Application of NnCIGR1 gene in increasing plant biomass and stalk mechanical force

Abstract

The invention discloses application of an NnCIGR1 gene in increasing plant biomass and stalk mechanical force, and belongs to the technical field of biology. Researches find that the biomass, including the plant fresh weight, the leaf area size, the fruit number and size, of a transgenic tobacco strain of the overexpressed lotus NnCIGR1 gene is remarkably improved, and the plant stem thickness and mechanical force are also remarkably enhanced, which indicates that the overexpressed NnCIGR1 gene can remarkably increase the plant biomass and the stem mechanical force, so that the transgenic tobacco strain has the advantages of high yield, high yield and the like. The lodging-resistant capability of the plants is improved. The invention provides new gene resources and theoretical basis for molecular breeding and genetic improvement of lotus.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to the application of NnCIGR1 gene in increasing plant biomass and stem mechanical force. BACKGROUND

[0002] Nelumbo nucifera, Nymphaeaceae Salisb., Subfam. Nelumboideae, Nelumbo Adans. plant. Also known as lotus, lotus, water lotus, its resources are rich, varieties are various, cultivation area is extensive, is the only aquatic flower in China's ten traditional famous flowers, set edible, medicinal, ornamental in one. Based on the difference of long-term artificial breeding target, lotus has formed three groups of lotus, lotus and flower lotus, and the application scene is further expanded by the diverse flower type, flower color and plant type characteristics. However, in actual cultivation, the biomass accumulation and stem lodging resistance of lotus are still the key factors restricting its yield and ornamental value, therefore, analyzing the regulation mechanism of biomass accumulation and stem mechanical force has important guiding significance for lotus variety improvement.

[0003] The mechanical strength of stem (such as bending resistance, thickness, and wall thickness) is the core of the plant resistance to lodging, which is closely related to biomass allocation. The mechanical strength of stem is determined by the morphological characteristics (such as plant height, internode length, stem thickness, and gravity center height) and the tissue structure and chemical composition (such as cell wall thickness, cellulose, and lignin content). Morphologically, the stem is composed of repeated units of internodes and nodes, and the spatiotemporal specificity of these units determines the overall structure of the stem. The length and thickness of the internode are the key factors affecting the strength. Generally, the increase in the thickness of the internode can improve the bending resistance, and the appropriate length can help balance the growth and support functions. Chemically, the mechanical properties of the stem are mainly determined by the cell wall, which is a heterogeneous composite network composed of cellulose, hemicellulose, lignin, and a small amount of functional molecules (such as expansin and pectin). The cell wall not only provides morphological support for cells but also regulates the strength of the stem through the proportion of components and structural arrangement. Cellulose, as the skeleton material of the cell wall, is a crystalline microfibril formed by β-1,4-glucan chains through hydrogen bonding, which is the core component determining the strength and flexibility of the stem. Defects in cellulose biosynthesis can cause the stem to become brittle and the mechanical force to decrease dramatically. In barley, wheat, corn, rape, and rice, the mechanical strength of the stem decreases with the decrease in cellulose content. Hemicellulose is a widely used polysaccharide, which mainly interacts with cellulose and lignin to stabilize the cell wall. Lignin, the second largest polymer in plant cell walls after cellulose, mainly accumulates in the thickened secondary cell wall and is one of the main components determining the strength of the cell wall and the hardness of the stem. The contents of cellulose, hemicellulose, and lignin in the stem are positively correlated with the strength of the stem. The decrease in the content of one or more substances or the change in their proportions will cause the stem to become brittle. The cellulose content of the brittle stem mutant of barley is significantly reduced due to the defect in cellulose synthesis, and even if the contents of lignin and hemicellulose remain unchanged, the stem still shows increased brittleness. The mechanical force of the stem in corn is also significantly related to the cellulose content per unit length, and the decrease in cellulose content in the mutant directly leads to a significant decrease in mechanical force. The evaluation of the mechanical strength of the stem can be quantified by specific indicators. The hardness can be measured by stem skin penetration strength, bending strength, and bending strength, and the higher the value, the stronger the resistance to deformation. The flexibility is evaluated by the bending angle, and the larger the angle, the better the elasticity, and the stronger the wind and lodging resistance. The comprehensive performance of these indicators is essentially the result of the joint action of stem morphology, chemical composition, and developmental stage.

[0004] Gibberellin (GA) is involved in many aspects of plant growth and development, acting as a plant hormone that regulates seed germination, cell elongation, flower and fruit growth and development, as well as diurnal rhythms and light regulation. At the heart of its signaling pathways are the GRAS family of transcription factors. All orthologous genes in the GRAS family possess the DELLA motif in their N-terminal regions. GIBBERELLIC ACIDINSENSITIVE (GAI), REPRESSOR OF GIBBERELLIC ACID INSENSITIVE 3 (RGA), and SCARECROW (SCR) were the first three members discovered and are considered characteristic of the GRAS protein family. They are repressors of GA transduction and play a significant role in regulating plant growth and development. The CIGR gene (Chitin-inducible Gibberellin-Responsive gene) is an important member of the plant GRAS transcription factor family, named for its ability to be induced by chitin and respond to gibberellins. Its encoded protein exhibits typical GRAS domain features, including conserved modules such as LRRI, VHIID, LRRII, PFYRE, and SAW. These domains play important roles in protein-protein interactions and signal transduction. Currently, the function of the lotus NnCIGR1 gene in stem mechanical strength and biomass formation has not been reported. In-depth research into the regulatory mechanism of NnCIGR1 gene in stem strength has significant application value for breeding new lotus varieties with high biomass and high lodging resistance. Regulating the expression of this gene through molecular means provides a new technical approach to improving the mechanical strength of lotus stems. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the NnCIGR1 gene in increasing plant biomass and stem mechanical strength, thereby addressing the problems existing in the prior art. This invention has found that transgenic tobacco lines overexpressing the lotus NnCIGR1 gene exhibit significantly increased biomass, including plant fresh weight, leaf area, and fruit quantity and size. Stem thickness and mechanical strength are also significantly enhanced. This indicates that overexpression of the NnCIGR1 gene can significantly increase plant biomass and stem mechanical strength, thereby increasing the plant's resistance to lodging. This invention provides new gene resources and theoretical basis for molecular breeding and genetic improvement of lotus.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides applications of the NnCIGR1 gene, including any of the following applications:

[0008] A1. Increase plant biomass;

[0009] A2. Increase the mechanical force of plant stems;

[0010] A3, breeding lodging-resistant plant lines;

[0011] The NnCIGR1 gene encodes a protein as shown in SEQ ID NO. 4.

[0012] The application also provides use of an expression cassette comprising the NnCIGR1 gene, including use as described in any one of the following:

[0013] A1, increasing plant biomass;

[0014] A2, increasing plant stem mechanical force;

[0015] A3, breeding lodging-resistant plant lines;

[0016] The NnCIGR1 gene encodes a protein as shown in SEQ ID NO. 4.

[0017] The application also provides use of a recombinant vector comprising the NnCIGR1 gene, including use as described in any one of the following:

[0018] A1, increasing plant biomass;

[0019] A2, increasing plant stem mechanical force;

[0020] A3, breeding lodging-resistant plant lines;

[0021] The NnCIGR1 gene encodes a protein as shown in SEQ ID NO. 4.

[0022] The application also provides use of a recombinant microorganism comprising the NnCIGR1 gene, including use as described in any one of the following:

[0023] A1, increasing plant biomass;

[0024] A2, increasing plant stem mechanical force;

[0025] A3, breeding lodging-resistant plant lines;

[0026] The NnCIGR1 gene encodes a protein as shown in SEQ ID NO. 4.

[0027] Further, the plant biomass includes plant fresh weight, leaf area size, fruit number and fruit size.

[0028] Optionally, the plant is lotus or tobacco.

[0029] The present invention also provides a method for enhancing plant biomass and stem mechanical strength, including the steps of introducing the NnCIGR1 gene into the plant using genetic transformation technology, thereby achieving stable overexpression of the NnCIGR1 gene and increasing plant biomass and stem mechanical strength.

[0030] The NnCIGR1 gene encodes a protein as shown in SEQ ID NO.4.

[0031] Furthermore, the plant biomass includes plant fresh weight, leaf area, number of fruits, and fruit size.

[0032] The present invention also provides a method for cultivating lodging-resistant plant lines, including the steps of introducing the NnCIGR1 gene into a plant using genetic transformation technology, causing the NnCIGR1 gene to be stably overexpressed, and cultivating lodging-resistant plant lines.

[0033] The NnCIGR1 gene encodes a protein as shown in SEQ ID NO.4.

[0034] Optionally, the plant may be lotus or tobacco.

[0035] The present invention discloses the following technical effects:

[0036] This invention cloned the NnCIGR1 gene from lotus, constructed an overexpression vector, transformed tobacco plants, and studied the function of the NnCIGR1 gene. The study found that the biomass of transgenic tobacco lines overexpressing the NnCIGR1 gene was significantly increased, including plant fresh weight, leaf area, and fruit number and size. Stem thickness and mechanical strength were also significantly enhanced. This indicates that overexpression of the NnCIGR1 gene can significantly increase plant biomass and stem mechanical strength, thereby increasing the plant's resistance to lodging. This invention is the first to clearly define the function of the NnCIGR1 gene in biomass synthesis and enhancing stem mechanical strength. The research results of this invention enrich the research on this type of gene in lotus and provide new gene resources and theoretical basis for molecular breeding and genetic improvement of lotus. Attached Figure Description

[0037] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0038] Figure 1 The results of amino acid sequence alignment between the lotus NnCIGR1 gene and the rice OsCIGR1 gene;

[0039] Figure 2 The diagram below illustrates the construction process of the pGWB418(4xMyc)-NnCIGR1 vector: A represents the structure of the pGWB418(4xMyc)-NnCIGR1 vector; B represents the construction flowchart of the pGWB418(4xMyc)-NnCIGR1 vector; C represents the NnCIGR1 gene structure; LB: left border of T-DNA; 35S: cauliflower virus 35S promoter; NOS: terminator; RB: right border of T-DNA.

[0040] Figure 3 A schematic diagram of the Agrobacterium-mediated genetic transformation system of wild-type tobacco leaf discs;

[0041] Figure 4 The results show the identification and expression level analysis of positive seedlings of NnCIGR1 overexpressing transgenic tobacco lines; where A is the electrophoresis image of PCR amplification products of NnCIGR1 overexpressing transgenic positive seedlings; lanes 4-12 represent the overexpressing transgenic positive lines OE-1, 4, 5, 6, 10, 12, 16, 17, and 24; and B is the detection result of NnCIGR1 expression level in the transgenic overexpressing lines.

[0042] Figure 5 The biomass results of the T3 generation transgenic lines overexpressing NnCIGR1 are shown below. A shows the plant height and fresh weight of the wild-type (WT) and NnCIGR1 (OE) lines; B shows the leaf size of the WT and NnCIGR1 (OE) lines; and C shows the fruit quantity and size of the WT and NnCIGR1 (OE) lines.

[0043] Figure 6 The results of stem mechanical force measurement of the T3 generation of NnCIGR1 overexpressing transgenic lines are shown in Figure A; Figure B shows the stems of WT and NnCIGR1(OE) lines at maturity; Figure B shows the stem mechanical force test results of WT and NnCIGR1(OE) lines. Detailed Implementation

[0044] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0045] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0046] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0047] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0048] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0049] Example 1: Isolation and Cloning of the NnCIGR1 Gene

[0050] Using the lotus cultivar 'Gele Lingyin' (provided by the National Lotus Germplasm Resource Bank of Southwest Forestry University) as experimental material, total RNA was extracted from the petioles of 'Gele Lingyin' using the Eastp® Super Total RNA Extraction Kit (purchased from Promega, USA). After RNA extraction, the samples were treated with DNase I (purchased from Promega). RNA integrity was detected by 1.2% (w / v) agarose gel (EtBr) electrophoresis (5V / cm). Nucleic acid concentration was determined using an IMPLEN NanoPhotometer-N50 series ultra-micro UV spectrophotometer (Germany). RNA with a 260 / 280 ratio between 1.9 and 2.1, a 260 / 230 ratio greater than 2.0, and a concentration greater than 500 ng / μL was used for further analysis. cDNA synthesis was performed using the Hiscript® II Q RT SuperMix for qRNA (+gDNA wiper) kit (purchased from Vazyme, China). Using 1 μg total RNA as a template, it was mixed with 4 μL of 4×gDNA wiper Mix and DEPC-water to a total volume of 16 μL. The mixture was incubated at 42°C for 2 min, then quenched on ice for 2-3 min. Next, 4 μL of 5×Hiscript II qRT Super Mix was added and mixed to a total volume of 20 μL. The mixture was then incubated at 50°C for 15 min, followed by 85°C for 5 sec. Each cDNA sample was diluted to 200 μL and stored at -20°C for later use.

[0051] The target band was amplified using in-fusion cloning primers NnCIGR1-418F and NnCIGR1-418R, amplified using TransTaq HiFi DNA Polymerase (Beijing TransGen Biotech Co., Ltd.). PCR reaction conditions were: 94 ℃ pre-denaturation for 1 min; 31 cycles of 94 ℃ for 30 sec, 60 ℃ for 30 sec, 72 ℃ for 2 min 26 sec; extension at 72 ℃ for 5 min. The PCR product was then cloned into the pGWB418 vector. Recovery of the target fragment was performed using the UNIQ-10 column DNA gel extraction kit (Sangon Biotech (Shanghai) Co., Ltd.). The ligation system for the target fragment and the pGWB418 linearized vector was: 4.5 μL target fragment, 0.5 μL pGWB418 vector (Wuhan Protech Biotechnology Co., Ltd.), and 5 μL Solution I (Takara Bio Inc. (Dalian) Co., Ltd.), ligated overnight at 16 ℃. The ligation product was transformed into DH5α competent cells by heat excitation. The bacterial culture was plated on LB agar plates containing 100 mg / L Kan antibiotic. After approximately 10-12 hours of growth, single colonies were selected for PCR using primers NnCIGR1-418F and NnCIGR1-418R. Positive colonies were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0052] NnCIGR1-418F:5' GACTTGAACGGTAGCGCT TTTTCAGACGAGCAACCAATG 3', SEQ ID NO.1 (underscore indicates 418 connector).

[0053] NnCIGR1-418R:5' TCGGGGAAATTCGAGCTC CTATTGATCTCAGTGCCAGG 3', SEQ ID NO.2 (underlined is 418 connector).

[0054] Sequencing revealed the target band as shown in SEQ ID NO.3. Further analysis identified the gene as NnCIGR1, with a full-length nucleotide sequence of 1979 bp, containing a 1764 bp open reading frame (positions 35-1798 of SEQ ID NO.3). Amino acid sequence alignment using ClustalX (Thompson JD, Gibson TJ, Plewniak F, et al. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research, 1997, 25:4876-82.) showed high amino acid homology (59.97%) to the OSCIGR1 gene in rice, consistent with the results obtained from NCBI alignment. Figure 1 The amino acid sequence encoded by the NnCIGR1 gene is shown in SEQ ID NO.4.

[0055] SEQ ID NO.3:

[0056]

[0057] SEQ ID NO.4:

[0058] .

[0059] Example 2: Obtaining transgenic tobacco plants overexpressing NnCIGR1

[0060] (1) Construction of plant overexpression vectors

[0061] Afel and Sacl restriction sites were added to both ends of the cloning and amplification primers, respectively. The pGWB418 vector was double-digested with AfeI and SacI. The digestion system was as follows: 15 μL pGWB418 (1700 ng / μL), 5 μL rCutsmartt Buffer, 1 μL AfeI (10000 U / L), 1 μL SacI (20000 U / L), and sterile water was added to a final volume of 50 μL. The digestion was carried out overnight at 37 °C. After 1% agarose gel electrophoresis, the single linearized vector fragment was recovered.

[0062] The PCR product obtained from the above amplification was ligated into the linearized pGWB418(4xMyc) vector using an infusion enzyme. Positive clones were screened and sequenced for identification, thus obtaining the lotus NnCIGR1 transgenic overexpression vector pGWB418(4xMyc)-NnCIGR1-NOS. Its T-DNA region contains a kanamycin-resistant gene sequence, and the promoter for NnCIGR1 overexpression is the 35S promoter (see...). Figure 2 ).

[0063] (2) Genetic transformation of tobacco

[0064] The recombinant plasmid (i.e., the overexpression vector) pGWB418-NnCIGR1-NOS was transformed into Agrobacterium GV3101 using the conventional leaf disc infection method. Seedlings were then selected and differentiated. The specific steps are as follows: Figure 3 ):

[0065] a. Infection: Wash the tender terminal leaves of wild tobacco shoots with 75% alcohol for 1 minute, then wash with 0.1% mercuric chloride solution for 5 minutes, and finally wash three times with sterile water. Use sterile tweezers and scissors to remove the leaf margins and midribs, cutting the leaves to a size of 1×1cm. Place the leaves in the pre-shaken bacterial solution for 10 minutes. After infection, carefully remove the leaves and lay them flat on sterilized filter paper, turning them over to air dry. This allows most of the infection solution to be filtered out. After the excess bacterial solution is absorbed, place the leaves flat at the four corners on a petri dish, with the leaf surface facing up, and incubate in the dark for 3 days.

[0066] b. Differentiation: After 3 days of dark culture, the explants were transferred to differentiation medium (MS inorganic salts and trace elements 4.404 g / L, sucrose 30 g / L, Agar 6.8 g / L, 6-BA 2.25 mg / L, NAA 0.3 mg / L, pH adjusted to 5.8-5.9, sterilized and cooled, and then Kana 50 mg / L and Cef 400 mg / L antibiotics were added). The medium was cultured at 24°C for 16 h of light and 8 h of dark.

[0067] c. Bud strengthening: After adventitious buds emerge, remove as much callus tissue as possible and transfer the bud strengthening medium (MS inorganic salts and trace elements 4.404 g / L, sucrose 30 g / L, Agar 6.8 g / L, 6-BA 2.25 mg / L, NAA 0.3 mg / L, adjust the pH of the medium to 5.8-5.9, sterilize and cool, then add Kana 50 mg / L and Cef 400 mg / L antibiotics) for 30 days of culture under the following conditions: 24℃, 16 h light / 8 h dark culture.

[0068] d. Rooting culture: Once the roots are robust and healthy, transfer them to a solid rooting medium (MS formula from 1962, containing 4.404 g / L inorganic salts and trace elements, 30 g / L sucrose, 6.8 g / L Agar, sterilized and cooled, then adding 50 mg / L Kana and 400 mg / L Cef antibiotics) to promote rooting.

[0069] (3) Identification of transgenic plants

[0070] a. Extraction of genomic DNA from wild-type tobacco leaves

[0071] DNA extraction was performed using the standard CTAB method. The specific steps were as follows: Young wild-type tobacco leaves (1-2 cm in length) were placed in a pre-cooled mortar and ground with liquid nitrogen 2-3 times until a fine paste was formed. The paste was then transferred to a 1.5 mL centrifuge tube, and 700 μL of 2x CTAB solution was added. The mixture was incubated at 70°C for 30 min, with gentle shaking every 6 min, followed by another 30 min incubation at 70°C with gentle shaking every 10 min. After cooling to room temperature, 700 μL of a 25:24:1 Tris-saturated phenol:chloroform:isoamyl alcohol solution was added, and the mixture was repeatedly inverted and gently shaken approximately 40 times. The mixture was centrifuged at 3100 rpm for 15 min at room temperature. Approximately 500 μL of the supernatant was collected, and an equal volume of a 24:1 chloroform:isoamyl alcohol solution was added. The mixture was then centrifuged at 3100 rpm for 15 min at room temperature. Discard the supernatant, add 1 mL of frozen -20°C anhydrous ethanol, incubate at -20°C for 30 min, then centrifuge at 12000 rpm for 10 min at room temperature. Wash with 75% ethanol and repeatedly pipette the precipitate for 3 min to remove salt. Discard the ethanol, air dry, and dissolve each sample in 30-50 μL of ddH2O. Analyze the extracted genomic DNA from *Tobacco Brassica oleracea* using a Nanodrop micro-nucleic acid analyzer.

[0072] b. Detection of positive transgenic plants

[0073] Young leaves of the transformed plants were collected, and DNA was extracted and positive seedlings were identified using the CTAB method. The primers used were NnCIGR1-418F and NnCIGR1-418R. The control was a non-transgenic wild-type plant (WT).

[0074] The test results show that ( Figure 4 (A) All nine transformed plants were able to amplify the expected size electrophoretic band (1807bp), while the wild type and ddH2O control did not have electrophoretic bands, indicating that the transgenic tobacco genome already contains exogenous gene DNA fragments.

[0075] (4) qRT-PCR identification of transgenic tobacco overexpressing NnCIGR1

[0076] a. Extraction of genomic RNA from wild-type tobacco leaves

[0077] Total RNA was extracted from leaves of WT and NnCIGR1-overexpressing positive lines identified in step (3) using the Eastep® Super Total RNA Extraction Kit (Promega, USA). The RNA was then reverse transcribed into cDNA using the Hiscript® II Q RTSuperMix for qRNA (+gDNA wiper) Kit (Vazyme, China).

[0078] b. Real-time quantitative PCR

[0079] To determine whether NnCIGR1 is overexpressed in tobacco, the transgenic plants identified in step (3) were analyzed using quantitative real-time PCR (qRT-PCR). The qRT-PCR kit used was the SYBR® Green Realtime PCR Master Mix-Plus kit (Takara Bio Engineering (Dalian) Co., Ltd.). The qRT-PCR primers for the NnCIGR1 gene were:

[0080] Q-NnCIGR1-F: 5' TTCACCACACACCCGATGAG 3', SEQ ID NO.5;

[0081] Q-NnCIGR1-R: 5' GTCGGAACCCTGCCATTGTA 3', SEQ ID NO. 6.

[0082] PCR program: 95℃ pre-denaturation for 30 seconds, followed by 40 cycles (95℃ 10 seconds, 60℃ 10 seconds, 72℃ 40 seconds). The transgenic plants identified in step (3) were analyzed, and the overexpressing plants were numbered with OE (abbreviation for overexpression) in front of their numbers.

[0083] like Figure 4 As shown in Figure B, the NnCIGR1 expression levels of the OE-4, 5, 6, and 10 lines were significantly higher than those of the non-transgenic wild-type control. The most significant increases were observed in the OE-4, 5, and 6 lines, with expression levels increasing by 70,456%, 77,768%, and 131,825% respectively compared to the wild-type, indicating that these lines are independent NnCIGR1 overexpressing transgenic lines.

[0084] Example 3: NnCIGR1 overexpression transgenic T3 line increases biomass and enhances stem mechanical strength.

[0085] (1) Determination of biomass of NnCIGR1 overexpression lines in the T3 generation

[0086] Plant height and fresh weight of plants overexpressing WT and NnCIGR1(OE) during the diagonal fruit stage were measured.

[0087] The plant height was measured as follows: Once the plant height no longer increased significantly, the T3 lines with the highest expression levels of OE-4, OE-5, and OE-6 were selected, and their height was measured using a telescopic measuring ruler, starting from the bottom of the cultivation pot and ending at the highest point of the main inflorescence. Fresh weight was measured: the weight of plants in the pod-bearing stage of the T3 lines with the highest expression levels of OE-4, 5, and 6 was measured. Leaf area was measured: leaves from the same location at the base of the pod-bearing stage plants of the T3 lines with the highest expression levels of OE-4, OE-5, and OE-6 were measured using ImageJ software. Fruit size was measured: fruits from the same location on the main stem of the pod-bearing stage plants of the T3 lines with the highest expression levels of OE-4, OE-5, and OE-6 were measured using ImageJ software.

[0088] The results showed that the transgenic lines had significantly greater fresh weight, leaf size, and fruit size than the wild-type control group. Specifically, fresh weight increased by 33%-53%, plant height by 37%-54%, leaf area by 65%-69%, and fruit quantity and size increased by 45%-52% and 51%-75%, respectively. This indicates that overexpression of the NnCIGR1 gene can increase plant biomass. Figure 5 ).

[0089] (2) Determination of stem mechanical strength of NnCIGR1 overexpression T3 generation lines

[0090] Stem diameter and stem mechanical force were measured in diagonally fruiting plants overexpressing WT and NnCIGR1(OE).

[0091] The stem diameter was measured as follows: T3 lines OE-4, OE-5, and OE-6, which had the highest expression levels, were selected, and the diameter at the midpoint of the penultimate internode at the base of the plant was measured using digital vernier calipers. The results showed that the average stem diameter of the three overexpressing transgenic lines was significantly higher than that of the WT line, indicating that overexpression of the NnCIGR1 gene significantly increased the stem diameter of the plant.

[0092] The stem breaking force was measured as follows: Control WT and transgenic tobacco plants were cut at the base, leaves, flowers, and lateral branches were removed, leaving only the main stem. The breaking force F (N) between the three nodes from the bottom was measured, with a uniform measurement interval of 5 cm. A suitable stem support force testing head was selected and installed on a plant stem strength tester. The instrument was adjusted to ensure the stem was perpendicular to the testing head, and the clamps on both sides were appropriately spaced and symmetrical. The measurement was then taken, and the readings were recorded.

[0093] The results showed that the stem mechanical strength of the three overexpressing transgenic lines was significantly higher than that of WT, increasing by 48%-61%, indicating that the overexpression line NnCIGR1(OE) can enhance the stem mechanical strength of the plants. Figure 6 ).

[0094] In summary, overexpression of the NnCIGR1 gene can significantly increase plant biomass and stem mechanical strength.

[0095] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of the NnCIGR1 gene, characterized in that, Including any of the following applications: A1. Increase plant biomass; A2. Increase the mechanical force of plant stems; A3. Breeding of lodging-resistant plant lines; The NnCIGR1 gene encodes a protein as shown in SEQ ID NO.

4.

2. The application of an expression cassette containing the NnCIGR1 gene, characterized in that, Including any of the following applications: A1. Increase plant biomass; A2. Increase the mechanical force of plant stems; A3. Breeding of lodging-resistant plant lines; The NnCIGR1 gene encodes a protein as shown in SEQ ID NO.

4.

3. The application of recombinant vectors containing the NnCIGR1 gene, characterized in that, Including any of the following applications: A1. Increase plant biomass; A2. Increase the mechanical force of plant stems; A3. Breeding of lodging-resistant plant lines; The NnCIGR1 gene encodes a protein as shown in SEQ ID NO.

4.

4. The application of recombinant microorganisms containing the NnCIGR1 gene, characterized in that, Including any of the following applications: A1. Increase plant biomass; A2. Increase the mechanical force of plant stems; A3. Breeding of lodging-resistant plant lines; The NnCIGR1 gene encodes a protein as shown in SEQ ID NO.

4.

5. The application according to any one of claims 1-4, characterized in that, The plant biomass includes plant fresh weight, leaf area, number of fruits, and fruit size.

6. The application according to any one of claims 1-4, characterized in that, The plant in question is either lotus or tobacco.

7. A method for enhancing plant biomass and stem mechanical strength, characterized in that, This includes the steps of using genetic transformation technology to introduce the NnCIGR1 gene into plants, thereby achieving stable overexpression of the NnCIGR1 gene and increasing plant biomass and stem mechanical strength. The NnCIGR1 gene encodes a protein as shown in SEQ ID NO.

4.

8. The method according to claim 7, characterized in that, The plant biomass includes plant fresh weight, leaf area, number of fruits, and fruit size.

9. A method for cultivating lodging-resistant plant lines, characterized in that, This includes the steps of using genetic transformation technology to introduce the NnCIGR1 gene into plants, enabling stable overexpression of the NnCIGR1 gene, and cultivating lodging-resistant plant lines. The NnCIGR1 gene encodes a protein as shown in SEQ ID NO.

4.

10. The method according to any one of claims 7-9, characterized in that, The plant in question is either lotus or tobacco.

Images