DNA bar code for identifying germplasm resources of radix saposhnikoviae, identification method and application

Abstract

The invention relates to the technical field of molecular identification, in particular to a DNA bar code for identifying germplasm resources of radix saposhnikoviae, an identification method and application, and the DNA bar code comprises a nucleic acid fragment composed of chloroplast gene fragments ycf2 and ycf3 of radix saposhnikoviae. Eight haploid genotypes are formed in the region in total, the eight haploid genotypes are respectively Hap1, Hap2, Hap3, Hap4, Hap5, Hap6, Hap7 and Hap8, and the base sequences of the eight haploid genotypes are sequentially SEQ ID NO.1-8. Experiments show that the DNA bar code can be used for identifying the germplasm of the radix saposhnikoviae medicinal material, the method is easy to operate and high in accuracy, and the radix saposhnikoviae from different producing areas and different germplasm can be distinguished; the authenticity identification of different batches of radix saposhnikoviae medicinal materials can be quickly and effectively carried out, and the market order stability of the radix saposhnikoviae medicinal materials is guaranteed.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of analytical identification technology, in particular to a DNA barcode and identification method and application for Saposhnikovia divaricata (Turcz.) Schischk. BACKGROUND

[0002] Saposhnikovia divaricata (Turcz.) Schischk. is the main source of Chinese medicine Saposhnikovia divaricata (Turcz.) Schischk. Modern pharmacological studies have shown that it has various pharmacological activities, such as diaphoretic, wind-dampness dispelling, and analgesic functions. As one of the commonly used bulk Chinese medicinal materials, its quality directly affects the clinical drug effect and patient safety. Through germplasm identification, the purity of Saposhnikovia divaricata (Turcz.) Schischk. can be ensured, and the occurrence of confusion and substitutes can be prevented, thereby ensuring the quality of medicinal materials. Therefore, Saposhnikovia divaricata (Turcz.) Schischk. germplasm identification is of great significance in ensuring the quality and safety of medicinal materials, promoting the breeding of excellent varieties of Chinese medicinal materials, promoting the sustainable development of Chinese medicinal material industry, and scientific research and clinical application.

[0003] With the intensification of population aging and the development of the health industry, the market circulation of Chinese medicinal materials is increasing, but the quality problems of Chinese medicinal materials are also emerging. The identification of germplasm resources and quality control of Chinese medicinal materials has become a problem that needs to be solved. Based on the above phenomenon, some scholars have proposed that the quality control of medicinal materials can be realized through the identification of the origin. However, the origin identification of medicinal materials has always been a difficult problem in medicinal material identification. On the one hand, the morphological and organizational differences of medicinal materials from different origins are very small, and traditional Chinese medicine identification methods (experience identification and microscopic identification) cannot solve the problem of mixed samples in the medicinal material market from the root; on the other hand, due to the influence of growth time and sampling time, the differences in effective components of medicinal materials from different origins make it difficult to draw the chemical characteristics of the same medicinal materials from different origins. For example, the market circulation of Saposhnikovia divaricata (Turcz.) Schischk. is relatively chaotic, and mixed products and counterfeit products such as Seselimairei Wolff, Libanotislaticalycina R. H. Shan & M. L. Sheh, and Peucedarum ledebourielloides K. T. Fu have flooded the market. Saposhnikovia divaricata (Turcz.) Schischk. is difficult to identify due to the large number of species and the cross of product name and variety during the sales process. Although there are relevant literature reports on the characteristics and physicochemical identification of Saposhnikovia divaricata (Turcz.) Schischk. and its counterfeit or mixed products, there are few related researches on how to trace the origin of Saposhnikovia divaricata (Turcz.) Schischk. medicinal materials, distinguish different production batches, and screen high-quality varieties.

[0004] Compared with traditional Chinese medicine identification methods, DNA barcoding technology has the advantages of high efficiency, accuracy, universality, objectivity, expansion of detection range, promotion of standardization and automation, and promotion of the development of Chinese herbal medicine industry. These advantages make DNA barcoding technology have broad application prospects and development space in the field of Chinese herbal medicine identification. Chloroplast is a unique organelle in plant cells, and chloroplast genome is double-stranded circular DNA. The evolution rate of plant chloroplast DNA is 3-4 times faster than that of mitochondrial DNA. At the same time, chloroplast DNA is maternally inherited in most angiosperms, and the genetic information is relatively conservative, showing a more highly geographical structure than nuclear genes, that is, differentiation between different regions. Therefore, it can be used for identification and analysis of Chinese herbal medicine germplasm resources. At present, there are few reports on chloroplast gene polymorphic regions that can be used for identification of Angelica polymorpha germplasm. SUMMARY

[0005] In view of the deficiencies of the prior art, the purpose of the present application is to provide a DNA barcode and identification method and application for Angelica polymorpha germplasm resource identification, based on the combined analysis of the chloroplast genome polymorphic gene regions ycf2 and ycf3 of Angelica polymorpha to identify the germplasm resources of Angelica polymorpha samples from different regions.

[0006] In order to achieve the purpose of the present application, the following technical solutions are adopted: on the one hand, the present application provides a DNA barcode for Angelica polymorpha germplasm resource identification, which comprises: a nucleic acid fragment composed of chloroplast gene fragments ycf2 and ycf3 of Angelica polymorpha.

[0007] As a preferred embodiment of the DNA barcode of the present application, the combined gene region of the chloroplast gene fragments ycf2 and ycf3 of Angelica polymorpha (i.e. the nucleic acid fragment composed of chloroplast gene fragments ycf2 and ycf3 of Angelica polymorpha) forms 8 haploid genotypes, which are Hap1, Hap2, Hap3, Hap4, Hap5, Hap6, Hap7 and Hap8, respectively. The base sequences of Hap1, Hap2, Hap3, Hap4, Hap5, Hap6, Hap7 and Hap8 are SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7 and SEQ ID NO. 8, respectively.

[0008] As a preferred embodiment of the DNA barcode of the present application, the ycf2 gene fragment forms 5 haplotypes, AHap1, AHap2, AHap3, AHap4 and AHap5, respectively; the haplotype sequence characteristics of the ycf2 gene fragment are that the specific bases at positions 17 and 1199 of AHap2 are both T, and there is an insertion sequence of SEQ ID NO. 9 at positions 756-757; there is an insertion sequence of SEQ ID NO. 10 at positions 756-757 of AHap3; the specific bases at positions 17 and 1163 of AHap4 are both T; the specific base at position 400 of AHap5 is T.

[0009] As a preferred embodiment of the DNA barcode of the present application, the ycf3 gene fragment forms 3 haplotypes, BHap1, BHap2 and BHap3, respectively; the haplotype sequence characteristics of the ycf3 gene fragment are that there is an insertion sequence of T at positions 731-732 of BHap2, and the specific base at position 589 of BHap3 is A, and there is an insertion sequence of T at positions 731-732.

[0010] In another aspect, the present application provides a primer pair for amplifying or detecting the DNA barcode as described above.

[0011] The full length of the ycf2 gene region is 6284 bp, and the ycf2 primer is designed by taking 3781-5127 bp of the full length of ycf2, wherein, there is a variation in the bases at positions 17 and 1163 of the ycf2 gene region, and the position 17 of the nucleic acid fragment is the position 3797 of ycf2. The full length of the ycf3 gene is 1999 bp, and the ycf3 primer is designed by taking 1189-1939 bp of the full length of ycf3.

[0012] As a preferred embodiment, the primer pair comprises primer pair 1 and / or primer pair 2:

[0013] The primer pair 1 for amplifying or detecting the gene fragment ycf2, the upstream primer and the downstream primer of the primer pair 1 have the nucleotide sequences as shown in SEQ ID NO. 11-12, respectively;

[0014] The primer pair 2 for amplifying or detecting the gene fragment ycf2, the upstream primer and the downstream primer of the primer pair 2 have the nucleotide sequences as shown in SEQ ID NO. 13-14, respectively.

[0015] In another aspect, the present application also provides the use of the DNA barcode or the primer pair in the identification of Angelica gigantea germplasm resources, or in the preparation of a product for identifying Angelica gigantea germplasm resources.

[0016] The product comprises reagents, kits or devices.

[0017] Preferably, the identification of the QFWR germplasm resource comprises QFWR germplasm identification and QFWR seed batch identification.

[0018] Preferably, the QFWR germplasm identification comprises identification of authenticity, origin and / or batch of the QFWR sample.

[0019] Preferably, the product is a reagent or a kit, and the product further comprises at least one of PCR amplification reagents, DNA extraction reagents and sequencing reagents.

[0020] Further, the PCR amplification reagents comprise at least one of dNTPs, DNA polymerase, PCR buffer and pure water.

[0021] In another aspect, the present application further provides application of the aforementioned DNA barcode and the aforementioned kit in identification of QFWR germplasm resource.

[0022] In another aspect, the present application further provides a method for identifying QFWR germplasm resource, comprising: using the primer pair or the kit of the present application to identify QFWR or QFWR seeds.

[0023] Preferably, the method comprises the following steps:

[0024] (1) Selection and planting of QFWR haploid genotypes: collect QFWR seeds of different haploid genotypes, combine haploid genotypes carrying different ycf2 and ycf3, and then plant in batches;

[0025] (2) Identification of QFWR batch samples: collect the planted QFWR samples, extract DNA, amplify and sequence the chloroplast polymorphic gene fragments ycf2 and ycf3 of the samples, obtain the sequencing peak graph, and identify the QFWR germplasm resource by combining the sequence of the DNA barcode and the sequencing peak graph.

[0026] As a preferred embodiment of the identification method of the QF germplasm resource, the specific primers for amplifying the chloroplast polymorphic gene fragment ycf2 of the sample are ycf2-F and ycf2-R, and the specific primers for amplifying the chloroplast polymorphic gene fragment ycf3 of the sample are ycf3-F and ycf3-R; the sequence of ycf2-F is SEQ ID NO. 11, the sequence of ycf2-R is SEQ ID NO. 12, the sequence of ycf3-F is SEQ ID NO. 13, and the sequence of ycf3-R is SEQ ID NO. 14.

[0027] In another aspect, the method for identifying the origin of QF is characterized in that it comprises steps S1-S4:

[0028] S1, collecting QF samples from different origins, extracting genomic DNA, and using the primer pair or the product of the application to amplify the ycf2 and ycf3 gene fragments, respectively, with the genomic DNA as a template;

[0029] S2, sequencing the amplification products and analyzing and determining the haplotypes of the ycf2 and ycf3 gene fragments;

[0030] S3, constructing an origin identification database according to the rare haplotype or combined haplotype;

[0031] S4, obtaining the haplotype of the QF sample to be identified according to steps S1-S2, inputting the haplotype into the origin identification database, and obtaining the origin information of the sample.

[0032] In another aspect, the application provides another method for identifying the origin of QF, which comprises steps S5-S6:

[0033] S5, using the DNA of the QF sample to be identified as a template, and using the primer pair or the product of the application to amplify the ycf2 and ycf3 gene fragments, respectively;

[0034] S6, sequencing the amplification products, constructing a phylogenetic tree of the DNA barcode system shown in SEQ ID NO: 1-8 according to the sequencing results, and determining the origin of the sample according to the clustering results.

[0035] The application has the following beneficial effects:

[0036] 1. The DNA barcode provided by the application can be used for identifying QF medicinal material germplasm, the method is simple to operate, has high accuracy, and can realize the differentiation of QF of different origins and different germplasms.

[0037] 2. The genetic region polymorphism fragment of Angelica pubescens provided by the present application can be used as a DNA barcode for identifying the authenticity of Angelica pubescens medicinal materials, and can quickly and effectively identify the authenticity of different batches of Angelica pubescens medicinal materials, thereby ensuring the stability of the Angelica pubescens medicinal material market order.

[0038] 3. The DNA barcode provided by the present application can provide accurate genetic diversity and population structure analysis for the Angelica pubescens species and provide valuable information. BRIEF DESCRIPTION OF DRAWINGS

[0039] Figure 1 Haplotypes after combined analysis of ycf2 and ycf3;

[0040] Figure 2 Phylogenetic evolution tree of haplotype sequence constructed after combined analysis of ycf2 and ycf3;

[0041] Figure 3 Genetic distance of haplotype sequence constructed after combined analysis of ycf2 and ycf3;

[0042] Figure 4 ycf2 sequencing peak chart of haplotype A Hap1 numbered LNCY and haplotype A Hap2 numbered NMGHLBE;

[0043] Figure 5 ycf3 sequencing peak chart of haplotype B Hap1 numbered HLJDQ and haplotype B Hap3 numbered NMGHLBE. DETAILED DESCRIPTION

[0044] The scheme of the present application will be explained below in combination with examples. Those skilled in the art will understand that the following examples are only used to illustrate the present application, and should not be regarded as limiting the scope of the present application. If the specific techniques or conditions are not specified in the examples, the techniques or conditions described in the literature in the art or according to the product instructions are used. If the manufacturer of the reagent or instrument is not specified, it is a conventional product that can be obtained by market purchase

[0045] Unless otherwise specified, the test materials used in the present application are ordinary commercially available products, which can be purchased in the market.

[0046] The nucleic acid sequence involved in the present application is shown in Table 1.

[0047] Table 1

[0048]

[0049]

[0050]

[0051] The DNA barcode comprises a nucleic acid fragment composed of chloroplast gene fragments ycf2 and ycf3 of Angelica keiskei.

[0052] The ycf2 gene fragment comprises five haplotypes, namely AHap1, AHap2, AHap3, AHap4 and AHap5, and the sequence characteristics of the haplotypes are that the specific bases at positions 17 and 1199 of AHap2 are both T, and there is an insertion sequence shown in SEQ ID NO. 9 at positions 756-757; there is an insertion sequence shown in SEQ ID NO. 10 at positions 756-757 of AHap3; the specific bases at positions 17 and 1163 of AHap4 are both T; and the specific base at position 400 of AHap5 is T.

[0053] The ycf3 gene fragment comprises three haplotypes, namely BHap1, BHap2 and BHap3, and the sequence characteristics of the haploid genotype of the ycf3 gene fragment are that there is an insertion sequence T at positions 731-732 of BHap2, and the specific base at position 589 of BHap3 is A, and there is an insertion sequence T at positions 731-732.

[0054] The nucleic acid fragment composed of the ycf3 gene fragment and the ycf2 gene fragment forms eight haplotypes Hap1-Hap8, and the haplotypes Hap1-Hap8 have the base sequences shown in SEQ ID NOs: 1-8 in sequence.

[0055] In the haplotype Hap1, the genotypes of ycf2 and ycf3 are AHap1 and BHap1 respectively; in the haplotype Hap2, the genotypes of ycf2 and ycf3 are AHap1 and BHap2 respectively; in the haplotype Hap3, the genotypes of ycf2 and ycf3 are AHap1 and BHap3 respectively; in the haplotype Hap4, the genotypes of ycf2 and ycf3 are AHap2 and BHap3 respectively; in the haplotype Hap5, the genotypes of ycf2 and ycf3 are AHap3 and BHap2 respectively; in the haplotype Hap6, the genotypes of ycf2 and ycf3 are AHap4 and BHap2 respectively; in the haplotype Hap7, the genotypes of ycf2 and ycf3 are AHap4 and BHap3 respectively; and in the haplotype Hap8, the genotypes of ycf2 and ycf3 are AHap5 and BHap2 respectively.

[0056] In one specific embodiment of the present application, the present application performs sequencing analysis on Guanfeng wind samples, and finds that for the combined analysis of ycf2 gene and ycf3 gene, the Guanfeng wind samples have their own haplotype, and the haplotype Hap8 can identify the production place of the Guanfeng wind samples in Lindian County, Daqing City, Heilongjiang Province; the haplotype Hap6 can identify the production place of the Guanfeng wind samples in Aihui District, Heihe City, Heilongjiang Province; and the haplotype Hap5 can identify the production place of the Guanfeng wind samples in Chengde City, Hebei Province or Keerqin Youyi Qianqi, Xing'an League, Inner Mongolia.

[0057] The above results show that ycf2 and ycf3 can be used as the core germplasm specific identification DNA barcode for the genuineness of Guanfeng wind.

[0058] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art.

[0059] In the present application, "and / or" is used herein to include "and", "or", and "all or any other combination of the elements linked by the term".

[0060] In the present application, "including", "containing" and "having" are used interchangeably and are intended to mean the inclusive nature of the scheme, meaning that the scheme can have other elements in addition to those listed. It should also be understood that the use of "including", "containing" and "having" in this context provides a "consisting of" scheme.

[0061] In the present application, "at least one" means one or more, and "a plurality" means two or more. "At least one", "at least one" or similar expressions mean any combination of these items, including any combination of single or multiple items.

[0062] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in the present application are ordinary commercially available products, which can be purchased from the market.

[0063] The present application will be further described below in conjunction with the examples:

[0064] Example 1: Screening of polymorphic regions of Guanfeng wind chloroplast genome

[0065] 1.1 Alignment results of chloroplast genome gene regions

[0066] Firstly, the NCBI database was combined with the whole chloroplast genome NC_050292 of Saposhnikovia divaricata (Turcz.) Schischk. Then, the chloroplast genome sequences of three S. divaricata samples from Handan City, Hebei Province, Panshi City, Jilin Province, and Miyun District, Beijing were sequenced, assembled, spliced, and annotated to explore the genetic information of S. divaricata chloroplast genes. The nucleotide diversity (Pi), ClustalX, and mVISTA were used to compare the chloroplast genome sequences of the three S. divaricata samples to obtain the molecular hypervariable region.

[0067] The clustalw2 software was used for multiple sequence alignment analysis of the chloroplast genome. Among the 75 alignment results obtained in the gene region, 55 alignment results had a similarity of 100%, and 9 alignment results had only one difference site. The above 64 genes could not be used for DNA barcode screening. The remaining 11 alignment results were sorted in ascending order of sequence similarity, as shown in Table 2.

[0068] Table 2 Sequence alignment analysis of 11 gene regions of S. divaricata

[0069]

[0070] 1.2 Screening of S. divaricata chloroplast gene region polymorphism region

[0071] For an efficient barcode sequence, in addition to meeting the requirement of sufficient variability to distinguish different species, it also needs to meet the experimental requirements of PCR amplification and PCR product sequencing, so the sequence length is also one of the screening factors. Through experiments, it was determined that the amplification efficiency of S. divaricata gene fragments with a sequence length of 600-1600 bp was high, and the sequencing results were good. The screened gene fragments with a length of 600-1600 bp, a sequence similarity of <98%, and the ability to effectively distinguish species were manually checked, and the gene fragments ycf2 and ycf3 with a large number of haplotypes were screened. The alignment results showed that among the sequence fragments meeting the requirements, only ycf2 and ycf3 genes had specific variation sites in each sample. The full length of ycf2 gene region was 6284 bp, and the fragment was too long to be amplified. The ycf2 primer was designed by intercepting 3781-5127 bp of the full length of ycf2. Among them, there were variations at the 17th position (i.e., the 3797th position of the full length of ycf2) and the 1163th position of the intercepted ycf2 gene region. The full length of ycf3 gene region was 1999 bp, and the ycf3 primer was designed by intercepting 1189-1939 bp of the full length of ycf3 as the target region. Among them, there were variations at the 589th position of the target region (i.e., the 1777th position of ycf3), and there were insertion sequences at the 731-733th positions.

[0072] Therefore, after artificial checking and screening, the ycf2 and ycf3 gene regions can be used as the core germplasm specificity identification DNA barcodes for distinguishing the genuineness of QF.

[0073] Example 2: Taking ycf2 and ycf3 as examples, the gene regions are used to identify different genuineness core germplasms of QF

[0074] 2.1 Collecting QF plants from different regions

[0075] A plurality of medicinal materials from different regions in the country (Table 3) were collected, DNA was extracted, and specific primers ycf2-F: AACATGCTATTGGGTGGTGA; ycf2-R: TGCTACAGCCCTTCCTATCT; ycf3-F: TTGAGCCGACATCCGTTACG; ycf3-R: GCCTAGATCGCGGATAAATGGA were used. The ycf2 and ycf3 fragments were amplified by PCR, and after gel recovery, sequencing was performed.

[0076] Table 3: Collection table of QF samples from different regions

[0077]

[0078] 2.2 Using gene regions to analyze haplotype sequence characteristics and genetic distance of QF from different regions

[0079] Using the barcode sequences obtained by screening in the above examples, haplotype detection was performed on QF samples from different producing areas, so as to investigate the identification ability of the barcode sequences obtained by screening.

[0080] 2.2.1 Using ycf2 to analyze haplotype sequence characteristics of QF from different regions

[0081] The sequencing results were analyzed, and the ycf2 fragment formed 5 haplotypes (AHap1-AHap5). Figure 1 According to the ycf2 haplotype sequence characteristics, the specific bases of AHap2 are T at positions 17 and 1199, and there is an insertion sequence TGATGCTAGTGACGATATTGATGCTAGTGACGATAT at positions 756-757; AHap3 has an insertion sequence TGATGCTAGTGACGATAT at positions 756-757; AHap4 has specific bases T at positions 17 and 1163; and AHap5 has a specific base T at position 400.

[0082] The sequencing analysis of the Guanfengmeng samples in Table 3 showed that, for the ycf2 gene, there were specific haplotypes, such as the exclusive haplotype AHap5 in Daqing City of Heilongjiang Province, and the exclusive haplotype AHap3 in Ke'erqin Youyi Qianqi of Inner Mongolia Autonomous Region and Chengde City of Hebei Province. The above shows that the ycf2 gene can be used for the identification of Guanfengmeng germplasm.

[0083] 2.2.2 Analysis of haplotype sequence characteristics of Guanfengmeng in different regions using ycf3

[0084] Analysis of the sequencing results showed that the ycf3 fragment formed 3 haplotypes (Hap1-Hap3). Figure 1 The sequence characteristics of the ycf3 haplotype were: there was an insertion sequence T at positions 731-732 of BHap2; and the specific base of BHap3 was A at position 589, and there was an insertion sequence T at positions 731-732.

[0085] 2.2.3 Combined analysis using ycf2 and ycf3 fragments

[0086] Combined analysis of ycf2 and ycf3 fragments formed 8 haplotypes (Hap1-Hap8). Figure 1 The sequences of various combined analysis haplotypes are shown in SEQ ID NO. 1-8. Hap1 is AHap1 and BHap1; Hap2 is AHap1 and BHap2; Hap3 is AHap1 and BHap3; Hap4 is AHap2 and BHap3; Hap5 is AHap3 and BHap2; Hap6 is AHap4 and BHap2; Hap7 is AHap4 and BHap3; and Hap8 is AHap5 and BHap2.

[0087] For the combined analysis of ycf2 and ycf3 genes, there were specific haplotypes, and the haplotype Hap8 can identify the origin of the Guanfengmeng sample as Linmen County of Daqing City in Heilongjiang Province; the haplotype Hap6 can identify the origin of the Guanfengmeng sample as Aihui District of Heihe City in Heilongjiang Province; and the haplotype Hap5 can identify the origin of the Guanfengmeng sample as Chengde City of Hebei Province or Ke'erqin Youyi Qianqi of Inner Mongolia Autonomous Region.

[0088] 2.2.4 Phylogenetic tree and genetic distance of Guanfengmeng in different regions after combined analysis using ycf2 and ycf3

[0089] The phylogenetic tree and genetic distance of the haplotype sequences of Guanfengmeng were constructed using MEGA 5 software. Figure 2It can be seen that the phylogenetic tree constructed by haplotype sequences can be divided into two branches, similar to the above sequencing result analysis; Hap5 is a branch; Hap2, Hap3, Hap4, Hap7 and Hap2 are distributed in another branch.

[0090] From Figure 3 It can be seen that the genetic distance of haplotype sequence after combined analysis of different ycf2 and ycf3 of Guanfeng is between 0-0.013, the average genetic distance within the species is 0.0019, among which the genetic distance between haplotype Hap2 and Hap8 is the smallest, which is 0; The genetic distance between Hap3 and Hap1 and the genetic distance between Hap4 and Hap1 are the largest, which is 0.013. The genetic distance analysis result is consistent with the result of phylogenetic evolution tree.

[0091] Example 3 Using Guanfeng chloroplast gene region polymorphism region to prevent counterfeiting of Guanfeng seed batch

[0092] Taking the screened ycf2 and ycf3 sequences as an example, the batch anti-counterfeiting research of Guanfeng seed was carried out.

[0093] 3.1 Using ycf2 gene region sequence to verify the batch anti-counterfeiting of Guanfeng seed

[0094] The experiment uses chloroplast gene region fragments as the main means to establish the production batch bar code of traditional Chinese medicinal materials. The batch bar code used in the experiment includes but is not limited to chloroplast gene region fragments such as ycf2 and ycf3.

[0095] Pick Guanfeng seeds of two different haplotypes numbered LNCY haplotype A Hap1 and numbered NMGHLME haplotype A Hap2 in Table 3 as a production batch to be sown. Sow in April, collect 10 leaves of different plants of Guanfeng in August, extract DNA, and use PCR instrument to amplify ycf2 fragment. After gel recovery, sequencing is carried out. The sequencing peak chart is shown in Figure 4 .

[0096] From Figure 4 It can be seen that the variation sites of ycf2 fragment are obvious: at 17bp, the base of AHap1 is C, and the base of AHap2 is T. There is a C-T peak structure in the peak chart of this site. At 1163bp, the base of AHap1 is G, and the base of AHap2 is T. There is a G-T peak structure in the peak chart of this site.

[0097] From the sequencing results, it can be concluded that the haplotype type of each batch of Guanfeng sample ycf2 fragment peak chart can be measured, the variation site is obvious, there is a peak structure, and the fragment can be used as a batch bar code anti-counterfeiting method.

[0098] 3.2 Using ycf3 gene region sequence to verify the batch anti-counterfeiting of Guanfeng seed

[0099] Pick Figure 1 Seeds of two different haplotypes of *Saposhnikovia divaricata*, haplotype BHap1 (Hypotype HLJDQ) and haplotype BHap3 (Hypotype NMGHLME), were mixed and sown as a single production batch in April. In August, ten leaves from different *Saposhnikovia divaricata* plants were collected, mixed, and DNA was extracted. The ycf3 fragment was amplified using a PCR instrument, recovered from the gel, and sequenced. The sequencing peak diagram is shown below. Figure 4 As shown.

[0100] Depend on Figure 5 The ycf3 fragment mutation site is clearly visible: at 589bp, the base of BHap1 is C and the base of BHap3 is A, and the sequencing peak diagram of this site shows a CA nested peak structure.

[0101] Sequencing results show that the ycf3 fragment peak diagrams of each batch of Guanfangfeng samples can identify the haplotype, with obvious variant sites and overlapping peak structures. This fragment can be used as a batch barcode anti-counterfeiting method.

[0102] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A DNA barcode for identifying germplasm resources of *Saposhnikovia divaricata*, characterized in that, The DNA barcode includes a nucleic acid fragment composed of the chloroplast gene fragments ycf2 and ycf3 from the *Saposhnikovia divaricata* plant.

2. The DNA barcode according to claim 1, characterized in that, The nucleic acid fragment includes eight haplotypes Hap1 to Hap8, each haplotype having the base sequence shown in SEQ ID NO:1 to 8.

3. Primer pairs for amplifying or detecting the DNA barcodes of claim 1 or 2.

4. The primer pair according to claim 3, characterized in that, It includes: Primer pair 1 for amplifying or detecting gene fragment ycf2, wherein the upstream and downstream primers of primer pair 1 have nucleotide sequences as shown in SEQ ID NO. 11~12, respectively; and / or Primer pair 2 for amplifying or detecting gene fragment ycf3, wherein the upstream and downstream primers of primer pair 2 have nucleotide sequences as shown in SEQ ID NO. 13~14.

5. The application of the DNA barcode according to any one of claims 1 to 2 or the primer pair according to any one of claims 3 to 4 in the identification of Guanfangfeng germplasm resources, or in the preparation of products for identifying Guanfangfeng germplasm resources; said products include reagents, kits or devices.

6. The application according to claim 5, characterized in that, The identification of Guanfangfeng germplasm resources includes Guanfangfeng germplasm identification and Guanfangfeng seed batch anti-counterfeiting identification; the Guanfangfeng germplasm identification includes the identification of the authenticity, origin and / or batch of Guanfangfeng samples.

7. A product for identifying germplasm resources of *Saposhnikovia divaricata*, said product comprising reagents, kits, or devices, characterized in that, Includes the DNA barcode as described in any one of claims 1 to 2 or the primer pair as described in any one of claims 3 to 4.

8. The product according to claim 6, characterized in that, The product is a reagent or kit, and the product also includes at least one of PCR amplification reagents, DNA extraction reagents, and sequencing reagents.

9. A method for identifying germplasm resources of *Saposhnikovia divaricata*, characterized in that, The primer pairs according to any one of claims 3 to 4 or the product according to any one of claims 7 to 8 are used to identify *Saposhnikovia divaricata* or *Saposhnikovia divaricata* seeds.

10. The identification method according to claim 9, characterized in that, The steps include the following: (1) Selection and planting of haplotypes of Saposhnikovia divaricata: Collect Saposhnikovia divaricata seeds with different haplotypes, combine seeds carrying different haplotypes of ycf2 and ycf3, and then plant them in batches; (2) Identification of batches of Guanfangfeng samples: Collect planted Guanfangfeng samples, extract DNA, and amplify and sequence the chloroplast polymorphic gene fragments ycf2 and ycf3 of the samples using the primer pairs described in any one of claims 3 to 4 or the products described in any one of claims 7 to 8, respectively, to obtain sequencing peak diagrams. Combine the DNA barcode sequence and sequencing peak diagrams to identify Guanfangfeng germplasm resources.

11. A method for identifying the place of origin of *Saposhnikovia divaricata*, characterized in that, Including steps S1 to S4: S1. Collect samples of *Saposhnikovia divaricata* from different production areas, extract genomic DNA, and use the genomic DNA as a template to amplify the ycf2 and ycf3 gene fragments respectively using the primer pairs described in any one of claims 3 to 4 or the product described in any one of claims 5 to 6. S2. Sequencing the amplified products and analyzing them to determine the haplotypes of the ycf2 and ycf3 gene fragments; S3. Construct a database for origin identification based on rare haplotypes or combined haplotypes; S4. Following steps S1 to S2, obtain the haplotype of the *Saposhnikovia divaricata* sample to be identified, input it into the origin identification database, and obtain the origin information of the sample. Or may include steps S5~S6: S5. Using the DNA of the sample of *Saposhnikovia divaricata* to be identified as a template, the ycf2 and ycf3 gene fragments are amplified using the primer pairs described in any one of claims 3 to 4 or the product described in any one of claims 5 to 6, respectively. S6. Sequencing the amplified product, constructing a phylogenetic tree by combining the sequenced sequence with the DNA barcodes shown in SEQ ID NO:1-8, and determining the origin of the sample based on the clustering results.

Images