD7 gene and introducing it into poplar plants.
It significantly reduced the stomatal density of poplar trees by 30.67%, enhanced the drought resistance of poplar trees, improved their adaptability to adverse conditions, shortened the breeding cycle, and mitigated the impact of drought on forestry yield and quality.
Smart Images

Figure CN121109458A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to a poplar drought resistance gene, and particularly relates to a PtoERD7 gene related to the stomatal density of poplar and application thereof. BACKGROUND
[0002] Global climate change aggravates drought stress, which has become a major abiotic stress factor limiting the growth of forest trees, wood yield and quality. Under drought stress, the water balance in the plant body is broken, which will quickly start a series of complex physiological and biochemical reactions. In order to reduce water loss, the stomata of the plant quickly close, leading to blocked leaf gas exchange, insufficient carbon dioxide uptake, and further affecting the dark reaction stage of photosynthesis. Under long-term drought stress, the growth and development process of the plant is significantly delayed, the root growth is limited, and the nutrient absorption capacity is reduced, ultimately leading to slow plant growth and reduced crop yield.
[0003] Stomata are the gateway for gas exchange between plants and the external environment, controlling water transpiration and CO2 uptake. Changes in stomatal density can change the efficiency of photosynthesis, thereby affecting the accumulation of photosynthetic pigments and growth and development inside the plant. Therefore, genetic improvement of the stomatal density of plants has important application value.
[0004] Populus plays an important role in global forestry due to its important ecological value (such as artificial forest construction and ecological restoration) and economic value (such as raw materials for the paper industry). However, drought stress seriously limits the normal growth of poplar and its geographical distribution range. Therefore, developing poplar varieties with strong drought tolerance is of great significance for improving the environmental adaptability of poplar, ensuring the efficiency of forestry production under drought stress, and improving the ecological environment. However, the molecular mechanism of drought stress in poplar is not fully understood, and there is a lack of key genes that play a core regulatory role in the genetic improvement of poplar drought resistance, especially stomatal density, which limits the creation of new poplar varieties with drought resistance.
[0005] Therefore, it is necessary to identify genes related to the stomatal density of poplar with clear functions and significant effects, in order to improve the breeding efficiency of excellent drought-resistant poplar germplasm resources. SUMMARY
[0006] In order to overcome the above problems, the present application finds that the PtoERD7 gene is significantly related to the stomatal density of poplar, and by overexpressing the PtoERD7 gene in poplar plants, the average stomatal density of poplar can be reduced by 30.67%, and moreover, the drought resistance of the PtoERD7 gene overexpression plant is enhanced, the leaf wilting is not obvious after drought treatment, and the plant can recover to normal morphology after rehydration. It is shown that the PtoERD7 gene is a core key gene for regulating stomatal density, and by reducing the stomatal density of poplar, the drought resistance of poplar is significantly enhanced, which provides a new idea for creating new drought-resistant poplar germplasm, thereby completing the present application.
[0007] Specifically, the present application aims to provide the following aspects:
[0008] In a first aspect, a PtoERD7 gene related to the stomatal density of poplar is provided, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1.
[0009] In a second aspect, a method for reducing the stomatal density of poplar is provided, and the method is achieved by overexpressing the PtoERD7 gene or increasing the content of the encoded protein of the PtoERD7 gene.
[0010] In a third aspect, the application of the method for reducing the stomatal density of poplar in the construction of drought-resistant poplar mutants is provided.
[0011] In a fourth aspect, a breeding method for enhancing the drought resistance of poplar is provided, and the breeding method comprises the step of overexpressing the PtoERD7 gene in poplar.
[0012] In a fifth aspect, the application of the PtoERD7 gene in regulating the stomatal density of poplar or cultivating drought-resistant poplar varieties is provided.
[0013] The present application has the following beneficial effects:
[0014] (1) The PtoERD7 gene related to the stomatal density of poplar provided by the present application provides a key candidate gene for the molecular breeding process of enhancing the drought resistance of poplar by reducing the stomatal density, and significantly accelerates the breeding process of drought-resistant poplar;
[0015] (2) The method for reducing the stomatal density of poplar provided by the present application can reduce the stomatal density per unit area by 30.67%, which is of great significance for enhancing the drought resistance of poplar, improving the adaptability of poplar under adversity, and reducing the damage of drought to the yield and quality of forestry;
[0016] (3) The breeding method for enhancing the drought resistance of poplar provided by the present application is achieved by reducing the stomatal density, which provides a new idea for the creation of new stress-resistant poplar germplasm. Attached Figure Description
[0017] Figure 1 A structural diagram of the basic carrier in Example 2 is shown;
[0018] Figure 2 Image (A) shows a gel electrophoresis diagram of PCR detection of the overexpression strain in Example 4;
[0019] Figure 2 (B) in the figure shows a comparison of the relative expression levels of the overexpression lines and the wild-type lines in Example 4;
[0020] Figure 3 (A) shows a stomatal diagram of the control and overexpression lines in Example 5, with yellow dots indicating the location of stomata;
[0021] Figure 3 (B) shows the statistical results of the number of stomata per unit area in Example 5. The data is the average of 16 biological replicates, and ± indicates the standard error (n=16).
[0022] Figure 4 (A) shows a morphological comparison of wild-type (WT) and PtoERD7 overexpressing poplar lines (OE7, OE11) before and after drought treatment in Example 6, scale bar = 5 cm;
[0023] Figure 4 (B) shows a morphological comparison of leaves of wild-type (WT) and PtoERD7 overexpressing poplar lines (OE7, OE11) after drought treatment in Example 6;
[0024] Figure 4 (C) shows a morphological comparison of leaves of wild-type (WT) and PtoERD7 overexpressing poplar lines (OE7, OE11) after restoration of watering in Example 6;
[0025] Figure 4 (D) in Example 6 shows the comparison results of relative water content (RWC) and relative electrical conductivity (REC) of leaves under normal and drought stress. Detailed Implementation
[0026] The present invention will be further described in detail below through preferred embodiments and examples. Through these descriptions, the features and advantages of the present invention will become clearer and more apparent.
[0027] The term "exemplary" is used herein to mean "serving as an example, instance, or illustration." Any embodiment described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other embodiments.
[0028] In a first aspect, the present application provides a PtoERD7 gene related to the stomatal density of poplar, wherein the nucleotide sequence of the gene is shown as SEQ ID NO. 1.
[0029] In the present application, by combining the drought stress transcriptome data of five different species of poplar, i.e., P. tomentosa, P. trichocarpa, 84K poplar (P. alba x P. davidiana), P. davidiana and P. deltoides, Weighted correlation network analysis (WGCNA) analysis is carried out, and it is identified that PtoERD7 is a gene for drought tolerance of different species of poplar, and specifically, it is significantly related to the stomatal density in the drought tolerance index of poplar.
[0030] The PtoERD7 gene belongs to the Early responsive to dehydration (ERD) family. The ERD gene family can be rapidly induced for expression in the early stage of plant dehydration stress, and is an important regulatory factor in the process of plant response to abiotic stress such as drought and high salt.
[0031] Preferably, the coding region nucleotide sequence of the PtoERD7 gene is shown as SEQ ID NO. 2.
[0032] More preferably, the amino acid sequence of the encoded protein of the PtoERD7 gene is shown as SEQ ID NO. 3.
[0033] In the present application, the poplar is white poplar, preferably P. tomentosa or 84k poplar.
[0034] Among them, the 84k poplar is a clone variety generated by hybridization of P. alba and P. glandulosa (P. alba x P. glandulosa), which belongs to the white poplar family and is a preferred tree species due to its easy rooting, rapid growth, excellent wood quality and wide adaptability. At the same time, due to its more standardized transformation conditions, it is often selected as an ideal model for genetic transformation.
[0035] In a second aspect, the present application provides a method for reducing the stomatal density of poplar, which is achieved by overexpressing the PtoERD7 gene or increasing the content of the encoded protein of the PtoERD7 gene.
[0036] Preferably, the nucleotide sequence of the PtoERD7 gene is as shown in SEQ ID NO. 1, and the amino acid sequence of the protein encoded by the PtoERD7 gene is as shown in SEQ ID NO. 3.
[0037] In a preferred embodiment, the method for reducing the stomatal density of a poplar tree comprises the following steps:
[0038] Step 1, constructing a recombinant vector for overexpression of the PtoERD7 gene.
[0039] Preferably, the recombinant vector for overexpression is obtained by constructing the CDS sequence of the PtoERD7 gene onto a basic vector, which is a 35S-PZP211-3Flag vector.
[0040] More preferably, step 1 comprises the following sub-steps:
[0041] Step 1-1, obtaining the CDS sequence of the PtoERD7 gene.
[0042] Preferably, the CDS sequence of the PtoERD7 gene is obtained by amplification using primers P1 and P2, wherein,
[0043] The nucleotide sequence of the primer P1 comprises the following sequence: 5'-ctcacgggtacccgaggatccATGTCATCTCCAAAACGTAACTCTCT-3';
[0044] The nucleotide sequence of the primer P2 comprises the following sequence: 5'-agtgagagatctttggtcgacGTCTTTAATTGGTATATTCCTAGCCTTC-3'.
[0045] More preferably, the nucleotide sequence of the primer P1 is: 5'-ctcacgggtacccgaggatccATGTCATCTCCAAAACGTAACTCTCT-3';
[0046] The nucleotide sequence of the primer P2 is: 5'-agtgagagatctttggtcgacGTCTTTAATTGGTATATTCCTAGCCTTC-3'.
[0047] In the present application, both the primers P1 and P2 are gene primers with homologous arms (the lowercase part of the primer sequence described above).
[0048] In a preferred embodiment, the target fragment is obtained by cloning using primers P1 and P2 with poplar cDNA as the template.
[0049] In the present application, the cloned target fragment is provided with homologous arms.
[0050] Step 1-2, the CDS fragment of PtoERD7 is connected with the enzyme-digested basic vector.
[0051] In a preferred embodiment, the basic vector is digested by endonuclease BamH I and Sal I.
[0052] Further, the enzyme-digested basic vector is mixed with the CDS fragment, and T4 ligase is used for connection at room temperature for 10 min.
[0053] Preferably, the system of the above connection reaction is as follows: CDS fragment 10 μL; enzyme-digested basic vector 7 μL; 10×buffer 2 μL; T4 ligase 1 μL.
[0054] Step 1-3, the recombined vector after connection is identified.
[0055] In a preferred embodiment, the connection product is transformed into E. coli competent cells, and positive clones are identified by bacterial liquid PCR.
[0056] Further, the plasmid of the positive clones is extracted, and finally the overexpression recombined vector of the PtoERD7 gene which is constructed successfully is obtained.
[0057] Step 2, the overexpression recombined vector is transformed into Agrobacterium.
[0058] The overexpression recombined vector plasmid of the PtoERD7 gene which is constructed successfully is transformed into Agrobacterium, and preferably the Agrobacterium is GV3101.
[0059] Step 3, the Agrobacterium liquid is used for infection, proliferation, differentiation and rooting culture of poplar plants, and overexpression transgenic plants are obtained.
[0060] Preferably, the poplar material is 84k poplar.
[0061] Further, the Agrobacterium liquid is used for infection of poplar leaves, and then the complete poplar plants are obtained through co-culture, differentiation culture and rooting culture.
[0062] In a preferred embodiment, the obtained overexpression transgenic plants are identified by the methods of PCR detection and RT-qPCR (real-time fluorescent quantitative PCR) detection.
[0063] Preferably, the PCR detection is amplified by primer P3 and primer P4, the sequence of primer P3 is 5'-ATGTCATCTCCAAAACGTAACTCTCT-3', and the sequence of primer P4 is 5'-TGTGCTGCAAGGCGATTAAG-3'.
[0064] More preferably, the RT-qPCR detection is performed by using primer P5 with the sequence of GGCAGAGAATCTCTTCCCTG and primer P6 with the sequence of AATCCCCACAAGCCAGTTCC.
[0065] In the present application, preferably, the plant with specific bands in the PCR detection result and significantly increased PtoERD7 gene transcription level in the RT-qPCR result is the overexpression transgenic line.
[0066] In a preferred embodiment, the method for reducing the stomatal density of poplar further comprises:
[0067] Step 4: Phenotypic identification of stomatal density and evaluation of drought resistance of the PtoERD7 overexpression transgenic plant identified as positive.
[0068] In the present application, in order to further clarify the mechanism behind the enhanced drought response in the overexpression transgenic line, the stomatal density (the number of stomata per unit area) of the transgenic plant is analyzed, and compared with the control, the number of stomata per unit area of the PtoERD7 overexpression line is significantly reduced, and the average stomatal density is reduced by 30.67%.
[0069] Preferably, the drought resistance evaluation shows that after 7 days of drought treatment, the top tender part of the overexpression plant appears a slight wilting state, and after rehydration, it can recover to normal morphology;
[0070] Under drought stress, the cell membrane damage of the overexpression plant is lower, and its ion permeability is only 32.25%-36.98%;
[0071] The PtoERD7 overexpression poplar plant obtained by the method comprising the above steps has significantly reduced stomatal density and significantly enhanced drought resistance.
[0072] The method for reducing the stomatal density of poplar provided by the present application is beneficial to breeding new poplar germplasm with strong drought resistance, improving the adaptability of poplar to drought environment, and shortening the breeding period.
[0073] In a third aspect, the present application provides the use of the method for reducing the stomatal density of poplar according to the second aspect in constructing drought-resistant poplar mutants.
[0074] In a fourth aspect, the present application provides a breeding method for enhancing the drought resistance of poplar.
[0075] Preferably, the drought resistance of poplar is enhanced by reducing the stomatal density.
[0076] In a preferred embodiment, the breeding method for enhancing drought tolerance of poplar comprises the step of overexpressing the PtoERD7 gene of the first aspect in poplar.
[0077] Preferably, overexpression of the PtoERD7 gene in poplar is achieved by introducing a PtoERD7 gene overexpression recombinant vector into a poplar plant.
[0078] More preferably, the PtoERD7 gene overexpression recombinant vector is obtained by constructing a CDS sequence of the PtoERD7 gene on a basic vector,
[0079] wherein the CDS sequence of the PtoERD7 gene is shown as SEQ ID NO. 2, and the basic vector is 35S-PZP211-3Flag vector.
[0080] In a fifth aspect of the present application, the PtoERD7 gene of the first aspect is provided for use in regulating the stomatal density of poplar or cultivating drought-resistant poplar varieties.
[0081] Preferably, the poplar is white poplar, preferably Chinese white poplar or 84k poplar.
[0082] Examples
[0083] The present application is further described below by specific examples, but these examples are merely exemplary and do not constitute any limitation on the scope of protection of the present application.
[0084] Unless otherwise specified, the reagents involved in the following examples are commercially available conventional reagents, and the methods used are commonly used methods in the art.
[0085] Example 1 Obtaining of PtoERD7 gene CDS fragment
[0086] The CDS sequence of the drought-resistant PtoERD7 gene of Chinese white poplar (as shown in SEQ ID NO. 2) is obtained according to the genomic sequence of Chinese white poplar (website https: / / db.cngb.org / search / sample / CNS0752799 / ; reference paper: https: / / onlinelibrary.wiley.com / doi / full / 10.1111 / pbi.14108), and the overexpression primers P1 and P2 for amplifying the target fragment are designed by using primer blast tool (NCBI, https: / / blast.ncbi.nlm.nih.gov) considering various principles of primer design, wherein the sequence of primer P1 (forward primer) is: 5'-ctcacgggtacccgaggatccATGTCATCTCCAAAACGTAACTCTCT-3';
[0087] The sequence of primer P2 (reverse primer) is: 5'-agtgagagatctttggtcgacGTCTTTAATTGGTATATTCCTAGCCTTC-3'.
[0088] wherein, primers P1 and P2 are gene primers with homologous arms (the lowercase part in the sequence of the above primers), which are used to amplify the target fragment (CDS fragment of PtoERD7 gene) by taking Populus tomentosa cDNA as a template.
[0089] wherein, Populus tomentosa cDNA is obtained according to the following steps:
[0090] ① Firstly, total RNA of fresh leaf tissue of Populus tomentosa is extracted by using RNA extraction kit (product name: FastPure Plant Total RNA Isolation Kit; article number: RC401-01) of Nuoyizhan, and the specific process is referred to the instruction manual of the RNA extraction kit (https: / / bio.vazyme.com / viewfilebizce / 1767349705707180032 / FastPure%20Plant%20Total%20RNA%20Isolation%20Kit-V22.1.pdf).
[0091] ② Then, the total RNA of Populus tomentosa obtained in step ① is reversely transcribed into cDNA by using reverse transcription kit (product name: HiScript III 1st Strand cDNA Synthesis Kit; article number: R312-01) of Nuoyizhan, and the instruction manual (https: / / bio.vazyme.com / viewfilebizce / 1767349619996704768 / R312%E8%AF%B4%E6%98%8E%E4%B9%A6-V22.1.pdf) is referred to, thereby obtaining the cDNA template of Populus tomentosa.
[0092] The amplification reaction system (25 μL) is shown in Table 1, and the reaction procedure is shown in Table 2.
[0093] Table 1
[0094]
[0095] Table 2
[0096]
[0097] Example 2 Construction of overexpression recombinant vector of PtoERD7 gene
[0098] (1) Enzymatic digestion of the vector
[0099] The selected overexpression base vector is 35S-PZP211-3Flag vector, as shown in Figure 1 .
[0100] The 35S-PZP211-3Flag overexpression vector is digested with BamH I and Sal I to obtain a double-stranded fragment. The enzyme digestion system is shown in Table 3. The reaction conditions are: 37°C enzyme digestion,
[0101] 30 min.
[0102] Table 3
[0103]
[0104] The enzyme-digested product is recovered and purified by using a Novizen gel recovery kit (name: FastPure Gel DNA Extraction Mini Kit; item number: DC301-01), and the process is referred to the instruction manual (instruction manual website: https: / / bio.vazyme.com / viewfilebizce / 1767349165158465536 / DC301%E8%AF%B4%E6%98%8E%E4%B9%A6-V22.1.pdf). After purification, it is used as a carrier skeleton and stored at -20°C.
[0105] (2) Ligation transformation
[0106] (2.1) Ligation expression vector
[0107] The CDS fragment of the PtoERD7 gene obtained in Example 1 is mixed with the linear vector after enzyme digestion of the base vector, and T4 ligase is used for ligation at room temperature for 10 minutes. The reaction system is: CDS fragment 10 μL; enzyme-digested base vector 7 μL; 10×buffer 2 μL; T4 ligase 1 μL. The ligation product is used for transformation of E. coli.
[0108] (2.2) Transformation of E. coli DH5α competent cells
[0109] The main process of transforming E. coli is as follows:
[0110] ① The E. coli competence is taken out from -80°C and thawed on ice for 10 minutes in advance.
[0111] ② 8 μL of ligation product is added to the competence, and then mixed and stirred gently on ice for 20 minutes.
[0112] ③ The competence with the ligation product is heat shocked at 42°C for 60-90 seconds.
[0113] (4) After heat shock, quickly ice bath for 2 minutes.
[0114] (5) Add 950 μL of LB liquid medium without resistance into the tube, shake at 37°C,
[0115] 1 hour.
[0116] (6) Centrifuge at 8000 rpm for 1 minute at room temperature.
[0117] (7) Discard the supernatant in the clean bench, leave a little about 50 μL, and mix the precipitate by pipetting and spreading on LB solid medium containing rifampicin antibiotic.
[0118] (8) Incubate in a 37°C incubator overnight.
[0119] (2.3) Identification of positive clones by PCR of bacterial solution
[0120] The PCR experiment system of bacterial solution is shown in Table 4.
[0121] Table 4
[0122]
[0123] Take out the overnight culture plate, select normal growth bacterial spots, and put them into the mixed screening system for PCR reaction (reaction program is shown in Table 5).
[0124] Table 5
[0125]
[0126]
[0127] (2.4) Extraction of plasmid from positive clones
[0128] The plasmid extraction uses the Novizen plasmid extraction kit (name: 8min FastPure Plasmid MiniKit; article number: DC221-01), and the specific process (detailed process is shown in the instruction https: / / bio.vazyme.com / viewfilebizce / 1859125199465156608 / DC221%20%E5%8D%95%E9%A1%B5%E7%89%88%E8%AF%B4%E6%98%8E%E4%B9%A6%20V24.1.pdf) is as follows:
[0129] (1) Take 1 ml of overnight culture solution, centrifuge at 12,000 rpm (13,400 x g) for 1 minute, and completely discard the supernatant.
[0130] ② Add 150 μl Buffer P1 containing RNase A, vortex or pipette to beat until the bacterial body is completely dispersed (no particle clumps).
[0131] ③ Add 150 μl Buffer P2, gently invert 15 times until the bacterial solution is blue and clear viscous (operation not more than 3 minutes).
[0132] ④ Add 350 μl Buffer NP3, quickly invert 15 times until the blue color disappears (white flocculent precipitate appears), centrifuge at 12,000 rpm for 2 minutes.
[0133] ⑤ Transfer the supernatant to the adsorption column (put into the collection tube), centrifuge at 12,000 rpm for 30 seconds, discard the filtrate.
[0134] ⑥ Add 700 μl Buffer PW containing anhydrous ethanol, centrifuge at 12,000 rpm for 30 seconds, discard the filtrate.
[0135] ⑦ Put the adsorption column back into the collection tube, centrifuge at 12,000 rpm for 1 minute (remove residual liquid).
[0136] ⑧ Move the adsorption column to a 1.5 ml centrifuge tube, add 30 μl preheated (65℃) Elution Buffer, centrifuge at 12,000 rpm for 1 minute, discard the adsorption column.
[0137] ⑨ Store the extracted plasmid in a -20℃ refrigerator.
[0138] Through this embodiment, the recombinant plasmid obtained is: 35S::PtoERD-PZP211-3Flag.
[0139] Example 3 Genetic transformation of PtoERD7 gene
[0140] (1) Transformation of recombinant plasmid into Agrobacterium
[0141] ① Prepare the transformation system (as shown in Table 6). Among them, YEP stands for Yeast Extract Peptone Medium (Yeast Extract Peptone Medium).
[0142] Table 6
[0143]
[0144] ② Ice bath for 5 minutes, then liquid nitrogen freezing for 8 minutes, and finally 37℃ water bath for 5 minutes.
[0145] ③ After adding YEP, shake the bacteria at 28℃ for 1 hour.
[0146] ④ Centrifuge at 8000 rpm for 1 minute to collect the bacterial body.
[0147] ⑤ Spread the Agrobacterium tumefaciens transformed with the expression plasmid onto a solid culture medium containing rifampicin antibiotic; invert the medium and incubate overnight at 37°C.
[0148] (2) Infection, proliferation, differentiation and rooting culture of poplar materials
[0149] (2.1) Explant preparation
[0150] Select wild-type 84K poplar seedlings that are 4-6 weeks old, take the 3rd to 5th flat, tender green leaves, cut off the leaf tips in a clean bench, and then make 2-3 cuts perpendicular to the main vein.
[0151] (2.2) Preparation of Agrobacterium infection solution
[0152] ①Activate the target Agrobacterium once by streaking it onto YEP solid medium containing rifampicin.
[0153] ② Pick a single colony and inoculate it into 20 mL of liquid YEP medium. Place it in a shaker at 28°C and shake at 200 rpm for 12 hours.
[0154] ③ Take 100 μL of bacterial culture and transfer it to 100 mL of YEP liquid medium containing rifampicin antibiotic. Incubate overnight (10 hours) at 28°C with shaking at 200 rpm.
[0155] ④ Centrifuge at 8000 rpm for 10 minutes at room temperature, discard the supernatant, resuspend the bacterial cells in sterile suspension to prepare the infection solution (as shown in Table 7).
[0156] Table 7
[0157]
[0158] (2.3) Infection
[0159] Immerse the cut leaves in the infection solution and gently shake for 10 minutes. Blot off excess bacterial solution with sterile filter paper. Place the leaves face down on a differentiation medium containing acetylsylgenin (AS) at pH 5.2 and incubate in the dark at 25°C for 48 hours. The composition of the differentiation medium is shown in Table 8.
[0160] Table 8
[0161]
[0162] (2.4) Sterilization and screening
[0163] ① After dark culture, the leaves were washed three times with sterile water containing 100 mg / L termethin, then washed twice with sterile water and dried.
[0164] ② Transfer the leaves to a differentiation medium containing termethin at pH 5.8, and change the medium every 8 days.
[0165] (2.5) Rooting culture
[0166] When the resistant shoots grow to 3-5 cm, they are cut off and transferred to a rooting medium containing termethin. The rooting medium is shown in Table 9.
[0167] Table 9
[0168]
[0169] In this embodiment, reagents such as yeast extract and Typtone, as well as plant hormones such as NAA and IBA, are all derived from...
[0170] Purchased by China Limited Company.
[0171] Example 4 Identification of PtoERD7 gene overexpression plant
[0172] (1) Genomic DNA extraction
[0173] Using the Novizan Plant Genomic DNA Extraction Kit (name: FastPure)
[0174] Plant DNA Isolation MiniKit (catalog number: DC104-01), follow the standard procedure for this kit (website: https: / / bio.vazyme.com / viewfilebizce / 1767350474141548544 / F).
[0175] (astPure%20Plant%20DNA%20Isolation%20Mini%20Kit-V20.1.pdf) was used to extract genomic DNA from control and overexpression lines. The main procedure is as follows:
[0176] ① Take ≤100mg of fresh plant tissue or ≤20mg of dried tissue, grind it into powder with liquid nitrogen, and transfer it to a 1.5ml centrifuge tube.
[0177] ② Add 400 μl Buffer A1 and 4 μl RNase A, vortex to mix, and incubate in a 65°C water bath for 10 minutes.
[0178] ③ Add 130 μl of Buffer A2, mix well, incubate on ice for 5 minutes, centrifuge at 14,000 rpm for 5 minutes, and collect the supernatant.
[0179] (4) Add 1.5 times Buffer A3 (containing anhydrous ethanol) to the supernatant, and mix immediately.
[0180] (5) Transfer the mixed solution to the adsorption column in batches, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate.
[0181] Add 600 μl Buffer AW (containing anhydrous ethanol) and centrifuge for 30 seconds, repeat once.
[0182] (6) Centrifuge the empty column at 12,000 rpm for 2 minutes, then add 50-100 μl of preheated (65-70°C) Elution Buffer to the center of the membrane, stand at room temperature for 3-5 minutes, centrifuge at 12,000 rpm for 1 minute, and collect the DNA.
[0183] (7) Store the DNA in the refrigerator at -20°C.
[0184] (2) PCR identification
[0185] (1) PCR system as shown in Table 10:
[0186] Table 10
[0187]
[0188]
[0189] (2) Reaction procedure: 95°C pre-denaturation for 5 minutes; (95°C denaturation for 15 seconds, 58°C annealing for 2 minutes, 72°C extension for 30 seconds), 35 cycles; 72°C final extension for 5 minutes, 4°C storage.
[0190] The sequence of primer P3 (gene primer) is: 5'-ATGTCATCTCCAAAACGTAACTCTCT-3';
[0191] The sequence of primer P4 (vector primer) is: 5'-TGTGCTGCAAGGCGATTAAG-3'.
[0192] (3) Electrophoresis detection: The PCR product is subjected to 1% agarose gel electrophoresis, compared with the positive control (PCR product of the target gene), and the plants showing specific bands are positive overexpression lines, as shown in (A) of Figure 1. Figure 2 It can be seen that the overexpression plants numbered OE1-OE12 have positive PCR detection results.
[0193] (3) Expression quantification
[0194] ① cDNA synthesis: total RNA was extracted using the RNA extraction kit from Novagen (product name: FastPure Plant Total RNA Isolation Kit; item number: RC401-01); and then the reverse transcription kit from Novagen (product name: HiScript III 1st Strand cDNA Synthesis Kit; item number: R312-01) was used to obtain the cDNA template.
[0195] ② The RT-qPCR system is shown in Table 11:
[0196] Table 11
[0197]
[0198]
[0199] The sequence of the quantitative primer P5 is: GGCAGAGAATCTCTTCCCTG;
[0200] The sequence of the quantitative primer P6 is: AATCCCCACAAGCCAGTTCC.
[0201] ③ Reaction procedure: reaction procedure: 95°C pre-denaturation for 30s; 95°C denaturation for 10s, 59°C annealing for 30s, 40 cycles; melting curve analysis.
[0202] ④ Data calculation: taking Actin gene as the internal reference, the relative expression amount of the target gene was calculated by the 2 -ΔΔCt method (for details, see the reference “Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method”; website: https: / / www.sciencedirect.com / science / article / pii / S1046202301912629?via=3Dihub), the expression difference between the transgenic lines and WT was compared, and the results are shown in (B) of Figure 2 .
[0203] After the above PCR identification and RT-PCR identification, the overexpression plants numbered OE7 and OE11 had specific bands, and the expression amounts were 10.2 and 11.3 times that of the control, respectively, so OE7 and OE11 were used as PtoERD7 overexpression transgenic plants.
[0204] Example 5 Analysis of stomatal density of PtoERD7 gene overexpression plant
[0205] To further elucidate the mechanism behind the enhanced drought response in the transgenic lines overexpressing PtoERD7, the number of stomata per unit area was analyzed in PtoERD7 gene overexpression plants and wild type plants (WT) using a Leica DM2500 optical microscope. The stomata map is shown in (A) of Figure 3 , where the stomata positions are marked with yellow dots. The stomata measurement method is as follows:
[0206] ① Select PtoERD7 overexpression plants and wild type (WT) plants that have grown for 2 months; collect mature leaves from the same part of each plant (such as the 6th-7th fully expanded leaves), and cut 3-5 mm2 leaf pieces with a sharp knife, taking 3 replicates from each plant. 2
[0207] ② Fixation and decolorization: immediately place the leaf pieces in a disposable plastic dish and immerse them in 100% ethanol, replacing the ethanol every 30 minutes for 3 times, until the leaves are completely transparent.
[0208] ③ Gradient rehydration: rehydrate according to the following gradient, and place each gradient at room temperature for 15 minutes: 90% ethanol; 75% ethanol; 50% ethanol; 15% ethanol; distilled water.
[0209] ④ Chloral hydrate transparency treatment. Transfer the rehydrated sample to a chloral hydrate solution (chloral hydrate: water: glycerol = 8:1:1, w:v:v), and place it at room temperature for 24 hours to further transparentize the tissue.
[0210] ⑤ Mounting: place the sample on a glass slide, add 1-2 drops of chloral hydrate solution, cover with a cover glass, and gently press to remove air bubbles.
[0211] ⑥ Observation: use a Leica DM 2500 optical microscope to observe the lower epidermis of the leaf and take images of the stomata.
[0212] Further, the statistical results of the number of stomata per unit area are shown in (B) of Figure 3 , where the data is the average of 16 biological replicates, and ± indicates the standard error (n=16).
[0213] As can be seen from (A) and (B) of Figure 3 , compared with the control, the stomata density of the PtoERD7 overexpression lines per unit area is significantly reduced, with an average stomata density decrease of 30.67%.
[0214] Example 6 Evaluation of drought resistance of PtoERD7 gene overexpression plant
[0215] To evaluate the effect of PtoERD7 overexpression on drought tolerance of poplar, PtoERD7 overexpression plants (OE7, OE11) and wild type (WT) were subjected to drought stress under the same condition, and then watered for 2 days after stress treatment.
[0216] The specific treatment method is as follows: the tissue culture seedlings are transplanted into mixed soil (vermiculite: grass carbon soil: flower soil = 1:1:3) and placed in an artificial climate chamber for growth (artificial climate chamber light cycle: 16 hours light, 8.0 hours darkness; relative humidity: 40%-45%; temperature 24°C during light, 20°C during darkness). The PtoERD7 overexpression plants and wild type that have grown normally for 7 weeks after transplanting are subjected to short-term drought treatment. Before treatment, water is poured in sufficient amount. When the relative water content of the soil decreases to 70%, short-term drought stress treatment is started.
[0217] The results of morphological comparison of the overexpression plants and wild type plants are shown in (A) of FIG. 7, which shows that on the 7th day of drought stress, the wild type plants are severely wilted as a whole, and the young stem ends are almost dried; while the PtoERD7 overexpression lines have less wilted leaves. Figure 4
[0218] Further, the relative water content of the leaves shows that the relative water content of the leaves of the PtoERD7 overexpression lines is 1.35 times that of the wild type (as shown in (D) of FIG. 7), which also supports the result that the PtoERD7 overexpression lines have less wilted degree than the wild type under drought stress. After recovery watering, the WT plants have limited recovery ability, especially the young stem ends are difficult to recover, while the PtoERD7 overexpression lines can recover to normal morphology (as shown in (B) and (C) of FIG. 7). Figure 4 Figure 4
[0219] It is found by evaluating electrolyte leakage through relative electrical conductivity (REC) that the cell membrane damage of the overexpression plants and the wild type increases under drought stress, but the membrane damage of the PtoERD7 overexpression plants is significantly lower, with an ion leakage rate of 32.25%-36.98%, while that of the WT is 52.56% (as shown in (D) of FIG. 8). This result shows that the PtoERD7 overexpression lines have higher tolerance under drought stress due to the decrease of stomatal density. Therefore, the PtoERD7 overexpression lines have lower wilted degree and cell membrane damage degree compared with the wild type. Figure 4
[0220] Relative conductivity measurements were determined according to the method described in the literature "PeCHYR1, a ubiquitin E3 ligase from Populus euphratica, enhances drought tolerance via ABA-induced stomatal closure by ROS production in Populus" (available at: https: / / onlinelibrary.wiley.com / doi / full / 10.1111 / pbi.12893).
[0221] The present application has been described in detail by the specific implementation and exemplary examples, but these descriptions cannot be understood as limiting the present application. Those skilled in the art understand that the technical solutions and implementation of the present application can be variously replaced, modified or improved without deviating from the spirit and scope of the present application, and these all fall within the scope of the present application.
Claims
1. A PtoERD7 gene associated with stomatal density in poplar trees, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. The PtoERD7 gene according to claim 1, characterized in that, The coding region nucleotide sequence of the PtoERD7 gene is shown in SEQ ID NO.
2.
3. The PtoERD7 gene according to claim 1, characterized in that, The amino acid sequence of the protein encoded by the PtoERD7 gene is shown in SEQ ID NO.
3.
4. A method for reducing the stomatal density of poplar trees, characterized in that, The method is achieved by overexpressing the PtoERD7 gene or increasing the content of the protein encoded by the PtoERD7 gene.
5. The method according to claim 4, characterized in that, The method includes the following steps: Step 1: Construct a recombinant vector for overexpression of the PtoERD7 gene; Step 2: Transform the overexpression recombinant vector into Agrobacterium; Step 3: Poplar plants were infected, proliferated, differentiated, and rooted using Agrobacterium tumefaciens solution to obtain overexpressing transgenic plants; Step 4: Stomatal density phenotype identification and drought resistance assessment were performed on transgenic plants that were identified as positive for PtoERD7 gene overexpression.
6. The method according to claim 5, characterized in that, In step 1, the overexpression recombinant vector is obtained by constructing the CDS sequence of the PtoERD7 gene into a base vector, which is the 35S-PZP211-3Flag vector.
7. The application of the method for reducing poplar stomatal density as described in any one of claims 4 to 6 in the construction of drought-resistant poplar mutants.
8. A breeding method for enhancing the drought resistance of poplar trees, characterized in that, The breeding method includes the step of overexpressing the PtoERD7 gene as described in any one of claims 1 to 3 in poplar trees.
9. The application of the PtoERD7 gene as described in any one of claims 1 to 3 in regulating stomatal density in poplar trees or in breeding drought-resistant poplar varieties.