Specific gene sequence for rapidly identifying dendrobium devonianum, composition, identification method and application

By integrating RPA-CRISPR/Cas12b one-step technology, the problems of speed and accuracy in the identification of Dendrobium denticulatum have been solved, enabling simple and sensitive on-site identification, which is suitable for the visual detection of Dendrobium denticulatum origin and medicinal materials.

CN121109640APending Publication Date: 2025-12-12INSTITUTE OF CHINESE MATERIA MEDICA CHINA ACADEMY OF CHINESE MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511449512.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-11
Publication Date
2025-12-12

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately identify Dendrobium dendrobium. Traditional methods are highly subjective and have poor stability. Furthermore, PCR is time-consuming and labor-intensive, making it unsuitable for on-site testing. Current one-step detection methods require additional reagents or instruments, increasing instability or reducing specificity.

Method used

The RPA-CRISPR/Cas12b one-step method integrates RPA and CRISPR/Cas12b into a single-tube reaction. Through the design of specific primers and sgRNA, the amplification and detection of target genes can be synchronized, simplifying the operation process and reducing the risk of aerosol contamination.

Benefits of technology

It enables rapid, accurate, and sensitive identification of Dendrobium nobile with high specificity, requiring only a thermostat and a blue light transilluminator. It is suitable for on-site visual detection, simplifies the operation process, and reduces the risk of false positives.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121109640A_ABST
    Figure CN121109640A_ABST
Patent Text Reader

Abstract

The invention provides a specific gene sequence for rapidly identifying dendrobium devonianum, a composition, an identification method and application, and belongs to the technical field of gene detection. The invention develops a one-step rapid detection method based on an RPA-CRISPR / Cas12b technology, RPA and CRISPR-Cas12b are integrated in a single-tube reaction, and target gene amplification and Cas12b mediated detection are synchronously realized at a constant temperature, so that the experimental operation process is simplified, the risk of aerosol pollution is reduced to the greatest extent, and the method is suitable for industrial production. The method can be used for on-site visual rapid identification of Dendrobium devonianum base and medicinal materials. The method is simple to operate, accurate, rapid and high in sensitivity, the result can be directly judged through visual fluorescence, and a reliable technical means is provided for field medicinal material screening and market supervision of dendrobium devonianum.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, and in particular to a rapid identification method, composition, and application of a specific gene sequence for Dendrobium nobile. Background Technology

[0002] Dendrobium ( Dendrobium Dendrobium (Dendrobium spp.) is one of the largest genera in the Orchidaceae family, with over 1000 species worldwide. The *Shennong Bencao Jing* (Shennong's Classic of Materia Medica) records that Dendrobium has effects such as nourishing yin and clearing heat, promoting body fluid production and benefiting the stomach, moistening the lungs and relieving cough, and improving eyesight and strengthening the body. Dendrobium dentata (Dendrobium spp.) is a species of Dendrobium. Dendrobium devonianum Dendrobium pachycarpa, commonly known as purple-skinned Dendrobium, was developed as an important medicinal plant resource in the 1980s. The purple-skinned Dendrobium pods made from it are characterized by their sweet taste, soft and resilient texture, and strong viscosity. Studies have shown that Dendrobium pachycarpa pods have superior luster, quality, and content compared to Dendrobium officinale. In recent years, the yield of Dendrobium pachycarpa pods and purple-skinned buds processed from the young stems of Dendrobium pachycarpa is far higher than that of Dendrobium officinale, resulting in a higher market share. With the increasing demand for Dendrobium pachycarpa, wild resources have been severely damaged. Simultaneously, low seed germination rates and slow development of artificial cultivation have led to a supply shortage. Furthermore, Dendrobium species are numerous and their origins are complex. The stems and leaves of non-flowering Dendrobium species are similar in morphology, and since Dendrobium is mostly sold in pod form, traditional morphological identification methods are even more difficult to use for differentiation. Moreover, during the processing of purple-skinned Dendrobium pods, producers' ambiguous identification of the original plant material leads to a mixture of raw materials. In addition, some merchants and producers, seeking profit, "pass off" counterfeit products, seriously harming consumers' interests.

[0003] Currently, there are relatively few studies on rapid molecular identification of Dendrobium nobile. Traditional identification methods mainly include morphological identification, microscopic identification, thin-layer chromatography identification, and physicochemical identification. However, these methods have limitations such as strong subjectivity and poor stability. In recent years, DNA molecular identification has developed rapidly and made great progress, such as the use of site-specific PCR and SSR markers for identification. However, this type of identification requires expensive instruments such as PCR machines, is highly specialized, and time-consuming and labor-intensive, making it unsuitable for rapid on-site testing.

[0004] Isothermal amplification techniques, such as recombinase polymerase amplification (RPA) and loop-mediated isothermal amplification (LAMP), are ideal rapid on-site identification methods and are widely used in medical testing, such as nucleic acid detection. Isothermal amplification is an effective alternative to traditional nucleic acid amplification methods due to its low cost, simple operation, and short processing time. Furthermore, it does not require expensive thermal cycling equipment and can achieve highly sensitive amplification of target fragments at a single temperature. Compared to LAMP, RPA primer design is simpler and the optimal temperature is lower. However, RPA has a higher tolerance to primer mismatches, which may affect its amplification specificity, necessitating combination with highly specific nucleic acid detection techniques.

[0005] In recent years, molecular diagnostic techniques based on clustered regularly spaced short palindromic repeats / CRISPR-associated proteins (CRISPR / Cas) have become a highly specific and visually perceptible nucleic acid detection technology due to their trans-cleavage activity. When guide RNA binds to target DNA, it can not only cis-cleave the target fragment but also non-specifically cleave surrounding ssDNA fluorescent reporter genes. Among various Cas proteins (Cas9, Cas12a, Cas12b, Cas13a, and Cas14, etc.), Cas12b exhibits high specificity, capable of distinguishing single-base differences, thereby improving identification accuracy. Combining the technical advantages of RPA and CRISPR / Cas12b, a simple, rapid, sensitive, and visual identification method can be established. Currently, many studies have successfully applied the RPA-CRISPR / Cas system to various detection scenarios, such as rapid on-site visual identification of the transgenic papaya "Hua Nong No. 1," nucleic acid detection of Pseudomonas aeruginosa, and rapid identification of grass carp species.

[0006] To avoid interference between RPA and CRISPR / Cas reactions, they are often performed in two steps: the target fragment is first amplified and accumulated via RPA, and then transferred to the CRISPR / Cas system for detection. However, this procedure is cumbersome, and the transfer of amplified products can easily cause aerosol contamination. Therefore, integrating amplification and detection into a single step is crucial to avoid false positives. Current strategies for achieving a one-step method primarily rely on time delay and spatial isolation to reduce interference between different components. Time delay involves mixing all reaction components in one tube and adding components such as sucrose, glycerol, and agarose to increase the overall consistency and density of the reaction, preventing premature fusion of the RPA amplification system and the CRISPR / Cas detection system, thus achieving a one-step method. This method requires additional reagents, increasing the instability of the detection system. Spatial isolation involves placing the RPA and CRISPR-Cas components separately at the bottom and top of the same reaction tube, respectively. After the RPA reaction is complete, the component at the top is centrifuged to the bottom for detection. Alternatively, centrifuge trays or capillary mechanisms can be used to separate the two reactions, but this method requires a centrifuge. Furthermore, some studies have reported achieving a one-step method by altering primer ratios to avoid the presence of PAM sites in the target sequence, thereby preventing interference between reaction components. However, the absence of PAM sites can lead to reduced detection specificity, and this method is unsuitable for species identification systems with diverse species and small differences in target fragment sequences. Therefore, establishing a rapid, accurate, and field-visualized method for identifying Dendrobium dentatum is crucial for meeting the needs of rapid detection of primary medicinal materials and ensuring the quality of medicinal materials. Summary of the Invention

[0007] The purpose of this invention is to provide a rapid identification method for the specific gene sequence, composition, and application of Dendrobium nobile. This method has high sensitivity and specificity, simple operation procedure, and visual interpretation of results. It only requires a small portable device, a thermostat and a blue light transilluminator. It provides a reliable and efficient technical means for rapid on-site screening of Dendrobium nobile and also provides a technical method that can be used as a reference for the rapid screening of other Chinese medicinal materials.

[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a specific gene sequence for rapid identification of Dendrobium denticulata, as shown in SEQ ID NO.1.

[0009] Preferably, the sequence shown in SEQ ID NO.1 includes a PAM site.

[0010] The present invention also provides a detection composition for rapid identification of Dendrobium denticulatum, the detection composition comprising the following sequence: SEQ ID NO.2-cb-SF: AGCATTTAGATGCTCCGTGCCTTGTCATCA; SEQ ID NO.3-cb-SR1: GCACGCACAATACAATAGGCCTTATCCTTT; SEQ ID NO.7-cb-sgRNA: GUCUAAAGGACAGAUUUUCACGGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAACUUCAAGCGAAGUGGCACAUGGAAGUGUUGGUGAAGGC.

[0011] Preferably, the cb-sgRNA sequence is designed with reference to the 5'-3' direction sequence after the PAM site of the sequence shown in SEQ ID NO.1, and the cb-SF and cb-SR primers are designed with reference to the differential sequence regions on both sides of the sgRNA.

[0012] The present invention also provides a Dendrobium dentata detection product, which includes the above-mentioned detection composition for rapid identification of Dendrobium dentata.

[0013] Preferably, the testing product includes a test kit and a test chip.

[0014] This invention also provides a method for rapid identification of Dendrobium dentatum using a one-step RPA-CRISPR / Cas12b method, the steps of which are as follows: (1) Extract DNA from the sample to be tested; (2) Using the above-mentioned rapid identification of Dendrobium denticulata, RPA and CRISPR / Cas12b reactions were carried out simultaneously in the same system, and the results were used to determine whether it was Dendrobium denticulata.

[0015] Preferably, the one-step RPA-CRISPR / Cas12b reaction system includes: CRISPR-Cas12b premix, RPA premix, Dendrobium officinale-specific RPA forward primer cb-SF, reverse primer cb-SR1, reverse primer cb-SR2, DNA template, and magnesium acetate. The CRISPR-Cas12b premix comprises: Cas12b protein, sgRNA with sequence SEQ ID NO.7, and a fluorescent reporter gene.

[0016] The present invention also provides the application of the above-mentioned one-step rapid identification of the specific gene sequence of Dendrobium denticulatum based on RPA-CRISPR / Cas12b, or the above-mentioned detection composition, or the above-mentioned detection product, or the above-mentioned method for identifying Dendrobium denticulatum in the identification of Dendrobium denticulatum.

[0017] The beneficial effects of this invention compared to the prior art are as follows: (1) This invention develops a one-step rapid detection method based on RPA-CRISPR / Cas12b technology, integrating RPA and CRISPR-Cas12b into a single-tube reaction. At a constant temperature, it simultaneously achieves target gene amplification and Cas12b-mediated detection, thereby simplifying the experimental procedure and minimizing the risk of aerosol contamination. It can be used for the rapid, visual identification of Dendrobium nobile origin and medicinal materials in the field. The method is simple to operate, accurate, rapid, and highly sensitive, and the results can be directly determined through visual fluorescence, providing a reliable technical means for the on-site screening and market supervision of Dendrobium nobile.

[0018] (2) The optimal reaction conditions for the one-step method of this invention are: Cas12b concentration 12.5 nM, ss-DNA fluorescent reporter gene concentration 1.6 μM, RPA specific primer concentration 0.2 μM, and reaction temperature 40℃. This method has high specificity and can accurately identify common adulterants of Dendrobium officinale; it has high sensitivity, with a detection limit of 0.05 ng / μL within 40 min. In the identification of 31 commercially available Dendrobium officinale medicinal materials, 23 genuine products and 8 adulterants were identified.

[0019] (3) This invention achieves rapid identification of *Dendrobium dendrobium* within 30 minutes by optimizing the concentrations of key components (Cas12b, ssDNA-FQ, RPA primers) and the incubation temperature of the system. No additional reagents are added, and instruments such as centrifuges are unnecessary, simplifying the two-step experimental procedure. It is convenient and fast, and the specificity of species detection is improved through optimal PAM site and specific sgRNA screening. Furthermore, the detection sensitivity is 0.05 ng / μL. It is suitable for rapid market identification of *Dendrobium dendrobium*. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1This invention establishes the one-step RPA-CRISPR / Cas12b method in Example 1; where A represents the screening of sites within the ITS2 sequence region of *Dendrobium dentata*; B represents the alignment of ITS2 sequences of *Dendrobium dentata* and 13 common hybrid pseudospecies with RPA primers and sgRNA design; C represents the real-time fluorescence curves of two pairs of RPA primers for screening *Dendrobium dentata*; D represents the endpoint fluorescence signal of two pairs of RPA primers for *Dendrobium dentata* at 120 minutes under a blue light transilluminator; E represents the real-time fluorescence curves showing the influence of each key reaction component on fluorescence in the one-step method system; and F represents the addition status of each key reaction component and the endpoint fluorescence signal of the corresponding experimental group at 50 minutes under a blue light transilluminator. Figure 2 This document describes the optimization of reaction components and temperature for the one-step RPA-CRISPR / Cas12b method for identifying Dendrobium nobile in Example 2 of this invention. Figure A shows the real-time fluorescence curves and fluorescence signals under 30 min blue light transmission at different Cas12b protein concentrations; Figure B shows the real-time fluorescence curves and fluorescence signals under 30 min blue light transmission at different ssDNA-FQ fluorescent probe concentrations; Figure C shows the real-time fluorescence curves and fluorescence signals under 30 min blue light transmission at different RPA primer concentrations; Figure D shows the real-time fluorescence curves and fluorescence signals under 30 min blue light transmission at different reaction temperatures; Figure E shows the changes in reaction parameters before and after optimization; Figure F shows the changes in fluorescence values ​​after 100 min before and after optimization. All data in each figure represent the mean of three replicates. Figure 3 This invention relates to the performance testing of the RPA-CRISPR / Cas12b one-step method system in Example 3. A represents the real-time fluorescence curves of *Dendrobium dentata* and its 13 common adulterant species detected by the one-step method; B represents the endpoint fluorescence value at 30 min and the fluorescence signal under blue light transmission; cb: *Dendrobium dentata*, dc: *Dendrobium pumilum*, sh: *Dendrobium nobile*, gc: *Dendrobium chrysanthum*, dq: *Dendrobium chrysanthum*, mg: *Dendrobium roseum*, bq: *Dendrobium cupulosum*, jc: *Dendrobium nobile*, tp: *Dendrobium officinale*, bc: *Dendrobium primrose*, cg: *Dendrobium winged pedunculata*, dbq: *Dendrobium large-bracted*, ls: *Dendrobium fimbriatum*, hs: *Dendrobium huoshanense*, NTC: blank control; C represents the real-time fluorescence curves of *Dendrobium dentata* at different DNA gradient concentrations; D represents the real-time fluorescence curves of *Dendrobium dentata* at different DNA gradient concentrations at 30 min. The fluorescence signal at the 30-minute endpoint and the fluorescence signal under blue light transmission are shown, with each concentration fluorescence value representing the mean of three replicates; E shows the real-time fluorescence curves of DNA at different concentrations in three batches of Dendrobium officinale medicinal materials (a, b, c); F shows the fluorescence value at different concentrations and the fluorescence signal under blue light transmission in three batches of Dendrobium officinale medicinal materials at the 30-minute endpoint and the fluorescence signal under blue light transmission. Figure 4 PCR sequencing and RPA-CRISPR of commercially available Dendrobium nobile medicinal material in Example 4 of this invention. The results of the Cas12b one-step method are shown in the following table: A represents the 30-minute endpoint fluorescence value of *Dendrobium dentata* medicinal materials detected by the RPA-CRISPR / Cas12b one-step method; B represents the morphological characteristics of 12 batches of *Dendrobium dentata* medicinal materials used for detection, where cb-yc-10, 14, 23, and 28 are genuine products, and cb-yc-1, 5, 8, 11, 12, 13, 16, and 19 are counterfeit products; C represents the 30-minute endpoint fluorescence signal of 31 batches of *Dendrobium dentata* medicinal materials detected by the one-step method; D represents the heatmap of the 30-minute endpoint fluorescence value of 31 batches of *Dendrobium dentata* medicinal materials detected by the one-step method and the PCR sequencing results. White represents counterfeit products, and red and blue represent genuine products in the one-step method detection and PCR sequencing results, respectively. The cutoff value (5.5) for the one-step method is the mean of the 30-minute fluorescence values ​​of the 12 blank groups plus 3 standard deviations. Figure 5 The NJ tree is constructed by combining the sequencing sequences of 14 fresh Dendrobium samples and commercially available Dendrobium denticulata medicinal materials in Example 4 of this invention with the ITS2 sequence downloaded from the NCBI database. Detailed Implementation

[0022] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0023] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0024] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0025] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0026] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0027] The reagents and materials used in the following examples are as follows: All primers used in this invention were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the CRISPR-Cas12b, sgRNA, and ssDNA fluorescent reporter genes were synthesized and purified by Beijing Xunshi Biotechnology Co., Ltd. The instruments used in this experiment included: a Nanodrop one ultra-micro spectrophotometer (Thermo Fisher Scientific, USA), a quantitative PCR instrument (Rotor-Gene Q, QIAGEN, Germany), and a blue light transilluminator (BL-20, LABGIC). The reagents used are shown in Table 1.

[0028] Table 1. Information on reagents used in the experiment

[0029] Fourteen fresh Dendrobium samples were collected from the Dendrobium Research Institute of Longling County, Yunnan Province (98°67′E, 24°66′N) (Table 2) and identified by Professor Duan Baozhong. Fresh, young leaves with good growth and free from pests and diseases were selected, rinsed several times with sterile water, dried, and stored at -80℃ for later use.

[0030] Table 2. Sample Information Table Used in the Experiment

[0031] Example 1 Embodiment 1 of this invention provides a method for rapid identification of Dendrobium officinale using a one-step RPA-CRISPR / Cas12b method. The specific steps are as follows: (1) Genomic DNA extraction Take 50 mg of fresh leaves from each of the different Dendrobium species listed in Table 2, place them in separate 2 mL centrifuge tubes, add two 3 mm diameter tungsten carbide grinding beads, freeze the centrifuge tubes in liquid nitrogen for 2 min, and then grind them for 120 s. Before extraction, add 1 mL of nuclear separation buffer (components: 1 mL nuclear separation buffer consists of 2% PVP40, 20 mmol / L EDTA, 100 mmol / L pH 8.0 Tris-HCl, and 0.7 mol / L NaCl) to each sample, vortex thoroughly, centrifuge for 5 min, and discard the supernatant. Repeat this step 2-3 times until the supernatant is no longer viscous. Subsequently, extract DNA according to the instructions of the polysaccharide and polyphenol plant genomic DNA extraction kit. DNA concentration and quality were detected using a NanoDrop one micro spectrophotometer and 1% agarose gel electrophoresis, respectively. Qualified samples were stored at -20℃ for later use.

[0032] (2) Optimal PAM site screening, sgRNA and RPA primer design ITS2 sequences of 14 Dendrobium species were sequenced and combined with ITS2 sequences of 14 Dendrobium species downloaded from the NCBI database. Multiple sequence alignment was performed using MAGA11 to construct a Neighbor-Joining Tree (NJ tree) to verify Dendrobium dentatum and its 13 common pseudo-hybrids. First, candidate PAM sites for TTN were screened in the ITS2 sequence of Dendrobium dentatum, and a total of 14 candidate PAM sites were obtained. Figure 1 (A). The 20 bp downstream of the PAM site is called sgRNA. Then, the number of single-base sequence variations of sgRNA in *Dendrobium dentatum* and 13 common *Dendrobium* species that are mixed with it, and the sequence differences of the 200 bp flanking the sgRNA sequence in *Dendrobium dentatum* and 13 common mixed *Dendrobium* species were used as comprehensive screening criteria. Finally, the optimal PAM site (TTT) of *Dendrobium cb* was determined to be located at 32-34 bp (5'-3') of its ITS2 sequence. The specific sgRNA sequence is: ATGGAAGTGTTGGTGAAGGC (SE ID NO.1), which is significantly different from the other 13 *Dendrobium* species. Figure 1 (B), ensuring that it can be used for the design of specific sequences for Dendrobium dentatum.

[0033] The ITS2 sequence was aligned and analyzed using SnapGene 6.0. PAM sites (PAM, 5'-TTN-3', where N represents any base) were retrieved in the regions of significant differences in Dendrobium officinale ITS2. Guide RNA (sgRNA) was designed after the PAM site (5'-3' direction). Dendrobium officinale-specific RPA primers cb-SF / R1 and cb-SF / R2 were designed in the differential sequence regions flanking the sgRNA. At the same time, universal primers CF / R were designed in the conserved sequence regions flanking the sgRNA. The sequences are shown in Table 3.

[0034] Table 3. Dendrobium-specific gene sequences, primers, and sgRNA sequences

[0035] (3) RPA-CRISPR / Cas12b one-step detection Preparation of RPA premix: Add 29.5 uL primer-free rehydration buffer and 12.2 uL ddH2O to the Twist Amp Basic lyophilized precipitate and vortex to mix.

[0036] Preparation of CRISPR / Cas12b premix: 0.23 μM Cas 12b protein, 0.23 μM sgRNA and 1.2 μM ssDNA-FQ fluorescent reporter gene.

[0037] RPA-CRISPR / Cas12b one-step reaction system: Add the CRISPR-Cas12b premix to the reaction tube, followed by the RPA premix and 2 μL (10 μM) of Dendrobium officinale-specific RPA forward primer and 2 μL (10 μM) of reverse primer. Finally, add 1 μL of DNA template and 1.5 μL of magnesium acetate (280 mM) to the wall of the reaction tube. Mix all components before the reaction, and measure the fluorescence signal value every 1 minute in a qPCR instrument (Rotor-Gene Q, QIAGEN).

[0038] The qPCR assay program was set to Machine Options: Rotor Type-72 Well Rotor; Channels: Green-Gain (5.33), Profile: Cycling-cycle repeats (120 times) - Timed step (40℃ - 60 seconds - Acquiring to Cycleing A - on Green). The endpoint fluorescence was observed and photographed under a blue light transilluminator. A blank control (ddH2O replacing template DNA) was used for RPA-CRISPR / Cas12b one-step assay. The results are as follows: Figure 1 As shown.

[0039] Figure 1 The results showed that the specific primer cb-SF1 / R1 could induce obvious amplification curves and fluorescence signals in the Dendrobium nobile reaction system, and normal fluorescence was generated in all three replicates. However, at the same reaction time, the cb-SF / R2 primer showed low fluorescence signals and uneven fluorescence in the three replicates. Figure 1 (CE), in this experiment, the cb-SF / R1 primer pair was selected for subsequent reactions. These results demonstrate that the one-step RPA-CRISPR / Cas12b method for identifying *Dendrobium dendrobium* is technically feasible.

[0040] Example 2 Example 2 of this invention optimized the one-step RPA-CRISPR / Cas12b reaction system. The gradients of each parameter are shown in Table 4. The specific details are as follows: Table 4 Parameter Optimization of RPA-CRISPR / Cas12b One-Step System

[0041] The detection was performed using the method described in Example 1, repeated three times. A blank control (NTC) was set up with ddH2O replacing the template DNA. The results are as follows: Figure 2 As shown.

[0042] This invention compares the effect of different Cas12b protein concentrations on the reaction rate under a Cas12b to sgRNA ratio of 1:1. The results show that a Cas12b concentration of 12.5 nM resulted in the earliest appearance of fluorescence signal in the system; this was selected as the optimal concentration for the one-step RPA-CRISPR / Cas12b reaction. Figure 2 (A)

[0043] Regarding the concentration of the ssDNA-FQ fluorescent reporter gene, the results showed that the fluorescence signal of the system became stronger with increasing ssDNA fluorescent reporter gene concentration, and the optimal ssDNA-FQ fluorescent reporter gene concentration was 1.6 μM. Figure 2 (B)

[0044] Five RPA primer concentrations (0.05 μM, 0.1 μM, 0.2 μM, 0.4 μM, and 0.6 μM) were screened. The results showed that the optimal primer concentration for the system's reaction rate was 0.2 μM. Figure 2 (C)

[0045] Finally, five reaction temperatures (35℃, 37℃, 40℃, 42℃, and 45℃) were selected. The results showed that the fluorescence signal appeared earliest at 40℃; therefore, 40℃ was chosen as the optimal reaction temperature. Figure 2 (D) In summary, after system optimization, the optimal reaction system for the one-step RPA-CRISPR / Cas12b identification of *Dendrobium dendrobium* was determined to be: Cas12b protein concentration of 12.5 nM, ssDNA-FQ fluorescent probe concentration of 1.6 μM, primer concentration of 0.2 μM, and reaction temperature of 40℃. After optimization, the detection time was significantly shortened. Before optimization, the fluorescence curve began to peak around 30 min and had not reached its peak value even after 90 min. After optimization, the fluorescence curve began to peak around 4 min and reached its peak value within 20 min. See Table 5 for details.

[0046] Table 5 Optimization of the one-step RPA-CRISPR / Cas12b system

[0047] Example 3 Example 3 of this invention tested the specificity and sensitivity of the one-step RPA-CRISPR / Cas12b method. The specific steps are as follows: Example 2 uses an optimized RPA-CRISPR / Cas12b one-step method, with DNA from Dendrobium nobile prepared in Example 1 and 13 other common adulterants as templates, to identify Dendrobium nobile and 13 common adulterants, verifying the specificity of the method.

[0048] Dendrobium dentata contains abundant polysaccharides and polyphenols, which can easily affect its DNA extraction. Furthermore, commercially available Dendrobium dentata is mostly available in the form of dried capsules or dried strips, and the processing may lead to severe DNA degradation. Therefore, high sensitivity of the identification method is crucial for this special material. This invention uses 50 ng / μL Dendrobium dentata DNA as a template and employs a tenfold dilution method to set five concentration gradients: 50 ng / μL, 5 ng / μL, 0.5 ng / μL, 0.05 ng / μL, 0.005 ng / μL, and 0.0005 ng / μL, to obtain the sensitivity of the method. Each concentration is repeated three times. Simultaneously, three batches of Dendrobium dentata medicinal materials (a, b, and c) were selected, and their DNA was diluted to different concentration gradients (50, 5, and 0.5 ng / μL) to detect the sensitivity of the medicinal materials. The results are as follows: Figure 3 As shown.

[0049] Figure 3 The AB test showed that only *Dendrobium dendrobium* exhibited a significantly enhanced fluorescence curve and bright green fluorescence, while the other 13 *Dendrobium* species showed no increase in fluorescence value or endpoint fluorescence signal in the reaction system. This indicates that the RPA-CRISPR / Cas12b one-step method of this invention has high specificity and can accurately identify *Dendrobium dendrobium* from the other 13 adulterants.

[0050] Figure 3 The CD results showed that the sensitivity reached 0.5 ng / μL after 30 min of reaction. After 40 min of reaction, the detection limit reached 0.05 ng / μL. Figure 3 According to the EF data, the sensitivity can reach 5 ng / μL after 30 min of reaction.

[0051] Example 4 Example 4 of this invention uses the optimized method from Example 2 to test Dendrobium nobile medicinal material. The specific steps are as follows: Commercially available Dendrobium dentata is mainly sold in the form of dried stems and diced pieces. Thirty-one batches of Dendrobium dentata medicinal material were purchased from the market. 50 mg of Dendrobium dentata medicinal material was taken as a sample, ground into powder using a mortar and pestle, and then processed. DNA was extracted using the method in Example 1, and then amplified using the optimized RPA-CRISPR / Cas12b method in Example 2.

[0052] Using PCR as a comparison, DNA was extracted and amplified using primers CF / R. The total amplification reaction volume was 25 μL, including 12.5 μL premix Tag enzyme, 1 μL forward primer, 1 μL reverse primer, 2 μL DNA template, and 8 μL ddH2O. The amplification reaction program was: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 15 s, 36 cycles, followed by a final extension at 72℃ for 10 min. The PCR products were subjected to Sanger sequencing. The processed sequencing results were BLASTed in the NCBI database. Subsequently, the sequences of 14 species were compared with the sequencing results of 31 batches of medicinal materials to construct a NJ tree for species identification. The results are as follows: Figure 4 As shown.

[0053] Figure 4 The results showed that 23 out of 31 batches of commercially available medicinal materials were genuine Dendrobium nobile, while the other 8 batches were counterfeit (Figures 4A-D), which corresponded to the sequencing results. Figure 5 ).

[0054] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A specific gene sequence for rapid identification of Dendrobium loddigesii Rolfe, characterized in that, The specific gene sequence for rapidly identifying Dendrobium loddigesi is shown as SEQ ID NO.

1.

2. The specific gene sequence for rapid identification of Dendrobium loddigesii according to claim 1, characterized in that, The sequence shown as SEQ ID NO. 1 includes a PAM site.

3. A detection composition for rapid identification of Dendrobium phalaenopsis, characterized in that, The detection composition for rapidly identifying Dendrobium loddigesi includes the following sequences: SEQ ID NO. 2-cb-SF: AGCATTTAGATGCTCCGTGCCTTGTCATCA; SEQ ID NO. 3-cb-SR1: GCACGCACAATACAATAGGCCTTATCCTTT; SEQ ID NO. 7-cb-sgRNA: GUCUAAAGGACAGAUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAACUUCAAGCGAAGUGGCACAUGGAAGUGUUGGUGAAGGC.

4. The detection composition for rapidly identifying Dendrobium swinhoei according to claim 3, wherein, The cb-sgRNA sequence is designed in the 5'-3' direction sequence after the PAM site of the sequence shown as SEQ ID NO. 1 in any one of claims 1-2, and the cb-SF and cb-SR primers are designed with reference to the difference sequence region on both sides of the sgRNA.

5. A Dendrobium detection product, characterized in that, The Dendrobium loddigesi detection product includes the detection composition for rapidly identifying Dendrobium loddigesi according to any one of claims 3-4.

6. The Dendrobium product for detection according to claim 5, wherein, The detection product includes a detection kit and a detection chip.

7. A method for rapid identification of Dendrobium loddigesii based on RPA-CRISPR / Cas12b one-step method, characterized by the steps of As follows: (1) Extracting DNA from the sample to be tested; (2) Using the detection composition for rapidly identifying Dendrobium loddigesi according to any one of claims 3-4, performing RPA and CRISPR / Cas12b reactions simultaneously in the same system, and determining whether it is Dendrobium loddigesi according to the results.

8. The method for rapid identification of D. dentilabrum based on RPA-CRISPR / Cas12b one-step method according to claim 7, wherein, The reaction system of RPA-CRISPR / Cas12b one-step method includes: CRISPR-Cas12b premix, RPA premix, Dendrobium loddigesi specific RPA forward primer cb-SF, reverse primer cb-SR1, reverse primer cb-SR2, DNA template, and magnesium acetate. The CRISPR-Cas12b premix includes: Cas 12b protein, sgRNA shown as SEQ ID NO. 7, and fluorescent reporter gene.

9. Use of the specific gene sequence for rapidly identifying Dendrobium loddigesi according to any one of claims 1-2, or the detection composition according to any one of claims 3-4, or the detection product of the detection composition according to claims 5-6, or the method for identifying Dendrobium loddigesi according to any one of claims 7-8 in the identification of Dendrobium loddigesi.