Gene associated with cotton fiber length and application
The cotton fiber length gene GhDTX48 was identified through genome-wide association analysis. Molecular markers and primer pairs were designed using its SNP sites, enabling precise control of cotton fiber length. This solved the problem of fiber length in cotton breeding and improved cotton quality and breeding efficiency.
Patent Information
- Application Number
- CN202511330729.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-17
- Publication Date
- 2025-12-12
AI Technical Summary
Existing technologies make it difficult to effectively utilize cotton MATE proteins to regulate fiber length, which hinders cotton breeding efforts to improve fiber length and thus affects cotton quality.
The cotton fiber length-related gene GhDTX48 was identified through genome-wide association analysis. Molecular markers and primer pairs were designed using its regulatory SNP sites to achieve genetic engineering modification and cultivate new long-fiber cotton varieties.
It enables precise control of cotton fiber length, improves cotton quality, provides an efficient molecular breeding tool, can significantly distinguish between long-fiber and short-fiber varieties, and improves breeding efficiency.
Smart Images
Figure CN121109632A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology applications and relates to genes associated with cotton fiber length and their applications. Background Technology
[0002] Cotton is one of the world's most important economic crops and a crucial raw material for the textile industry, holding an irreplaceable position in agriculture, industry, and economic development. Fiber length is a major component of cotton fiber quality, and increasing fiber length is an effective way to improve cotton quality. Therefore, it is of great significance to explore and utilize superior genetic variations related to cotton fiber length to breed excellent cotton varieties.
[0003] Single nucleotide polymorphisms (SNPs) are DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level. They are the most common type of heritable variation in humans, accounting for over 90% of all known polymorphisms. SNPs are widespread in the human genome, averaging one in every 300 base pairs, with an estimated total of 3 million or more. An SNP is a bimorphic marker caused by a single base transition or transversion. SNPs can be found both within gene sequences and in non-coding sequences outside of genes. Genome-wide association studies (GWAS) link phenotypes to their underlying genetics across a population genome (Yasir et al., 2022), and are a powerful tool for revealing the association between genetic variation and phenotypic traits. They are widely used to identify complex crop traits and potential natural variations (Gupta et al., 2014) and are commonly used to discover genes associated with important agronomic traits such as yield, disease resistance, and stress tolerance. With the rapid development of sequencing technology and computational methods, GWAS has become a powerful tool for detecting natural variation in complex traits of crops (Rafalski et al., 2010). It can mine genes related to multiple agronomic traits on a large scale without prior assumption of candidate genes, and boasts strong detection capabilities and high accuracy, making it a hot topic in molecular breeding research. Currently, GWAS research has been successfully conducted in many crops, including rice, mustard, soybean, and cotton, yielding fruitful results.
[0004] Multidrug and Toxic Compound Extrusion (MATE), also known as detoxification efflux transporters (DTXs), are widely found in eukaryotes and prokaryotes. MATE is a membrane protein, typically possessing 12 transmembrane domains arranged in a V-shape. In plants, MATE / DTX transporters are primarily involved in iron homeostasis regulation, transport of inorganic anions and secondary metabolites, detoxification of exogenous substances and heavy metals, regulation of plant growth and development, and responses to diseases and abiotic stresses.
[0005] MATE proteins may indirectly affect cotton fiber length by regulating the transport and homeostasis of plant hormones. During fiber development, the concentration gradient of auxin (IAA) is crucial for fiber cell initiation and polar elongation. For example, MATE proteins in Arabidopsis thaliana (such as FFT) have been identified as auxin transporters, and it is speculated that homologous MATE members in cotton may be responsible for the directional transport of auxin to developing fiber cells, thereby establishing and maintaining this gradient and promoting fiber initiation and elongation. Furthermore, gibberellin (GA) is another key hormone that significantly promotes fiber elongation. Although MATE proteins do not directly transport GA itself, they may indirectly affect GA homeostasis by transporting metabolic precursors or regulatory molecules related to GA biosynthesis or signaling pathways, ultimately positively regulating fiber cell elongation. Therefore, MATE proteins likely play an important role in cotton fiber development through the aforementioned hormonal pathways, thereby influencing the final fiber length.
[0006] Therefore, in order to overcome the limitations of existing technologies regarding the influence of cotton MATE protein on fiber length, and to provide new genetic resources and molecular tools for breeding ideal long-fiber cotton, it is of great theoretical value and practical application potential to discover key genes closely related to cotton MATE. Summary of the Invention
[0007] The purpose of this invention is to address the shortcomings of existing technologies by providing a gene associated with cotton fiber length and its application. GhDTX48 was identified as closely associated with cotton fiber length through resequencing of the YM8 population and genome-wide association analysis based on SNPs.
[0008] The objective of this invention can be achieved through the following technical solutions:
[0009] Firstly, the cotton gene GhDTX48, in tetraploid YM8, has the cDNA sequence SEQ ID NO.1 and the genome sequence SEQ ID NO.2. The genome sequence was transcribed in the forward direction. This gene is regulated by a nearby SNP site where the thymine (T) is mutated to cytosine (C), resulting in cotton fibers significantly longer than the wild type.
[0010] This invention further provides the application of the cotton gene GhDTX48 described in this invention in the identification of long-fiber upland cotton varieties.
[0011] The present invention further provides the application of the cotton gene GhDTX48 in the breeding process of new cotton varieties. The gene containing the gene GhDTX48 and having a base of C at the 579th bp of the genomic DNA sequence is transferred into cotton varieties to cultivate new cotton varieties with long fibers, or the base T on the gene containing the gene GhDTX48 and having a base of T at the 579th bp of the genomic DNA sequence is mutated to C at a specific site using genetic engineering to cultivate new cotton varieties with long fibers.
[0012] Secondly, SNP markers that are significantly associated with cotton fiber length traits are provided, located at 24631774 bases on chromosome D11 of the cotton genome, with polymorphisms of C or T. Among them, the CC genotype corresponds to the phenotype of long-fiber cotton varieties, and the TT genotype corresponds to the phenotype of short-fiber cotton varieties.
[0013] Further, primer pairs for detecting the above-mentioned SNP markers are provided, wherein the upstream primer sequence is shown in SEQ ID NO.5 and the downstream primer sequence is shown in SEQ ID NO.6.
[0014] Further, the application of the reagent for detecting the above-mentioned SNP markers is provided in the identification of long-fiber cotton. Using the reagent to detect the SNP markers, if the base is C, the cotton is a long-fiber cotton variety; if the base is T, the cotton is a short-fiber cotton variety. The reagent can be the primer pair mentioned above.
[0015] A further kit is provided, comprising the primer pairs described above.
[0016] Furthermore, an application of the above-mentioned kit is provided, wherein the kit is used to identify the fiber length trait of cotton and / or to screen and cultivate new long-fiber cotton varieties.
[0017] The beneficial effects of this invention are as follows:
[0018] 1. This invention identified a gene, GhDTX48, associated with cotton fiber length through genome-wide association analysis. Gene GhDTX48 was identified in the genome-wide association analysis (…). Figure 1 Analysis of expression levels in different tissues and developmental stages of cotton () Figure 2 All of these are closely related to the length property of cotton fibers.
[0019] 2. Based on the different genotypes of the SNP (D11:24631774) regulating GhDTX48, the variety population can be divided into two major categories. Statistical analysis revealed significant differences in traits between these two groups. Figure 3 This further demonstrates the correlation between this gene and the cotton fiber length trait.
[0020] 3. The SNP genotypes of GhDTX48 in relatively long-fiber and short-fiber cultivars can be verified by PCR technology, which has the advantages of being easy to operate, highly sensitive and accurate. Attached Figure Description
[0021] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.
[0022] Figure 1 This is a graph showing the results of a genome-wide association analysis of cotton fiber length traits; in the graph: the horizontal axis represents the location on the chromosome (Mb), and the positive vertical axis represents the significance of the association between the SNP site and the agronomic trait, expressed as -log. 10 (P value) indicates the value; arrows indicate SNP variant sites associated with agronomic traits.
[0023] Figure 2 This is a statistical graph showing the gene expression levels of GhDTX48 in different tissues and developmental stages of cotton. In the graph: the horizontal axis represents different tissues, namely root, stem, leaf, sepal, petal, anther, stigma, ovule, and fiber; the ovule tissue includes the day of flowering and 5 days after flowering; the fiber tissue includes 10 days, 15 days, 20 days, 25 days, and 30 days after flowering; the vertical axis represents FPKM, which is a standard for measuring the relative expression level of genes.
[0024] Figure 3 This is a graph showing the results of the analysis of expression levels and fiber length differences of GhDTX48 among different genotypes in the population; in the graph: the box plot represents the distribution of fiber length trait in the variety population; there are 225 varieties containing the CC genotype and 116 varieties containing the TT genotype; the horizontal line in the box represents the median of the trait distribution. Detailed Implementation
[0025] Example 1: Discovery and acquisition of the GhDTX48 gene associated with cotton fiber length:
[0026] In 2022, a detailed survey of cotton fiber length traits was conducted in Xinjiang, targeting 370 modern cotton varieties or lines. Simultaneously, whole-genome resequencing was performed on these 370 cotton varieties, with an average sequencing depth of 20X. These sequences were aligned to the genome sequence of the upland cotton genetic standard line TM-1 (V2.1), and SNP identification was performed at the whole-genome level using the samtools software. Genome-wide association analysis was then conducted on the identified genetic variation sites and cotton phenotypic data. The results are as follows: Figure 1 As shown, a SNP signaling site (D11:24631774) on chromosome D11 can be associated with the cotton fiber length trait. At the same time, this SNP is associated with the gene GhDTX48 in the GWAS signaling region, and it is preliminarily determined that this gene may be involved in cotton fiber formation.
[0027] GhDTX48 was obtained from the genome sequence. A pair of full-length primers (Table 1) were designed based on both ends of its cDNA sequence, including upstream primer F1 (SEQ ID NO. 3) and downstream primer R1 (SEQ ID NO. 4), for subsequent PCR amplification. The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 sec, 57℃ annealing for 15 sec, 72℃ extension for 45 sec, 34 cycles; and a final extension at 72℃ for 5 min. The PCR amplification products were sequenced and compared with the cDNA sequence to confirm sequence accuracy. The GhDTX48 gene was obtained through these steps.
[0028] Table 1. Primer sequence list for PCR amplification
[0029] Primer name Primer direction Primer sequence SEQ ID NO. 3 Forward CATAACGACAAGCAGTGAGCATTGA SEQ ID NO. 4 Reverse TCGGTCTTTTCCCTTTTCTTGCATG
[0030] Analysis of the expression levels (FPKM values) of the GhDTX48 gene in multiple tissues and different developmental stages of cotton revealed high expression of GhDTX48 in fiber tissue at 15 and 20 days post-flowering. At this time, cotton fibers are in a rapid elongation phase, and the synthesis of secondary fiber wall cells is also underway, indicating that GhDTX48 plays a key role in controlling cotton fiber elongation. Figure 2 ).
[0031] Example 2: Application of the GhDTX48 gene in the identification of long-fiber cotton:
[0032] Based on the location of the SNP site (D11:24631774) on chromosome D11 and the nearby sequence (SEQ ID NO.2, the SNP site is at 579 bp in SEQ ID NO.2), GhDTX48 designed genome amplification primers at both ends of the site (Table 2). The primer sequences are F2: SEQ ID NO.5 and R2: SEQ ID NO.6. PCR amplification and sequencing were performed. The PCR reaction program was as follows: 98℃ pre-denaturation for 3 min; 95℃ denaturation for 15 sec, 57℃ annealing for 15 sec, 72℃ extension for 30 sec, 34 cycles; and a final extension at 72℃ for 5 min.
[0033] Table 2. Primer Sequence List for PCR Amplification
[0034] Primer name Primer direction Primer sequence SEQ ID NO. 5 Forward GTGGACAGTTCCCTAGTTCACAAAG SEQ ID NO. 6 Reverse AACCTCGTCCACGATCGCATTATCA
[0035] Based on the different genotypes regulating SNP sites, the variety population was divided into two categories: TT represents the short-fiber genotype with a homozygous SNP site; CC represents the long-fiber genotype with a homozygous mutation at the SNP site. As shown in Table 3, the number of varieties identified by the two genotypes based on the aforementioned SNP sites were 116 and 225, respectively. Figure 3 As shown, statistical analysis revealed significant differences between homozygous sites and homozygous mutant populations, both between population genotype and gene expression levels, and between population genotype and fiber length trait levels, demonstrating the correlation between SNP sites and cotton fiber length traits.
[0036] The results above demonstrate that the GhDTX48 gene has significant research value in improving fiber length and breeding new long-fiber cotton varieties. On one hand, molecular markers can be designed based on the two genotypes controlling the SNP site of the GhDTX48 gene, effectively identifying long-fiber cotton varieties. On the other hand, site-directed mutations of the SNP site in the short-fiber genotype (TT) can be performed using genetic engineering to modify it into a long-fiber genotype (CC), thereby breeding new long-fiber cotton varieties.
[0037] Table 3. Distribution of long and short fiber haplotypes in population varieties
[0038]
[0039]
[0040]
[0041] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. The application of the cotton gene GhDTX48 in the identification of long-fiber cotton, characterized in that, The genomic DNA sequence of the cotton gene is shown in SEQ ID NO.
2.
2. The application according to claim 1, characterized in that, The cDNA sequence of the gene GhDTX48 is shown in SEQ ID NO.
1.
3. The application of the cotton gene GhDTX48 in cotton variety breeding, characterized in that, A new cotton variety with long fibers is bred by transferring a gene containing the gene GhDTX48 with a base of C at the 579th bp of its genomic DNA sequence into a cotton variety, or by selectively mutating the base T in a gene containing the gene GhDTX48 with a base of T at the 579th bp of its genomic DNA sequence to C using genetic engineering techniques; wherein the genomic DNA sequence of the cotton gene is shown in SEQ ID NO.
2.
4. A SNP marker that is significantly correlated with cotton fiber length traits, characterized in that, The SNP marker is located at base 24631774 on chromosome D11 of the cotton genome, with polymorphisms of C or T. The CC genotype corresponds to a long-fiber cotton variety, while the TT genotype corresponds to a short-fiber cotton variety.
5. The application of a reagent for detecting the SNP marker described in claim 4 in the identification of long-fiber cotton, characterized in that, The application is as follows: using the reagent to detect SNP markers, if the base is C, the cotton is a long-fiber cotton variety; if the base is T, the cotton is a short-fiber cotton variety.
6. The application according to claim 5, characterized in that, The reagent is a primer pair, with the upstream primer sequence shown in SEQ ID NO.5 and the downstream primer sequence shown in SEQ ID NO.
6.
7. A reagent kit, characterized in that, The kit contains primer pairs, with the upstream primer sequence shown in SEQ ID NO.5 and the downstream primer sequence shown in SEQ ID NO.
6.
8. The application of the reagent kit according to claim 7, characterized in that, The kit is used to identify the fiber length trait of cotton and to screen and breed new long-fiber cotton varieties.