KASP molecular marker for detecting stripe rust resistance gene YrZT94.2 of wheat and application of KASP molecular marker

Abstract

The invention belongs to the technical field of molecular biology, and relates to a KASP molecular marker for detecting a wheat stripe rust resistance gene YrZT94.2 and application of the KASP molecular marker. The KASP molecular marker XK7B-32 disclosed by the invention is obtained by utilizing a specific primer group as shown in SEQ ID NO.2-4 for amplification; the KASP molecular marker XK7B-32 is closely linked with a wheat stripe rust resistance gene YrZT94.2, and has a co-separation characteristic, and the polymorphism of the XK7B-32 is C / G. The KASP molecular marker provided by the invention can accurately track the stripe rust resistance gene YrZT94.2 of wheat, performs molecular marker-assisted selection, and improves the breeding efficiency of wheat disease resistance. The method can be simply and quickly applied to screening of the stripe rust resistant gene YrZT94.2 in wheat germplasm resources with high throughput, so that the method is applied to molecular design breeding, and the wheat breeding process is greatly accelerated.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology, and relates to a wheat stripe rust resistance gene YrZT94.2 KASP molecular marker for detection and application. BACKGROUND

[0002] The prevention and treatment of wheat stripe rust mainly relies on two ways of chemical fungicides and cultivation of disease-resistant varieties. Cultivating disease-resistant varieties through exploring disease-resistant genes is a better choice. This method does not rely on chemical agents, can enhance the resistance of wheat from the genetic level, and reduce environmental pressure and pesticide residue problems. At present, 87 officially named wheat stripe rust resistance genes have been identified in the field of scientific research Yr1 ~ Yr87 These genes can be divided into two categories: adult plant resistance genes (APR) and whole growth period resistance genes (ASR) according to the period of resistance effect. The two have significant differences in characteristics. The core feature of whole growth period resistance genes (ASR) is "small species specialization", which only produces resistance to specific stripe rust physiological races or virulence races, and the resistance is controlled by a single major gene, which belongs to a qualitative trait and can work throughout the entire growth cycle of wheat. However, stripe rust has a high frequency of variation, and new types of toxic physiological races often appear in the field, resulting in wheat varieties with single ASR gene as resistance source losing resistance due to small species adaptability in 3-5 years of production, and unable to resist disease continuously. Unlike ASR genes, adult plant resistance genes (APR) are not specific to certain stripe rust races and have broad-spectrum resistance advantages. Even if stripe rust mutates, its resistance ability is not easily lost, so it is considered to have a durable resistance gene. However, most of the currently discovered APR genes are still in the initial positioning stage, and the large positioning interval leads to insufficient precision, and the genetic effects of some genes have not been determined, and there are linkage drag and other problems. The number of APR genes that can be successfully applied to actual breeding production is small.

[0003] In molecular marker technology, single nucleotide polymorphism (SNP) is one of the most widely used types. It is formed by the variation of a single nucleotide in the DNA sequence (including base deletion, insertion, transition, transversion), accounting for more than 90% of all known polymorphic markers, and has high distribution density in the genome, covering intergenic regions, coding regions and non-coding regions, providing rich marker resources for gene mapping and breeding screening. In recent years, the third generation KASP (Competitive Allele Specific PCR) molecular marker technology based on SNP has become an important tool for scientific research and breeding. Its core principle is to use the specific matching of primer end bases to achieve accurate double-allele genotyping of target SNP sites and specific site insertion and deletion (InDel). This technology not only has high accuracy and marker conversion rate, but also has the characteristics of low cost, high throughput detection and simple and fast result analysis, and plays an irreplaceable role in resistance gene mapping, molecular marker assisted selection breeding and wheat germplasm resource resistance identification. SUMMARY

[0004] In view of the above technical problems and defects, the present application provides a wheat stripe rust resistance gene YrZT94.2 KASP molecular marker for detection and application, which is closely linked to the stripe rust resistance gene YrZT94.2 and can accurately screen the stripe rust resistance gene YrZT94.2 , which is of great significance for creating wheat stripe rust resistance materials or wheat stripe rust resistance molecular marker assisted selection breeding.

[0005] In a first aspect, the present application provides a wheat stripe rust resistance gene YrZT94.2 KASP molecular marker for detection, which is XK7B-32 ; The XK7B-32 nucleotide sequence is shown as SEQ ID NO. 1.

[0006] Further, the present application provides a wheat stripe rust resistance gene YrZT94.2 KASP molecular marker for detection, wherein the XK7B-32 is obtained by amplification of three primers, the three primers comprising two forward primers and one reverse primer, and the 5' ends of the two forward primers are respectively added with different fluorescent labels; The two forward primers are forward primer 1 and forward primer 2, the nucleotide sequence of the forward primer 1 is shown as SEQ ID NO. 2, and the nucleotide sequence of the forward primer 2 is shown as SEQ ID NO. 3; The nucleotide sequence of the reverse primer is shown as SEQ ID NO. 4.

[0007] Further, the present application provides a wheat stripe rust resistance gene YrZT94.2In the KASP molecular marker for detection, the fluorescent tags are FAM fluorescent groups and HEX fluorescent groups; The universal primer sequence of the FAM fluorescent group is 5'-GAAGGTGACCAAGTTCATGCT-3'; The universal primer sequence of the HEX fluorescent group is 5'-GAAGGTCGGAGTCAACGGATT-3'.

[0008] Further, the wheat stripe rust resistance gene YrZT94.2 In the KASP molecular marker for detection, the KASP molecular marker is linked to the wheat stripe rust resistance gene YrZT94.2 on the 7BL chromosome of wheat and is co-located; The polymorphism of the KASP molecular marker is C / G.

[0009] In a second aspect, the present application provides a kit for detecting whether wheat contains a wheat stripe rust resistance gene YrZT94.2 , the kit comprising two forward primers and one reverse primer, the two forward primers being forward primer 1 and forward primer 2, the nucleotide sequence of the forward primer 1 being as shown in SEQ ID NO. 2, the nucleotide sequence of the forward primer 2 being as shown in SEQ ID NO. 3, and the nucleotide sequence of the reverse primer being as shown in SEQ ID NO. 4.

[0010] In a third aspect, the present application provides a wheat stripe rust resistance gene YrZT94.2 In a third aspect, the present application provides a wheat stripe rust resistance gene YrZT94.2 application of the KASP molecular marker for detection or the kit for detecting whether wheat contains a wheat stripe rust resistance gene YrZT94.2 , the application comprising: screening wheat varieties with stripe rust resistance and / or screening wheat lines containing a wheat stripe rust resistance gene and / or molecular marker-assisted breeding of wheat with stripe rust resistance.

[0011] In a fourth aspect, the present application provides a screening method for a wheat line containing a wheat stripe rust resistance gene YrZT94.2 , the screening method comprising: performing fluorescent quantitative PCR amplification on a template of a primer pair of the KASP molecular marker for detection of the wheat stripe rust resistance gene YrZT94.2 , according to a genotype of an amplification product; The primer comprises two forward primers and one reverse primer, the two forward primers being forward primer 1 and forward primer 2, the nucleotide sequence of the forward primer 1 being as shown in SEQ ID NO. 2, the nucleotide sequence of the forward primer 2 being as shown in SEQ ID NO. 3, and the nucleotide sequence of the reverse primer being as shown in SEQ ID NO. 4.

[0012] Further, the application provides a screening method of a wheat strain containing a wheat stripe rust resistance gene YrZT94.2 In the screening method of the wheat strain containing the wheat stripe rust resistance gene

[0013] Further, the application provides a screening method of a wheat strain containing a wheat stripe rust resistance gene YrZT94.2 In the screening method of the wheat strain containing the wheat stripe rust resistance gene YrZT94.2 In the screening method of the wheat strain containing the wheat stripe rust resistance gene YrZT94.2 In the screening method of the wheat strain containing the wheat stripe rust resistance gene YrZT94.2

[0014] Further, the application provides a screening method of a wheat strain containing a wheat stripe rust resistance gene YrZT94.2 In the screening method of the wheat strain containing the wheat stripe rust resistance gene The mixed primer is: 12ul of forward primer 1, 12ul of forward primer 2, 30ul of reverse primer, and 46ul of ddH2O. The concentration of the forward primer 1, the forward primer 2 and the reverse primer is 100um.

[0015] Compared with the prior art, the technical scheme provided by the application has at least the following beneficial effects or advantages: The application provides a SNP marker closely linked to the wheat stripe rust resistance gene YrZT94.2 Based on the SNP marker, a KASP marker closely linked to the wheat stripe rust resistance gene YrZT94.2 has the feature of co-segregation, and can accurately identify whether the wheat stripe rust resistance gene YrZT94.2 is contained, so as to eliminate the susceptible plants in the breeding process and improve the breeding work efficiency, which has important significance for creating a wheat stripe rust resistance material or wheat stripe rust resistance molecular marker assisted selection breeding. BRIEF DESCRIPTION OF DRAWINGS

[0016] ​​​In order to make the technical solutions of the embodiments of the present application or the prior art clearer, the accompanying drawings needed in the embodiments or the prior art description will be briefly introduced. Obviously, the accompanying drawings in the following description are only some embodiments of the present application, and other accompanying drawings can be obtained by those skilled in the art without any creative effort on the basis of these accompanying drawings.

[0017] Figure 1 For the wheat stripe rust resistance gene YrZT94.2 The results of the positioning on the 7BL chromosome of wheat.

[0018] Figure 2 For the XK7B-32 The results of the genotyping of the markers on the natural population.

[0019] Figure 3 For the XK7B-32 The results of the genotype and phenotype association of the markers on the natural population. (A) is the IT value, (B) is the DS value, A is the wheat material to be tested containing the stripe rust resistance gene, and B is the wheat material to be tested not containing the stripe rust resistance gene. YrZT94.2 YrZT94.2 The results of the genotype and phenotype association of the markers on the natural population. (A) is the IT value, (B) is the DS value, A is the wheat material to be tested containing the stripe rust resistance gene, and B is the wheat material to be tested not containing the stripe rust resistance gene. DETAILED DESCRIPTION

[0020] The technical solutions of the present application will be described below in combination with the embodiments, but the present application is not limited to the following embodiments. The experimental methods and detection methods described in the embodiments are all conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified. The percentages in the following embodiments are all mass percentages unless otherwise specified. The proportions in the following embodiments are all mass ratios unless otherwise specified.

[0021] Example 1 This embodiment provides the positioning of the YrZT94.2 and the development of the closely linked KASP markers.

[0022] ​In the recombinant inbred line (RIL) consisting of continuous selfing of the cross between wheat germplasm ZTR94 (a stripe rust resistance excellent wheat line selected from the cross between Indian wheat variety PI 183527 and Australian wheat line AvS) and Kenong 9204, a preliminary genetic mapping population is constructed, and a family with phenotypic segregation is selected from the population as a remaining heterozygous line to construct a fine mapping population. The whole test is completed in the field of Yangling District, Shaanxi Province. The specific steps are as follows: the RIL population is row-sown with 20 seeds per row, the fine mapping population is point-sown, the fine mapping population is labeled for sampling, phenotype identification and genotyping, and then the recombinants are screened to narrow the location interval. The two evaluation indexes of reaction type (Infection type, IT) and disease severity (Disease severity, DS) are used for phenotype identification. The identification standard of IT is 0-9 grade, and the identification standard of DS is 0, 1%, 5%, 10%, 20%, 30%, 40%, 60%, 80% and 100%. The CTAB (cetyltrimethylammonium bromide) method is used to extract the genomic DNA of the parent ZTR94 and Kenong 9204, the F2 secondary segregation population and the RIL population. The DNA quality is detected by agarose gel detection method, the DNA quantity is measured by the NanoDrop™ One / OneC ultraviolet spectrophotometer of Thermo, the qualified DNA is sent to Shijiazhuang Boruitai Technology Co., Ltd. for 16K SNP chip typing, and the genetic map is constructed by using IciMapping V4.2. The complete interval mapping method (Inclusive Composite Interval Mapping-ADD, ICIM-ADD) in QTL IciMapping V4.2 is used, the threshold value is set to LOD≥2.5, the stripe rust phenotype is used to detect QTL, and the wheat stripe rust resistance gene YrZT94.2 is located, and the genetic distance between YrZT94.2 and molecular markers is calculated, which is preliminarily located in the 1.19cM interval on the wheat 7BL chromosome by the RIL population and the secondary segregation population (population size 552), and finally located in the 1.19cM interval on the wheat 7BL chromosome YrZT94.2 , corresponding to the Chinese spring reference genome 2.0 physical location of 728.05-730.62Mb, and co-segregated with KASP marker XK7B-32 Figure 1 .

[0023] The molecular markers used in this embodiment are from the 16K chip and resequencing data of the parents ZTR94 and Kenong 9204, the SNP sites obtained are converted into KASP markers by using the Polymarker website, and synthesized in Shanghai Shengong Biological Engineering Co., Ltd.

[0024] KASP markers XK7B-32Resequencing data from parental ZTR94 and Kenon 9204, and YrZT94.2 Co-separation.

[0025] XK7B-32 Nucleotide sequence SEQ ID As shown in NO.1, 5′-TGCATGATGTGTGCATGCGTGCTAGTGTGCTGGCTGGAAGCCTCGCGTGGGTGCTCCGGGGCGATGCGCTGGCTGTGCTCAGCGTGATGTTTGCGGTTGA[C / G]CTTGAGCAGCAAAGCCGTGCAGCAGCAGCAGACAGCAGTGCGGGGTGTTTGTGCACACTGGTGGTGTCGGACGGTAGATGAGGAGCAAGCATCACGGAG-3′.

[0026] XK7B-32 The sequence of the forward primer 1 is shown in SEQ ID NO.2, 5′-GAAGGTGACCAAGTTCATGCTgcGtgatgtttgcggttgaG-3′; XK7B-32 The sequence of the forward primer 2 is shown in SEQ ID NO.3, 5′-GAAGGTCGGAGTCAACGGATTgcGtgatgtttgcggttgaC-3′; XK7B-32 The reverse primer sequence is shown in SEQ ID NO.4 as 5′-tcctcatctctaccgtccg-3′.

[0027] The universal primer for FAM fluorescence is 5′-GAAGGTGACCAAGTTCATGCT-3′. The FAM fluorescent group is observed and read at an excitation wavelength of 485 nm and an emission wavelength of 520 nm. The universal primer for HEX fluorescence is 5′-GAAGGTCGGAGTCAACGGATT-3′. The HEX fluorescent group is observed at an excitation wavelength of 535 nm and an emission wavelength of 556 nm.

[0028] Example 2 This embodiment provides a method for genotyping.

[0029] Identifying whether wheat materials contain stripe rust resistance genes YrZT94.2 The method includes the following steps: S1. Primer synthesis: In the primer mixture, the concentrations of forward primer 1, forward primer 2 and reverse primer are 100 μM, of which the amount of forward primer 1 and forward primer 2 added is 12 μL, the amount of reverse primer added is 30 μL, and the amount of ddH2O added is 46 μL.

[0030] S2. Genomic DNA was extracted from the wheat material to be tested using the CTAB method and used as an amplification template.

[0031] S3. Using genomic DNA from the wheat material to be tested as a template, KASP molecular markers were used for amplification. XK7B-32 Primers were used to amplify the genomic DNA of the wheat material to be tested by PCR to obtain the amplification product.

[0032] S4. The reaction system used to amplify the KASP molecular marker is as follows: 0.2 μg of wheat DNA to be tested, 2 μL of 2×KASPV4.0 Master mix, 0.0448 μL of mixed primers, and 1.9552 μL of ddH2O.

[0033] S5. The reaction procedure for amplifying the KASP molecular marker is as follows: pre-denaturation at 94 °C for 15 min; denaturation at 94 °C for 20 s, annealing at 65 °C for 60 s, 10 cycles, with the annealing temperature decreasing by 0.6 °C per cycle; denaturation at 94 °C for 20 s, annealing at 55 °C for 60 s, 32 cycles.

[0034] S6. Transfer the amplification product to a microplate reader to read the fluorescence data, and then import the fluorescence data into KlusterCaller software for analysis to obtain genotype data. The genotype of a homozygous allele with HEX fluorescence is “Y:Y”, the genotype of a homozygous allele with FAM fluorescence is “X:X”, the genotype of a heterozygous allele is “X:Y” or “Y:X”, and the genotype with a deletion value is “?”.

[0035] In KASP mark XK7B-32 In the test, if the genotype is "X:X", then the wheat material being tested contains the stripe rust resistance gene. YrZT94.2 (Denotes it as A). If the genotype is "Y:Y", then the wheat material being tested does not contain the stripe rust resistance gene. YrZT94.2 (Referred to as B). If the genotype is "X:Y" or "Y:X", then the wheat material being tested contains a heterozygous stripe rust resistance gene. YrZT94.2 .

[0036] Example 3 This embodiment provides molecular markers. XK7B-32 Selecting genes resistant to stripe rust YrZT94.2 Applications in [the field].

[0037] Using the KASP molecular marker described in Example 1 XK7B-32 Genotyping of 329 natural populations using the method described in Example 2 showed that the natural populations could be divided into two types, and co-segregation with disease resistance was observed. Figure 2 ).like Figure 2 As shown, if the genotype is "X:X", then the wheat material being tested contains the stripe rust resistance gene. YrZT94.2 If the genotype is "Y:Y", then the wheat material being tested does not contain the stripe rust resistance gene. YrZT94.2 Let it be denoted as B. For example... Figure 3 As shown, in the mark XK7B-32 Contains genes that resist stripe rust YrZT94.2 The average IT value of the plants was 3.75, which was significantly lower than that of plants without the stripe rust resistance gene. YrZT94.2 The plants had an average IT value of 6.22 and contained a gene for resistance to stripe rust. YrZT94.2 The average DS of the plants was 18.51, which was significantly lower than that of plants without the stripe rust resistance gene. YrZT94.2 The average DS of the plants was 48.83, consistent with the expected results. The molecular markers of this invention... XK7B-32 Able to quickly YrZT94.2 Selection and germplasm resource screening can be applied to YrZT94.2 Molecular-assisted selection breeding can accelerate the breeding process.

[0038] As described above, the basic principles, main features, and advantages of the present invention have been well described. The above embodiments and specifications are merely descriptions of preferred embodiments of the present invention, and the present invention is not limited to the above embodiments. Various changes and improvements made to the technical solutions of the present invention by those skilled in the art without departing from the spirit and scope of the present invention should fall within the protection scope defined by the present invention.

Claims

1. Wheat stripe rust resistance gene YrZT94.2 The KASP molecular marker for detection is characterized by, The KASP molecular marker is XK7B-32 ; The XK7B-32 The nucleotide sequence is shown in SEQ ID NO.

1.

2. The wheat stripe rust resistance gene according to claim 1 YrZT94.2 The KASP molecular marker for detection is characterized by, The XK7B-32 The amplification was achieved using three primers, including two forward primers and one reverse primer. Different fluorescent tags were added to the 5′ ends of the two forward primers. The two forward primers are forward primer 1 and forward primer 2. The nucleotide sequence of forward primer 1 is shown in SEQ ID NO.2, and the nucleotide sequence of forward primer 2 is shown in SEQ ID NO.

3. The nucleotide sequence of the reverse primer is shown in SEQ ID NO.

4.

3. The wheat stripe rust resistance gene according to claim 2 YrZT94.2 The KASP molecular marker for detection is characterized by, The fluorescent tag is a FAM fluorescent group and a HEX fluorescent group; The universal primer sequence for the FAM fluorescent group is 5′-GAAGGTGACCAAGTTCATGCT-3′; The universal primer sequence for the HEX fluorescent group is 5′-GAAGGTCGGAGTCAACGGATT-3′.

4. The wheat stripe rust resistance gene according to claim 1 YrZT94.2 The KASP molecular marker for detection is characterized by, The KASP molecular marker is related to the wheat stripe rust resistance gene. YrZT94.2 Linked and co-located on wheat chromosome 7BL; The polymorphism of the KASP molecular marker is C / G.

5. A method for detecting whether wheat contains a stripe rust resistance gene. YrZT94.2 The reagent kit is characterized by, The kit contains two forward primers and one reverse primer. The two forward primers are forward primer 1 and forward primer 2. The nucleotide sequence of forward primer 1 is shown in SEQ ID NO.2, the nucleotide sequence of forward primer 2 is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

4.

6. The wheat stripe rust resistance gene according to any one of claims 1 to 4 YrZT94.2 The detection method uses the KASP molecular marker or the method described in claim 5 to detect whether wheat contains the stripe rust resistance gene. YrZT94.2 The application of the reagent kit is characterized by, The applications include: screening wheat varieties resistant to stripe rust and / or screening varieties containing wheat stripe rust resistance genes. YrZT94.2 Wheat lines and / or molecular markers assist in the breeding of stripe rust-resistant wheat.

7. A gene containing wheat resistance to stripe rust. YrZT94.2 The method for screening wheat lines is characterized by, include: Using the genomic DNA of the wheat material to be tested as a template, the wheat stripe rust resistance gene described in any one of claims 1 to 4 was used. YrZT94.2 The template was amplified by real-time quantitative PCR using primers with KASP molecular markers, and the genotype was determined based on the amplification products.

8. The wheat stripe rust resistance gene according to claim 7 YrZT94.2 The method for screening wheat lines is characterized by, The homozygous allele genotype with HEX fluorescence is "Y:Y", the homozygous allele genotype with FAM fluorescence is "X:X", the heterozygous genotype is "X:Y" or "Y:X", and the deletion genotype is "?".

9. The wheat stripe rust resistance gene according to claim 8 YrZT94.2 The method for screening wheat lines is characterized by, If the genotype of the KASP molecular marker is "X:X", then the wheat material being tested contains the stripe rust resistance gene. YrZT94.2 ; If the genotype of the KASP molecular marker is "Y:Y", then the wheat material being tested does not contain the stripe rust resistance gene. YrZT94.2 ; If the genotype of the KASP molecular marker is "X:Y" or "Y:X", then the wheat material being tested contains a heterozygous stripe rust resistance gene. YrZT94.2 .

10. The wheat stripe rust resistance gene according to claim 7 YrZT94.2 The method for screening wheat lines is characterized by, The PCR amplification system consisted of: 0.2 μg of the wheat DNA to be tested, 2 μL of 2×KASPV4.0 Master mix, 0.0448 μL of mixed primers, and 1.9552 μL of ddH2O. The mixed primers consist of: 12 μL of forward primer 1, 12 μL of forward primer 2, 30 μL of reverse primer, and 46 μL of ddH2O. The concentrations of forward primer 1, forward primer 2, and reverse primer were 100 μM.

Images