Compound capable of inducing totipotent embryonic stem cells and preparation method thereof

Abstract

The invention provides a compound capable of inducing totipotent embryonic stem cells, the structural general formula of the compound is shown in the specification, and the preparation method of the compound comprises the following steps: (1) preparing an intermediate Int-1, (2) preparing a Boc-removed product Int-2, and (3) preparing a product MYF. The micromolecule compound (MYF) can simultaneously activate human and mouse totipotent embryonic stem cells in vitro, and fills the technical blank that a single micromolecule can only activate human or mouse totipotent embryonic stem cells independently in the prior art.

Description

Technical Field

[0001] This invention relates to the field of compound technology, and in particular to a small molecule compound applied to cell totipotency. Background Technology

[0002] The difference between totipotency and pluripotency lies in the fact that pluripotent stem cells / embryos can differentiate into most organs but lack the ability to develop into a complete individual, while totipotent stem cells / embryos have the potential to develop into a complete individual. In the field of cell totipotency research, totipotent embryos and spontaneously generated totipotent stem cells are difficult to obtain in large quantities, while in vitro induced totipotent stem cells can be easily isolated from pluripotent embryonic stem cells, making them good in vitro cell models for studying totipotency and the zygotic genome activation process during embryonic development.

[0003] The generation of pluripotent embryonic stem cells is regulated by multiple factors, such as transcriptional levels: the emergence of pluripotency is accompanied by the expression of a transcriptional network activated by the zygote. Cis-acting elements, trans-acting factors, and both coding and non-coding RNAs actively participate in zygote activation and the establishment of pluripotency. Transcription factors function by recognizing specific DNA sequences and recruiting RNA polymerase II for specific gene transcription. Pluripotent embryonic stem cells possess their own unique transcriptional regulatory network. Currently, the understanding of the pluripotency transcriptional regulatory network is still in its early stages, and several positive and negative transcription factors have been identified from in vivo and in vitro pluripotency models. Among all pluripotency-related transcription factors, Dux is a significantly studied dual-homological-domain transcription factor. It was initially discovered to reprogram pluripotent mouse embryonic stem cells into mouse two-cell embryo-like cells. After Dux induction, mouse two-cell embryo-related genes, including the Zscan4 family, and mouse two-cell embryo-specific retrotransposons are transcribed and activated, and the chromatin state is reorganized to resemble that of a mouse two-cell embryo. In addition to the influence at the transcriptional level, the transition from pluripotency to totipotency also requires changes in epigenetic state, such as totipotency being associated with lower global repressive histone modifications and increased chromatin accessibility.

[0004] Based on the above theoretical foundation, other studies on in vitro induction and activation of pluripotent embryonic stem cells have emerged. In 2021, Cell reported that the small molecule compound cleavage body inhibitor (PlaB) could induce the generation of totipotent blastomere-like cells (TBLCs), but the specific mechanism by which it activates the pluripotency gene remains unclear. Following the report on cleavage body inhibitors, other articles reported the use of compound combinations to induce the construction of pluripotent cell lines in vitro. For example, in 2022, a combination of DOT1L inhibitor (SGC0946), KDM5B inhibitor (AS8351), and G9a inhibitor (A366) was reported to generate totipotent-like stem cells (TLSCs). Recently, a study reported a culture condition that reprogrammed cells using a combination of TTNPB, 1-azakenpaullone, and a WS6 inhibitor to chemically induce pluripotent stem cells (ciTotiSCs) that are similar to mouse totipotent two-cell embryonic cells at the transcriptional, epigenetic, and metabolic levels. Furthermore, studies have reported that culture conditions using a combination of HDAC1 / 2 inhibitors and DOT1L inhibitors can yield pluripotent stem cells from two-cell embryos. In vivo chimerism assays have demonstrated that these cells possess embryonic and extraembryonic developmental potential at the single-cell level and can induce blastocyst-like structures from TPS cells in vitro. In addition to inducing pluripotent-like cells in mouse embryonic stem cells, the combined use of IWR1, PD0325901, DZNep, TSA, and other auxiliary compounds in human embryonic stem cells (hESCs) can also significantly enhance the expression of marker genes in human eight-cell-like cells.

[0005] To date, numerous studies have reported that different compounds can induce the in vitro generation of human or mouse pluripotent embryonic stem cells, but many questions remain to be addressed. First, combined treatment with multiple compounds (chemical cocktail) increases unknown side effects during cell reprogramming, while using a single compound can mitigate these side effects. Second, although the single compound cleavage inhibitor PlaB has been reported to activate pluripotent blastomeres, its specific biomolecular mechanism remains unclear. Finally, current technology lacks compounds capable of simultaneously activating human and mouse pluripotent embryonic stem cells.

[0006] Therefore, finding a single compound with a well-defined mechanism to induce the generation of human and mouse pluripotent embryonic stem cells has become key to solving the problem of insufficient supply of in vitro pluripotency research models. Summary of the Invention

[0007] The technical problem to be solved by the present invention is to provide a small molecule compound that can simultaneously induce pluripotent embryonic stem cells in humans and mice in vitro, addressing the problems existing in the prior art.

[0008] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0009] This invention provides a compound capable of inducing pluripotent embryonic stem cells, the compound having the following general structural formula:

[0010] Equation (I);

[0011] Preferably, the Ar group is a variable aromatic group selected from phenyl, alkyl, substituted alkyl, alkoxy or halogen-substituted phenyl.

[0012] Preferably, the X group is selected from one of oxygen atom, methyl, sulfur atom or imino.

[0013] Preferably, the X group is an oxygen atom or a methyl group.

[0014] Preferably, the I portion is selected from 2-thiazolyl, 3-pyridinyl, 1-imidazolyl, and 2-pyrimidinyl.

[0015] Preferably, the I portion is 2-thiazolyl or 3-pyridyl.

[0016] Preferably, the R group is selected from one of hydrogen atom, alkoxy group, alkyl group, substituted alkyl group, and halogen group.

[0017] Preferably, the R group is a hydrogen atom or an alkoxy group.

[0018] Preferably, the compound is a small molecule compound MYF, which can simultaneously activate the generation of human and mouse pluripotent embryonic stem cells in vitro.

[0019] Preferably, the specific structure of the small molecule compound is selected from one of the following structural formulas:

[0020] MYF-16: ,

[0021] MYF-28: ,

[0022] MYF-42: ,

[0023] MYF-45: .

[0024] The present invention also provides a method for preparing the above-mentioned compound capable of inducing pluripotent embryonic stem cells, comprising the following specific steps:

[0025] (1) Preparation of intermediate Int-1:

[0026] (1.1) Take the raw material A containing part I of formula (I) and potassium carbonate into a reaction vessel, add acetonitrile solvent, stir magnetically at room temperature for 1~48h at a stirring speed of 200~2000rpm, then add N-Boc-bromoethylamine, and incubate overnight in an oil bath at 60℃.

[0027] (1.2) After raw material A is basically consumed, the reaction solution is poured into saturated brine and extracted. The crude product is then separated and purified by silica gel column chromatography to obtain intermediate Int-1.

[0028] (2) Preparation of Boc-free product Int-2: Dissolve intermediate Int-1 in DCM solvent, stir magnetically at room temperature for 1~48h at a stirring speed of 200~2000rpm, then add trifluoroacetic acid (TFA), and continue stirring at room temperature for 2h until intermediate Int-1 is completely consumed to generate Boc-free product Int-2. Concentrate the reaction solution under reduced pressure at a vacuum degree of 5~500mbar until no liquid is distilled off. The crude product Int-2 is directly used in the next step of the reaction.

[0029] (3) Preparation of product MYF:

[0030] (3.1) Place the crude Int-2 product obtained in step (2), the raw material B containing the group in part II of formula (I) (red group) and N,N-diisopropylethylamine in a reaction vessel, add DMF solvent, stir magnetically at room temperature, add condensing agent HATU, and then stir at room temperature for 6 hours.

[0031] (3.2) After raw material B is completely consumed, the reaction solution is poured into saturated saline solution and extracted with ethyl acetate. The crude product is purified by silica gel column chromatography to obtain product MYF.

[0032] Preferably, the synthetic route for the compound of product MYF is as follows:

[0033] ;

[0034] ;

[0035] .

[0036] The beneficial effects of this invention are:

[0037] (1) The present invention obtains a novel small molecule compound with low cytotoxicity (named MYF) by optimizing and modifying the structure of the drug. This compound is non-cytotoxic in mouse embryonic stem cells at a final concentration of 10 µM and can significantly increase the production of pluripotent cells and can complete long-term culture.

[0038] (2) The small molecule compound (MYF) of the present invention can activate human and mouse pluripotent embryonic stem cells in vitro. Therefore, the small molecule compound can activate both human and mouse pluripotent embryonic stem cells, filling the technical gap in the prior art where a single small molecule can only activate human or mouse pluripotent embryonic stem cells.

[0039] (3) Using the small molecule compound (MYF) of the present invention for in vitro induction, it only takes 2-4 hours to induce the expression of totipotent genes, and it does not produce toxicity to cells, thus improving the induction efficiency. It is also simple to operate and easy to implement.

[0040] (4) The small molecule compound (MYF) of the present invention has a clearly defined target. The small molecule induces pluripotency through the target Annexin11, and the target is clearly defined. Attached Figure Description

[0041] Figure 1 This is a fold change map of the MYF series compounds and the mouse totipotency marker genes (Dux, Zscan4) in the DMSO control group in Example 5 of this invention.

[0042] Figure 2 This is a schematic diagram of the modified photoaffinity probe in Embodiment 6 of the present invention.

[0043] Figure 3 This is a graph showing the results of fluorescence quantitative PCR detection of the expression of pluripotent genes (Dux, Zscan4) in Example 6 of the present invention.

[0044] Figure 4 This is the mass spectrum of the MYF-16 target protein detection in Example 6 of the present invention.

[0045] Figure 5 This is a schematic diagram of real-time PCR and Western blot detection of proteins in Example 7 of the present invention.

[0046] Figure 6 This is a graph showing the cytotoxicity test results of the MYF-16 compound on mouse embryonic stem cells in Example 8 of this invention.

[0047] Figure 7 This is a graph showing the results of quantitative real-time PCR detection of the activation marker gene of human pluripotent embryonic stem cells by the MYF-16 compound in Example 9 of this invention.

[0048] Figure 8 This is a graph showing the results of the detection of heterogeneity of mouse pluripotent embryonic stem cells by the MYF-16 compound in Example 10 of this invention. Detailed Implementation

[0049] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be described in detail, clearly, and completely below with reference to the accompanying drawings and embodiments. Obviously, the described embodiments are merely some embodiments of the present invention, and not all embodiments. Furthermore, based on the embodiments of the present invention, any modifications, equivalent substitutions, improvements, etc., made by those skilled in the art to all other embodiments obtained without creative effort should be included within the protection scope of the present invention.

[0050] To enable those skilled in the art to better understand the technical solutions of this invention, some technical terms of this invention are first explained. In the text of this invention, these explanations are mainly to help those skilled in the art understand and implement the technical solutions of this invention, rather than to limit this invention. Furthermore, other disclosures outside of this invention may have other technical interpretations of these technical terms. To avoid technical ambiguity, the understanding of this invention should be based on these explanations.

[0051] The "compounds" described in this invention include all stereoisomers, geometric isomers, tautomers, and isotopes.

[0052] The "small molecule compounds" described in this invention, from a chemical perspective, refer to compounds with very small molecular weights, typically biological functional molecules with a molecular weight less than 1000 Daltons (especially less than 400 Daltons); from a biological perspective, they are naturally occurring or artificially synthesized compounds composed of elements such as carbon, hydrogen, oxygen, nitrogen, sulfur, and phosphorus that possess biological activity. In this invention, the names MYF, SM, and Int series compounds are specific to the technical solution of this invention and have no technical meaning; they are used to distinguish the compounds of this invention from other compounds.

[0053] Example 1: Synthesis of compound MYF-16.

[0054] Synthesis Step 1: 3-Hydroxypyridine (10 mmol) and potassium carbonate (15 mmol) were placed in a single-necked flask, and 30 mL of MeCN (acetonitrile solvent) was added. The mixture was magnetically stirred at 200-2000 rpm for 1-48 hours at room temperature. Then, N-Boc (tert-butyloxycarbonyl)-bromoethylamine (11 mmol) was added, followed by heating in an oil bath at 60°C overnight. LC-MS showed that 3-hydroxypyridine was almost completely consumed, and the product peak was the dominant peak. The reaction mixture was poured into saturated brine and extracted with ethyl acetate. The crude product was purified by silica gel column chromatography (50% EA in PE) to obtain intermediate Int-1 (6.2 mmol).

[0055] The synthesis route is as follows:

[0056]

[0057] Synthesis Step 2: Intermediate Int-1 (6.2 mmol) was dissolved in 20 mL of DCM solvent. The mixture was magnetically stirred at 200–2000 rpm for 1–48 h at room temperature. Then, 4 mL of trifluoroacetic acid (TFA) was added, and stirring continued at room temperature for 2 h. LC-MS showed complete consumption of Int-1, yielding the de-Boc product Int-2. The reaction mixture was concentrated under reduced pressure at 5–500 mbar until no more liquid was distilled off. The crude Int-2 product was directly used in the next reaction step.

[0058] The synthesis route is as follows:

[0059]

[0060] Synthesis Step 3: The crude Int-2 product obtained in the previous step, SM-1 (5.6 mmol), and DIEA (31 mmol) were placed in a single-necked flask, and 30 mL of DMF solvent was added. Magnetic stirring was started at room temperature, followed by the addition of HATU condensing agent (5.6 mmol), and stirring was continued at room temperature for 6 hours. LC-MS showed that SM-1 was completely consumed, and the product MYF-16 was the main peak. The reaction solution was poured into saturated brine and extracted with ethyl acetate. The crude product was purified by silica gel column chromatography (80% EA in PE) to obtain MYF-16 (3.3 mmol).

[0061] The synthesis route is as follows:

[0062]

[0063] Product Analysis: 1H NMR (400 MHz, DMSO-d6) δ 9.03 (t, J = 5.7 Hz, 1H), 8.31 (dd, J = 3.0, 0.7 Hz, 1H), 8.17 (dd, J = 4.6, 1.4 Hz, 1H), 7.98 – 7.89 (m,2H), 7.61 – 7.50 (m, 3H), 7.43 (ddd, J = 8.5, 3.0, 1.4 Hz, 1H), 7.39 (s, 1H), 7.33 (ddd, J = 8.4, 4.6, 0.7 Hz, 1H), 4.22 (t, J = 5.8 Hz, 2H), 3.67 (q, J =5.8 Hz, 2H). LCMS (ESI): m / z = 310 [M+H] + .

[0064] Example 2, Synthesis of compound MYF-28.

[0065] In this embodiment, following steps one and two of the synthesis in embodiment 1, Int-2 is replaced with Int-3 in step three of the synthesis. The synthesis route is as follows:

[0066]

[0067] Product Analysis: 1 H NMR (400 MHz, DMSO-d6) δ 9.49 (t, J = 6.1 Hz, 1H), 8.52 (dd, J = 5.1, 0.8 Hz, 1H), 8.50 (dd, 1H), 7.98 – 7.91 (m, 2H), 7.71 (dd, J =2.2, 0.8 Hz, 1H), 7.61 – 7.50 (m, 3H), 7.43 – 7.38 (m, 2H), 7.34 (ddd, J =5.1, 1.7, 0.7 Hz, 1H), 4.52 (d, J = 6.1 Hz, 2H), 2.53 (s, 3H), 2.33 (s, 3H). LCMS (ESI): m / z = 385 [M+H] + .

[0068] Example 3, Synthesis of compound MYF-42.

[0069] Following synthesis steps one and two in Example 1, 3-hydroxypyridine was replaced with 5-hydroxy-2-methoxypyridine to obtain intermediate Int-4.

[0070] Following step three of the synthesis in Example 1, Int-2 is replaced with Int-4 to obtain MYF-42.

[0071] The synthesis route is as follows:

[0072]

[0073] Product Analysis: 1 H NMR (400 MHz, DMSO-d6) δ 9.00 (t, J = 5.7 Hz, 1H), 7.98 –7.90 (m, 2H), 7.88 (dd, J = 3.1, 0.6 Hz, 1H), 7.62 – 7.50 (m, 3H), 7.42 (dd,J = 9.0, 3.1 Hz, 1H), 7.38 (s, 1H), 6.76 (dd, J = 8.9, 0.6 Hz, 1H), 4.13 (t,J = 5.8 Hz, 2H), 3.63 (q, J = 5.8 Hz, 2H). LCMS (ESI): m / z = 340 [M+H] + .

[0074] Example 4, Synthesis of compound MYF-45.

[0075] Following synthesis steps one and two in Example 1, 3-hydroxypyridine was replaced with 3-cyano-5-hydroxypyridine to obtain intermediate Int-5.

[0076] Following step three of the synthesis in Example 1, Int-2 is replaced with Int-5 to obtain MYF-45.

[0077] The synthesis route is as follows:

[0078]

[0079] Product Analysis: 1 H NMR (400 MHz, Chloroform-d) δ 8.57 (s, 1H), 8.53 (s, 1H), 7.88 – 7.76 (m, 2H), 7.57 – 7.41 (m, 4H), 7.30 (t, J = 6.9 Hz, 1H), 6.99 (s,1H), 4.27 (t, J = 5.2 Hz, 2H), 3.95 (q, J = 5.5 Hz, 2H). LCMS (ESI): m / z = 335[M+H] + .

[0080] Example 5: Synthesis of probe compound PAL1.

[0081] The methyl group of MYF-42 was removed using hydrobromic acid and acetic acid: 1 mmol of MYF-42 was dissolved in a 33% hydrobromic acid and acetic acid solution. The solution was heated at 50°C for 1 hour with magnetic stirring. LC-MS indicated that MYF-42 was completely consumed, yielding the demethylated product Int-7. The reaction solution was poured into water and extracted three times with ethyl acetate. The combined organic phases were dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue obtained did not require purification and was used directly in the next reaction step.

[0082] The synthesis route is as follows:

[0083]

[0084] Int-7 crude product and starting material SM-2 (1.1 mmol) were dissolved in acetonitrile, and potassium carbonate (3 mmol) was added. The mixture was magnetically stirred at room temperature, and after 2 hours, LC-MS monitoring indicated the formation of product PAL1. The reaction solution was poured into saturated brine and extracted with ethyl acetate. The crude product was purified by silica gel column chromatography (70% EA in PE) to obtain PAL1 (0.3 mmol).

[0085] The synthesis route is as follows:

[0086]

[0087] Product Analysis: 1 H NMR (400 MHz, DMSO-d6) δ 9.00 (t, J = 5.7 Hz, 1H), 7.99 –7.89 (m, 2H), 7.86 (dd, J = 3.0, 0.6 Hz, 1H), 7.61 – 7.51 (m, 3H), 7.42 (dd,J = 9.0, 3.1 Hz, 1H), 7.38 (s, 1H), 6.76 (dd, J = 9.0, 0.6 Hz, 1H), 4.14 (t,J = 5.8 Hz, 2H), 4.02 (t, J = 6.3 Hz, 2H), 3.63 (q, J = 5.7 Hz, 2H), 2.82 (t,J = 2.6 Hz, 1H), 2.02 (td, J = 7.4, 2.7 Hz, 2H), 1.84 (t, J = 6.3 Hz, 2H), 1.62 (t, J = 7.4 Hz, 2H). LCMS (ESI): m / z = 446 [M+H] +.

[0088] Example 6: Synthesis of probe compound PAL2.

[0089] The cyano group of MYF-45 was reduced to aminomethyl group by Raney nickel catalytic hydrogenation: 1 mmol of MYF-45 was dissolved in methanol, and hydrogenation was carried out under magnetic stirring with Raney nickel catalytic hydrogenation for 16 hours. LC-MS showed that MYF-45 was completely consumed, generating the hydrogenated product Int-8. The reaction solution was filtered to remove solids such as Raney nickel, and concentrated under reduced pressure. The residue obtained did not require purification and was used directly in the next reaction.

[0090] The synthesis route is as follows:

[0091]

[0092] Int-8 crude product, starting material SM-3 (1.1 mmol), and DIEA (3 mmol) were placed in a single-necked flask, and 3 mL of DMF solvent was added. The mixture was magnetically stirred at room temperature, followed by the addition of HATU condensing agent (1.1 mmol), and then stirred at room temperature for 2 hours. LC-MS indicated complete consumption of Int-8, yielding product PAL2. The reaction mixture was poured into saturated brine and extracted with ethyl acetate. The crude product was purified by silica gel column chromatography (90% EA in PE) to obtain PAL2 (0.2 mmol).

[0093] The synthesis route is as follows:

[0094]

[0095] Product analysis: LCMS (ESI): m / z = 487 [M+H] + .

[0096] Example 7: Detection of activation marker genes of mouse pluripotent embryonic stem cells by MYF series compounds using real-time quantitative PCR.

[0097] The stock solutions of the MYF series compounds (MYF-16, MYF-28, MYF-41 and MYF-45) synthesized in Examples 1-4 were diluted 1:1000 (final concentration 10 µM) and added to freshly prepared Serum / LIF medium to culture mouse embryonic stem cells for 24 hours for subsequent detection.

[0098] RNA extraction and reverse transcription reaction

[0099] Remove the culture medium from the cells to be tested, add an appropriate volume of Trizol reagent, and lyse them using a pipette to transfer the lysate to a DNase / RNase-free Ep tube. Add 1 / 5 volume of chloroform to the Trizol reagent, vortex for 10 s, let stand for 3 minutes, centrifuge at 12000 rcf at 4˚C for 10 minutes, and then transfer the supernatant to 1 volume of isopropanol, vortex for 10 s, let stand for 5 minutes, and centrifuge at 12000 rcf at 4˚C for 10 minutes. Wash the RNA precipitate twice with 75% ethanol prepared with DEPC water, then dissolve the RNA in an appropriate amount of DEPC water (nuclease-free water), and use Nanodrop to detect the RNA quality and concentration.

[0100] Prepare the following mixture in an RNase-free centrifuge tube: 1 µg RNA, 4 µl 4 × g DNA wiperMix, and DEPC water to make up to 16 µl. Gently pipette to mix and incubate at 42°C for 2 min in a PCR instrument. Add 4 µl 5 × qRT SuperMix II directly to the reaction tube from step 1, gently pipette to mix, and incubate at 50˚C for 15 min, then at 85˚C for 2 min in a PCR instrument.

[0101] Real-time PCR detection

[0102] The reverse transcription product was diluted 5-fold with DEPC water and used as a cDNA template. The following mixture was prepared in a qPCR tube: 5 µl 2 × Taq Pro Universal SYBR qPCR Master Mix (a universal dye-based qPCR premix for stable detection of low expression systems), 0.2 µl 10 µM forward primer, 0.2 µl 10 µM reverse primer, 1 µl cDNA template, and 3.6 µl DEPC water.

[0103] The nucleotide sequence number of the forward primer is:

[0104] sgAnxa11T1: AGGACCTCGGCATCTCGCAA;

[0105] The nucleotide sequence number of the reverse primer is:

[0106] sgAnxa11T2:CTATCCTTCAAGACGGCCTA.

[0107] Perform qPCR reactions under the following conditions: Stage 1: pre-denaturation, 95˚C / 30s, 1 cycle; Stage 2: cyclic reaction, 95˚C / 10s, 60˚C / 15s, 45 cycles; Stage 3: melting curve, using the instrument's default melting curve acquisition program.

[0108] Each experiment was performed in triplicate, using DMSO as the vehicle and the Gapdh (glyceraldehyde-3-phosphate dehydrogenase) gene as an internal control. The relative quantification method was used to compare the transcriptional expression differences of mouse embryonic stem cell pluripotency marker genes. ΔΔCt = [mean Ct value of pluripotency marker genes in the MYF group - mean Ct value of Gapdh in the MYF group] - [mean Ct value of pluripotency marker genes in the DMSO group - mean Ct value of Gapdh in the DMSO group]. Then, a 2... ‐ΔΔCt The fold relationship between the MYF series compounds and the DMSO control group in terms of mouse totipotency marker genes (Dux, Zscan4) was calculated, and the results are shown in [Table missing]. Figure 1 The results showed that MYF-16 significantly activated mouse totipotency marker genes (Dux, Zscan4) more than other MYF series compounds, therefore MYF-16 was used for subsequent studies.

[0109] Example 8, Detection of MYF-16 target protein.

[0110] MYF-16 was modified into photoaffinity probes PY-MYF containing Alkyne (PAL1, PAL2, preparation process see Examples 4 and 5), and the results are as follows. Figure 2 10 mM photoaffinity probes PAL1 or PAL2 and MYF-16 stock solutions were diluted 1:1000 (final concentration 10 µM) and added to freshly prepared Serum / LIF medium. Mouse embryonic stem cells were cultured for 24 hours, and the expression of pluripotency genes (Dux, Zscan4) was detected by quantitative real-time PCR. The results are as follows: Figure 3 The results showed that PAL1 cells had good permeability and the MYF-16 pharmacophore was fully preserved.

[0111] PAL1 was detected using Click Reaction-mass spectrometry (CMS). First, two 10 cm cell culture dishes were filled with mESC cells to 80% saturation. The cells were then incubated in phenol red-free medium with 10 ml of PAL1 and DMSO (dimethyl sulfoxide) at 37˚C for 2 h. Afterward, the cells were irradiated with UV light (365 nm) at 4˚C for 10 min. The cells were washed twice with PBS, scraped from the tubes with 5 ml of PBS into 15 ml centrifuge tubes, centrifuged at 400 g for 5 min, and the supernatant was discarded. The cells could be frozen to -80˚C. After resuspending the cells in 1 ml of PBS, they were subjected to contact sonication: 10 sec on, 5 sec off, 3 cycles at 30% power. The cells were then centrifuged at 12000 g at 4˚C for 5 min, and the nuclei, cell membranes, and unruptured cells were collected. The supernatant was transferred to new centrifuge tubes, and BCA protein was quantified to 2 mg / ml. For each reaction, dispense 0.5 ml of 2 mg / ml solution, and aliquot any excess 0.5 ml. Click Reaction: 11.3 μL of 5 mM biotin / Rh-azide, 11.3 μL of 50 mM TCEP, 34.0 μL of 1.7 mM MTBTA, and 11.3 μL of 50 mM CuSO4•5H2O. Incubate at 25˚C in the dark for 60 min, vortexing after every 30 min. Combine all components to 1 ml, add 4 ml of methanol and 1 ml of chloroform, vortex, add 3 ml of water, and mix again. Centrifuge at 14000 g for 2 min at 4˚C. Aspirate the lower organic phase, then aspirate the upper aqueous phase. Add 400 µl of methanol, transfer to a 1.5 ml centrifuge tube, centrifuge at 14000 g for 2 min at 4˚C, and aspirate the supernatant. Add 650 µl of 2.5% SDS (sodium dodecyl sulfate) PBS, sonicate for 5 seconds on and 5 seconds off, repeating 3 times at 30% power to promote dissolution. The protein can be stored at -80˚C after this step. Heat at 60˚C for 5 min, then sonicate again to resuspend the precipitate. Centrifuge at 6500g for 5 min, and transfer the supernatant to a new 15 ml tube (if more than 20% precipitate remains after centrifugation, repeat the above steps, heating at 90˚C for 2-5 min if necessary). Make up to 3.5 ml with PBS, and dilute the SDS to 0.5%. The protein can be stored at -80˚C after this step. Make up to 8.5 ml with 5 ml PBS, and dilute the SDS to 0.2%. Add pretreated Streptavidin beads. Incubate at room temperature for 30 min, wash 3 times with PBST (phosphate buffer), and elute with 1x SDS-PAGE loading buffer at 95˚C. See results below. Figure 4 Mass spectrometry results showed that there were 5 unique peptides specific to mouse Anxa11 (MmAnxa11) at 55 kDa in the centrosome protein. The specific information of the peptides is as follows:

[0112] peptide1: TPVLFDVYEIK

[0113] peptide2: SELDLLDIR

[0114] peptide3: NTPAFAER

[0115] peptide4: QQILLSFK,

[0116] peptide5: AHLVAVFNEYQR.

[0117] Example 9: Target verification of MYF-16 compound.

[0118] First, the target protein MmAnxa11 (peptide1~peptide5) of the MYF-16 compound was knocked out in mouse embryonic stem cells using the Crisper / Cas9 (gene editing) system. Two specific sgRNAs were designed in MmAnxa11 CDS using the LentiCrisper-v2-puromycin dual plasmid, and the plasmid was integrated into the mouse embryonic stem cell genome using lentivirus. The resulting monoclonal cell lines were identified by genome extraction and Sanger sequencing. The positive knockout cell lines obtained by sequencing were cryopreserved.

[0119] The gene sequence of the specific sgRNA is as follows:

[0120] sgAnxa11T1: AGGACCTCGGCATCTCGCAA;

[0121] sgAnxa11T2:CTATCCTTCAAGACGGCCTA.

[0122] The 10 mM stock solution of MYF-16 compound was diluted 1:1000 (final concentration 10 µM) and added to fresh Serum / LIF medium. After culturing homozygous MmAnxa11-deficient mouse embryonic stem cells for 24 hours, quantitative real-time PCR and Western blot analysis were performed. Results are shown below. Figure 5 The efficacy of the drug was significantly weakened after the absence of MmAnxa11.

[0123] Example 10: Detection of cytotoxicity of MYF-16 compound against mouse embryonic stem cells.

[0124] The MYF-16 compound was diluted 1:1000 (final concentration 10 µM) with stock solutions of 0 mM, 5 mM, 10 mM, 20 mM, 40 mM, and 60 mM and cultured in fresh Serum / LIF medium for 24 hours before CCK8 values ​​were measured.

[0125] Add 10 μL of CCK-8 solution to each well. Use wells containing the corresponding amount of cell culture medium and CCK-8 solution but without cells as blank controls. Incubate for 1 hour in a cell culture incubator, and measure absorbance at 450 nm using a microplate reader. Results are shown below. Figure 6 The results showed that 10 mM MYF-16 was non-toxic to cells and had therapeutic effects.

[0126] Example 11: Detection of activation marker genes of human pluripotent embryonic stem cells by MYF-16 compound using real-time quantitative PCR.

[0127] The 10 mM and 20 mM stock solutions of MYF-16 compound were diluted 1:1000 (final concentrations of 10 and 20 µM) and added to fresh PGEX medium / e4CL to culture human embryonic stem cells for 24 hours before quantitative real-time PCR detection.

[0128] Cells to be tested were aspirated from the culture medium and subjected to the above-described RNA extraction, reverse transcription reaction, and quantitative real-time PCR detection steps. Each experiment was performed in two biological replicates, using DMSO as the vehicle and the β-Actin gene (Actb) as an internal control. The relative quantification method was used to compare the transcriptional expression differences of human embryonic stem cell pluripotency marker genes. ΔΔCt = [mean Ct value of human pluripotency genes in the MYF-16 group - mean Ct value of Actb in the MYF-16 group] - [mean Ct value of human pluripotency genes in the DMSO group - mean Ct value of Actb in the DMSO group]. Then, the results were repeated using a 2:1 ratio. ‐∆∆Ct The fold relationship between the human totipotency marker genes in the MYF-16 compound and the DMSO control group was calculated, and the results are shown in [the table below]. Figure 7 The results showed that MYF-16 can activate the expression of human totipotency marker genes.

[0129] Example 12, Detection of heterogeneity of mouse pluripotent embryonic stem cells by compound MYF-16

[0130] The 10 mM stock solution of MYF-16 compound was diluted 1:1000 (final concentration 10 µM) and added to fresh Serum / LIF medium. Mouse embryonic stem cells were cultured for 24 hours and then digested with trypsin. Cell concentration and cell viability were detected using trypan blue and a hemocytometer. The samples that met the requirements were used to construct libraries using the GEXSCOPE® Single Cell Transcription Library Kit. Library construction was completed according to the standard procedure in the instruction manual.

[0131] The raw sequencing data were aligned to the mm10 genome using Celescope software. The alignment counts were analyzed using Seurat software, and dimensionality reduction analysis was performed using Umap. The analysis results are shown below. Figure 8 The results showed that MYF-16 could induce the generation of mouse pluripotent embryonic stem cells in vitro.

Claims

1. A compound capable of inducing pluripotent embryonic stem cells, characterized in that, The general structural formula of the compound is: Equation (I); Wherein, the Ar group is a variable aromatic group, selected from one of phenyl, alkyl, substituted alkyl, alkoxy or halogen-substituted phenyl; The X group is selected from one of oxygen atom, methyl, sulfur atom or imino; The I portion is selected from 2-thiazolyl, 3-pyridinyl, 1-imidazolyl, and 2-pyrimidinyl; The R group is selected from hydrogen atom, alkoxy, alkyl, substituted alkyl, and halogen.

2. The compound according to claim 1 capable of inducing pluripotent embryonic stem cells, characterized in that, The X group is preferably an oxygen atom or a methyl group.

3. The compound according to claim 1 that can induce pluripotent embryonic stem cells, characterized in that, The I portion is preferably 2-thiazolyl or 3-pyridyl.

4. The compound according to claim 1 capable of inducing pluripotent embryonic stem cells, characterized in that, The R group is preferably a hydrogen atom or an alkoxy group.

5. The compound according to claim 1 capable of inducing pluripotent embryonic stem cells, characterized in that, The compound is a small molecule compound that can simultaneously activate the generation of human and mouse pluripotent embryonic stem cells in vitro.

6. The use of the compound of claim 1 in inducing pluripotent embryonic stem cells.

7. The use of the compound of claim 1 in inducing human pluripotent embryonic stem cells.

8. The use of the compound of claim 1 in inducing mouse pluripotent embryonic stem cells.

9. The use of the compound of claim 1 in simultaneously inducing human and mouse pluripotent embryonic stem cells.

10. A method for preparing a compound capable of inducing pluripotent embryonic stem cells according to any one of claims 1-9, characterized in that, The specific steps include the following: (1) Preparation of intermediate Int-1: (1.1) Take raw material A containing the group in part I of formula (I) and potassium carbonate into a reaction vessel, add acetonitrile solvent, stir magnetically at room temperature for 1~48h at a stirring speed of 200~2000rpm, then add N-Boc-bromoethylamine, and incubate overnight in an oil bath at 60℃. (1.2) After raw material A is basically consumed, the reaction solution is poured into saturated brine and extracted. The crude product is then separated and purified by silica gel column chromatography to obtain intermediate Int-1. (2) Preparation of Boc-free product Int-2: Dissolve intermediate Int-1 in DCM solvent, stir magnetically at room temperature for 1~48h at a stirring speed of 200~2000rpm, then add trifluoroacetic acid (TFA), and continue stirring at room temperature for 2 hours until intermediate Int-1 is completely consumed to generate Boc-free product Int-2. Concentrate the reaction solution under reduced pressure until no liquid is distilled off. Crude product Int-2 can be directly used in the next step of the reaction. (3) Preparation of product MYF: (3.1) Place the crude Int-2 product obtained in step (2), the raw material B containing the group in part II of formula (I), and N,N-diisopropylethylamine into a reaction vessel, add DMF solvent, stir magnetically at room temperature, add condensing agent HATU, and then stir at room temperature for 6 hours. (3.2) After raw material B is completely consumed, the reaction solution is poured into saturated saline solution and extracted with ethyl acetate. The crude product is purified by silica gel column chromatography to obtain product MYF.

11. The preparation method according to claim 10, characterized in that, The synthetic route for the product MYF is as follows: ； ； 。

Images