Bacillus subtilis DW251 and application thereof

By optimizing the culture conditions of Bacillus subtilis DW251 and using rapeseed straw to prepare solid inoculants, the problems of insufficient oxygen supply and low efficiency in sludge fermentation were solved, achieving efficient and safe sludge resource utilization.

CN121136856APending Publication Date: 2025-12-16GUIZHOU UNIV
View PDF 10 Cites 0 Cited by

Patent Information

Application Number
CN202511283336.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-09
Publication Date
2025-12-16

AI Technical Summary

Technical Problem

Traditional sludge fermentation technology faces problems such as insufficient oxygen supply, low fermentation efficiency, long cycle, easy generation of odor, and poor stability of fermentation products, which limit its large-scale promotion and application.

Method used

Bacillus subtilis DW251 and its optimized culture method and solid inoculant were used. By optimizing the culture conditions (temperature, inoculum amount, nitrogen source, etc.), the degradation ability and fermentation efficiency of the strain were improved. Rapeseed straw was used as a carrier to prepare solid inoculant, which was applied to the aerobic fermentation of sludge.

Benefits of technology

It significantly improved sludge fermentation efficiency, shortened the composting cycle, reduced odor generation, enhanced the agricultural safety and total nitrogen retention rate of fermentation products, extended the high-temperature period, and promoted pathogen inactivation and organic matter degradation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121136856A_ABST
    Figure CN121136856A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of sludge fermentation, in particular to bacillus subtilis DW251 and application of the bacillus subtilis DW251, the bacillus subtilis DW251 is preserved in China General Microbiological Culture Collection Center on January 20, 2025, and the preservation number is CGMCC NO.33467. The bacillus subtilis DW251 is named as bacillus subtilis DW251. The bacillus subtilis DW251 is named as bacillus subtilis DW251. The bacillus subtilis DW251 provided by the invention has high temperature resistance, nitrification function and starch, fat and protein degradation performance, and can accelerate the maturing process of fermentation and improve the fermentation efficiency. Meanwhile, the invention provides a solid microbial inoculum for sludge fermentation, which is prepared from bacillus subtilis DW251 and rape straw, and the microbial inoculum can prolong the high-temperature period of a pile body, provide key environmental guarantee for enzymatic degradation and nitration reaction, and provide prerequisite conditions for reducing nitrogen loss and shortening the decomposition period of a sludge aerobic fermentation system. The bacillus subtilis DW251 and the solid microbial inoculum thereof provided by the invention have great market development and utilization values in the field of sludge fermentation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of sludge fermentation technology, specifically to a strain of Bacillus subtilis DW251 and its applications. Background Technology

[0002] With the acceleration of global urbanization and the widespread adoption of wastewater treatment facilities, the production of sewage sludge, an unavoidable byproduct of wastewater treatment, is showing a year-on-year increasing trend. Sludge contains large amounts of harmful substances such as organic matter, pathogens, heavy metals, and persistent organic pollutants. Improper treatment can not only cause serious pollution to soil, water bodies, and the atmosphere, but may also threaten human health and ecological security through bioaccumulation in the food chain. Therefore, how to efficiently and environmentally treat sewage sludge and realize its resource utilization has become a crucial issue urgently needing to be addressed in the field of environmental science and engineering.

[0003] Currently, the main methods for sludge treatment include landfill, incineration, land application, and fermentation. While landfilling is simple to operate and relatively inexpensive, it consumes a large amount of land resources and poses problems such as leachate pollution and greenhouse gas emissions (e.g., methane). Furthermore, landfill capacity is increasingly saturated. Incineration, although it can significantly reduce sludge volume and achieve energy recovery, has high energy consumption, requires substantial equipment investment, and is prone to generating secondary pollution (e.g., dioxins, heavy metal fly ash), posing potential threats to the environment and human health. In contrast, aerobic fermentation of sludge, as a resource utilization technology, is gradually becoming a research hotspot due to its advantages such as low cost, simple operation, and the ability of the products to be used as soil conditioners or organic fertilizers.

[0004] Aerobic fermentation is the process by which microorganisms transform organic matter in sludge into stable humus through their metabolic activities. This process not only effectively degrades harmful substances in sludge (such as pathogens and organic pollutants) but also converts them into organic fertilizer with high agricultural value, thus realizing the resource utilization of sludge. However, traditional sludge fermentation technology still faces many challenges in practical applications: First, the high moisture content and low C / N ratio in sludge often lead to insufficient oxygen supply and low fermentation efficiency during fermentation; second, the fermentation cycle is long (usually requiring 30-60 days) and easily produces large amounts of odorous gases (such as NH3-N and H2S), affecting the surrounding environment and the health of operators; third, the stability and fertilizer efficiency of the fermentation products vary due to improper control of process parameters, limiting its large-scale application.

[0005] To address the aforementioned issues, this invention provides a strain of Bacillus subtilis DW251 and its application in sludge fermentation. The aim is to provide a theoretical basis and technical support for the resource utilization of sludge, promote the green and efficient development of sludge treatment technology, and offer new ideas for the reduction, resource recovery, and harmless treatment of solid waste. Summary of the Invention

[0006] The purpose of this invention is to provide a strain of Bacillus subtilis DW251 and its application in sludge fermentation.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The Bacillus subtilis DW251 described in this invention was deposited on January 20, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC NO.33467.

[0008] Preferably, the nucleotide sequence of Bacillus subtilis DW251 of the present invention is shown in SEQ ID NO.1.

[0009] The method for culturing Bacillus subtilis DW251 according to the present invention involves first culturing the strain in LB liquid medium to the logarithmic growth phase to obtain a seed culture, and then inoculating the seed culture into a bacterial culture medium for further cultivation under the following conditions: The bacterial culture medium is any one of LB liquid medium, NH3 selective medium, LBSP medium, casein medium or rhodamine B medium; The incubation temperature is 35℃~60℃; The vaccination rate is 3% to 13%; The initial pH of the culture medium is 3-9; The nitrogen source for the culture medium is any one or more of ammonium sulfate, ammonium chloride, or ammonium dihydrogen phosphate.

[0010] Preferably, in the method for culturing Bacillus subtilis DW251 of the present invention, the OD of the logarithmic phase bacterial culture is... 600 The value is 0.4 to 0.6.

[0011] Preferably, in the method for culturing Bacillus subtilis DW251 of the present invention, the culture conditions are specifically as follows: The incubation temperature is 40℃~55℃; The vaccination rate is 7% to 11%; The initial pH of the culture medium is 5-9; The nitrogen source for the culture medium is any one or both of ammonium chloride or ammonium dihydrogen phosphate.

[0012] More preferably, in the method for culturing Bacillus subtilis DW251 of the present invention, the culture conditions are specifically as follows: The incubation temperature is 50℃; The vaccination rate was 9%; The initial pH of the culture medium was 5; The nitrogen source for the culture medium is ammonium chloride.

[0013] The solid microbial agent for sludge fermentation described in this invention consists of sterilized rapeseed straw and fermentation broth of strain DW251, wherein: the fermentation broth of strain DW251 is prepared by inoculating strain DW251 into LB liquid fermentation medium and culturing until the bacterial culture reaches OD. 600 The value is 1; the mass ratio of the sterilized rapeseed straw to the fermentation broth of strain DW251 is 1:1.

[0014] The method for preparing the solid microbial agent for sludge fermentation described in this invention is to mix sterilized rapeseed straw with the fermentation broth of strain DW251 in a certain proportion and then drain the water to obtain the agent.

[0015] Preferably, in the method for preparing the solid microbial agent for sludge fermentation according to the present invention, the temperature condition for controlling the moisture is 55°C.

[0016] The application of Bacillus subtilis DW251 or the solid microbial agent for sludge fermentation described in this invention in sludge fermentation.

[0017] The beneficial effects of this invention are: 1. This invention provides a heat-resistant strain DW251 with nitrification function and the ability to degrade starch, fats and proteins. Its lipase production capacity is 30.73 U / mL, amylase production capacity is 19.83 U / mL, and protease production capacity is 40 U / mL. It helps to more effectively decompose fats, starches and proteins in fermentation, accelerate the fermentation maturation process, and improve fermentation efficiency. It has great market development and application value in the field of sludge fermentation.

[0018] 2. By optimizing the culture conditions of strain DW251, this invention determined the optimal culture conditions as follows: culture temperature of 50℃; inoculum size of 9%; initial pH of the culture medium of 5; and ammonium chloride as the nitrogen source of the culture medium.

[0019] 3. This invention provides a solid microbial agent for sludge fermentation. Aerobic fermentation experiments on sludge have confirmed that strain DW251 can effectively balance the acid-base environment. The fermentation products after 28 days of composting using this invention's agent exhibit good agricultural safety. The high-temperature plateau period (>50℃) maintained for up to 10 days during composting using this agent significantly promotes pathogen inactivation and organic matter degradation, demonstrating strain DW251's good high-temperature adaptability and metabolic activity. Composting using this agent creates an efficient nitrogen retention pathway, significantly increasing the total nitrogen retention rate in the compost pile. The germination index is significantly improved. This agent prolongs the high-temperature period of the compost pile, providing crucial environmental protection for enzymatic degradation and nitrification, ultimately achieving a synergistic effect of reducing nitrogen loss by 35% and shortening the composting cycle by more than 30%.

[0020] Information on microbial preservation: Strain name: Bacillus subtilis DW251; Preservation institution: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Culture Collections; Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; Deposit date: January 20, 2025; Accession number: CGMCCNO.33467. Attached Figure Description

[0021] Figure 1 The colony morphology of strain DW251; Figure 2 Phylogenetic tree of strain DW251; Figure 3 The degradation ability of strain DW251 on different culture media is shown in the figure (A is LBSP medium; B is casein medium; C is Rhodamine B medium). Figure 4 This is a growth curve of strain DW251; Figure 5 The effect of different fermentation temperatures on the growth of the strain; Figure 6 The effect of different inoculum amounts on the growth of the strain; Figure 7 The effect of different initial pH values ​​in culture media on the growth of bacterial strains; Figure 8 The effects of different nitrogen sources on the growth of the strain; Figure 9 Changes in pH and EC in the fermentation pile; Figure 10 This refers to the temperature changes within the fermentation pile. Figure 11 The changes in total nitrogen, ammonia nitrogen, and nitrate nitrogen in the fermentation pile; Figure 12 This represents the change in the germination index of the fermentation pile. Detailed Implementation

[0022] The technical solution of the present invention will be described in detail below with reference to specific embodiments. The following embodiments are for explanation and illustration only, and do not constitute a limitation on the technical solution of the present invention.

[0023] Example 1 Bacillus subtilis DW251 was deposited on January 20, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.33467.

[0024] Example 2 A method for culturing Bacillus subtilis DW251 involves first culturing the strain in LB liquid medium to the logarithmic growth phase to obtain a seed culture, and then inoculating the seed culture into a bacterial culture medium for further cultivation under the following conditions: The bacterial culture medium is LB liquid medium; The incubation temperature is 50℃; The vaccination rate was 9%; The initial pH of the culture medium was 5; The nitrogen source for the culture medium is ammonium chloride.

[0025] Example 3 A method for culturing Bacillus subtilis DW251 involves first culturing the strain in LB liquid medium to the logarithmic growth phase to obtain a seed culture, and then inoculating the seed culture into a bacterial culture medium for further cultivation under the following conditions: The bacterial culture medium is an NH3 selective medium; The incubation temperature is 55℃; The vaccination rate was 11%. The initial pH of the culture medium was 9; The nitrogen source for the culture medium is ammonium dihydrogen phosphate.

[0026] Example 4 A method for culturing Bacillus subtilis DW251 involves first culturing the strain in LB liquid medium to the logarithmic growth phase to obtain a seed culture, and then inoculating the seed culture into a bacterial culture medium for further cultivation under the following conditions: The bacterial culture medium is casein medium; The incubation temperature is 40℃; The vaccination rate was 7%; The initial pH of the culture medium was 5; The nitrogen source for the culture medium is ammonium chloride.

[0027] Example 5 A method for culturing Bacillus subtilis DW251 involves first culturing the strain in LB liquid medium to the logarithmic growth phase to obtain a seed culture, and then inoculating the seed culture into a bacterial culture medium for further cultivation under the following conditions: The bacterial culture medium was Rhodamine B medium; The incubation temperature is 35℃; The vaccination rate was 3%; The initial pH of the culture medium was 3; The nitrogen source for the culture medium is ammonium sulfate.

[0028] Example 6 The solid microbial agent used for sludge fermentation is composed of sterilized rapeseed straw and fermentation broth of strain DW251 in a mass ratio of 1:1.

[0029] The fermentation broth for strain DW251 was prepared by inoculating strain DW251 into LB liquid fermentation medium and culturing until the bacterial culture reached OD500. 600 The value is 1.

[0030] Example 7 The method for preparing the solid microbial agent for sludge fermentation provided in Example 6 is as follows: sterilized rapeseed straw and fermentation broth of strain DW251 are mixed in a certain proportion and then the moisture is drained at 55°C to obtain the product.

[0031] Example 8 The Bacillus subtilis DW251 provided in Example 1 or the solid microbial agent for sludge fermentation provided in Example 6 was applied to sludge fermentation.

[0032] To further verify the reliability of the present invention and select the optimal solution, the inventors conducted a series of experiments, as follows: 1. Isolation, screening and identification of functional bacteria for sludge fermentation 1.1 Isolation and purification of bacterial strains (1) Collect sludge compost samples from Daozhen Gelao and Miao Autonomous County, Guizhou Province. Take an appropriate amount of sample using the five-point sampling method. Weigh 10.0 g and add it to a 250 mL conical flask containing LB liquid culture medium. Shake and culture at 55℃ and 150 r / min for 48 h.

[0033] (2) The strains were isolated using the dilution-spreading method. After acclimatization, 1.0 mL of each culture solution was placed in a 15 mL centrifuge tube and serially diluted with sterile water to a 10⁻⁶ concentration. -5 -10 -8 The bacterial suspension was prepared. 200 μL of bacterial suspension from each dilution gradient was spread onto LB solid medium, and the medium was incubated upside down in a 55℃ incubator for 2 days.

[0034] (3) Observe the colonies that grow on the culture medium. Based on the characteristics of colony size, color and surface pattern, select the larger strains and culture them on LB solid medium multiple times by streak plate culture. Repeat the purification for 4 to 6 generations until single colonies appear.

[0035] 1.2 Screening of strains (1) Preliminary screening of ammonia-assimilating strains: Take a sterile 50 mL centrifuge tube, add 10 mL of NH3 selective medium, and add 10 µL of ammonia water to the centrifuge tube in a clean bench. After activating the test strain, inoculate the bacterial solution into the centrifuge tube at a ratio of 2%, seal it, and place it on a shaker at 37℃ and 160 r / min for 5 days. Observe the change in turbidity of the bacterial solution. If the bacterial solution is turbid, it indicates that the strain has the ability to assimilate NH3. If the bacterial solution remains transparent, it indicates that the strain cannot directly utilize NH3.

[0036] NH3 selective medium: 50.0 g sucrose, 10.0 mL ammonia, 2.0 g dipotassium hydrogen phosphate, 0.5 g MgSO4·7H2O, 0.1 g FeSO4, 5.0 mL 1% ZnSO4, 0.5 g sodium chloride, 1 L distilled water, sterilized at 121℃ for 30 min.

[0037] (2) Screening of nitrifying bacteria: The purified strains were inoculated onto nitrifying bacteria isolation medium, and the growth of the strains on the medium was observed. The strains that grew well on the medium were selected and stored for later use.

[0038] Nitrifying bacteria isolation media: ① Autotrophic nitrification medium: NaNO2 1.0 g, NaCl 0.5 g, K2HPO4 0.15 g, MgSO4 0.05 g, FeSO4 0.15 mg, CaCO3 3.0 mg, distilled water 1 L, pH 7.8; ② Heterotrophic nitrification medium: NaNO2 0.35 g, Na2HPO4·7H2O 7.9 g, K2HPO4 1.5 g, MgSO4·7H2O 0.1 g, glucose 10 g, trace elements 2 mL (trace element preparation: EDTA 50 g, ZnSO4 2.2 g, CaCl2 5.5 g, CuSO4·5H2O 1.57 g, MnCl2·4H2O 5.06 g, FeSO4·7H2O 5.0 g, CoCl2·6H2O 1.61 g, pH 7.8). 7.0~7.5, bring to a final volume of 1 L), add distilled water to a final volume of 1 L, autoclave and store for later use.

[0039] (3) Re-screening of strains: The isolated and purified nitrogen-fixing bacteria were inoculated into LBSP medium (reflecting starch degradation ability), casein medium (reflecting protein degradation ability), and Rhodamine B medium (reflecting fat degradation ability) using an inoculation needle. Three replicates were prepared for each culture. After 24 h of incubation, the presence of transparent hydrolysis zones around the colonies was observed. In LBSP medium, after starch decomposition, a transparent zone centered on starch-decomposing bacteria appeared in the medium. In casein medium, the hydrolysis of casein to produce tyrosine formed a transparent zone in the casein medium. In Rhodamine B medium, fatty acids produced by the degradation of lipids by lipases could specifically react with Rhodamine B, and the area around the enzyme-producing colonies would turn rose-red, appearing orange-yellow under ultraviolet light at a wavelength of 365 nm.

[0040] The degradation ability of a strain is determined based on the diameter of the transparent hydrolysis zone (D) and the diameter of the colony (d). The larger the ratio of D / d, the stronger the degradation performance of the strain.

[0041] (4) Determination of enzyme production capacity of strains The strains were further screened by measuring their lipase, amylase, and protease activities. Organic matter accounts for approximately 50%–70% of the total solids in sludge, mainly including protein, fat, and starch. Protein accounts for 20%–30% of the sludge's organic matter. Through the catalytic action of proteases, proteins in the sludge can be broken down into small peptides and amino acids, thereby improving the sludge's degradability and dewatering performance. Fat content is relatively low, but it is also an important component of sludge, typically accounting for 5%–10% of the organic matter. Lipases catalyze the hydrolysis of fatty substances in the sludge, breaking them down into smaller molecules such as glycerol and fatty acids, thus accelerating the degradation process of organic matter in the sludge. This degradation not only improves the fermentation efficiency of the sludge but also reduces odor generation during fermentation. Starch is a carbohydrate, accounting for approximately 30%–40% of the sludge's organic matter. Through the action of amylases, starch in the sludge is broken down into soluble sugars, which can be further utilized by microorganisms, promoting their growth and metabolism. This not only increases the degradation rate of sludge, but also reduces the residue of undegraded organic matter during fermentation.

[0042] ① Method for Assaying Protease Activity The determination of protease activity was performed according to the ultraviolet spectrophotometric method in GB / T23527-2009. The protease-producing bacteria were activated on a culture medium, and an appropriate amount of crude enzyme solution was added to the reaction system containing casein. The reaction was carried out at 65℃ and pH 7. Trichloroacetic acid was added to terminate the reaction and precipitate unhydrolyzed casein. The reaction mixture was filtered, and the filtrate was collected. The absorbance of the filtrate was measured at 275 nm using an ultraviolet spectrophotometer. Based on the direct proportionality between absorbance and tyrosine concentration, and in conjunction with a standard curve, the enzyme activity was calculated.

[0043] Blank control group: Prepare a 10 mL centrifuge tube and label it blank. Add 2.00 mL of crude enzyme solution. Preheat the centrifuge tube in a 65°C water bath for 2 min. Add 2.00 mL of trichloroacetic acid and react at 65°C for 10 min, shaking at 150 r / min during reaction. Add 1.00 mL of casein solution. Remove the centrifuge tube, let it stand for 10 min, and then filter. Pipette 1.00 mL of the filtrate and measure the absorbance of the filtrate at a wavelength of 275 nm.

[0044] Sample group: Prepare a 10 mL centrifuge tube and label it as the sample. Add 2.00 mL of crude enzyme solution and preheat the centrifuge tube in a 65°C water bath for 2 min. Add 1.00 mL of casein solution and react at 65°C for 10 min, shaking at 150 rpm during reaction. Add 2.00 mL of trichloroacetic acid. Remove the centrifuge tube and let it stand for 10 min, then filter. Pipette 1.00 mL of the filtrate and measure the absorbance of the filtrate at a wavelength of 275 nm.

[0045] ② Lipase activity assay method Add 2.0 mmol / L p-NP, isopropanol, and substrate buffer to centrifuge tubes sequentially. Heat in a water bath for 15 min, then terminate the reaction with an appropriate amount of 95% C2H5OH to construct a standard curve. Culture the bacterial suspension to the logarithmic growth phase in lipase fermentation medium. Take an appropriate amount of bacterial suspension and centrifuge at 10000 r / min for 10 min; the resulting supernatant is the crude enzyme solution. After heating the crude enzyme solution in a water bath, add 0.5 mL of Tris-HCl buffer to centrifuge tubes sequentially; for the control group, add 0.5 mL of Tris-HCl buffer. After reacting for 15 min, quickly terminate the reaction with 95% C2H5OH solution, then centrifuge at 10000 r / min for 10 min. After centrifugation, quickly transfer the supernatant to a 96-well plate using a sterile pipette, and measure the absorbance at 410 nm to calculate enzyme activity.

[0046] ③Methods for determining amylase activity Add 5 mL of substrate solution to a 10 mL centrifuge tube and pre-equilibrate at 65°C for 3 min in a constant temperature water bath. Simultaneously, transfer the crude enzyme extract to the same temperature zone for preheating for 60 s. To start the reaction, quickly transfer 1.5 mL of the preheated crude enzyme solution to a centrifuge tube containing the substrate and set a constant temperature shaker to continuously shake at 150 r / min for 10 min. Immediately after the reaction is terminated, inject 0.5 mL of 0.1 mol / L hydrochloric acid solution to terminate the enzymatic reaction through strong acid denaturation. After the reaction system has stood for 5 min, transfer 0.5 mL of the treated solution and 5 mL of iodine chromogenic reagent for a colorimetric reaction. Immediately measure the absorbance at 620 nm using a spectrophotometer. When setting up a control group, use an equal volume of buffer solution instead of the reaction solution as a background reference, and calculate the enzyme activity based on the change in absorbance.

[0047] (5) Drawing growth curves of strains The growth curve of the sludge fermentation functional bacteria was determined by turbidimetric method. The growth curve was plotted by monitoring the change of absorbance value of the bacterial solution at a specific wavelength over time.

[0048] 1.3 Identification of strains (1) Morphological identification The selected bacteria were inoculated onto LB solid medium (containing 1% peptone, 0.5% yeast extract, and 1% NaCl) using the streak plate method and incubated in a 37°C incubator for 24 h. The morphological characteristics of single colonies were observed, including colony shape, edge features, surface texture, and pigment secretion. Gram staining was performed, and the staining characteristics and cell morphology of the bacteria were observed using an optical microscope.

[0049] (2) Molecular biological identification 16S rRNA sequence analysis: DW251 was inoculated into LB liquid medium for activation. After activation, total DNA of strain DW251 was extracted using EZNA® Bacterial DNA Spin Protocol (catalog number D3350).

[0050] The PCR amplification primers used are universal bacterial primers, and their sequence information is as follows: 27F: AGAGTTTGATCCTGGCTCAG; 1492R: GGTTACCTTGTTACGACTT.

[0051] The amplification reaction system (20 µL) consisted of: 25 µL KOD One™ PCR Master Mix; 20 µL sterile water; 2 µL template and 1.5 µL primers.

[0052] The PCR program was as follows: 95℃ pre-denaturation for 5 min, 25 cycles (95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 90 s), and a final extension at 72℃ for 10 min.

[0053] PCR products were verified using 1% agarose gel electrophoresis. The PCR products were sequenced using the Sanger sequencing method on an ABI 3730XL gene sequencer. Low-quality bases were removed from both ends of the raw sequences obtained from Sanger sequencing to obtain clean sequences. These clean sequences were then assembled to obtain the assembled sequence. The sequence was compared with the NT database BLAST to obtain information on the top 10 species with the highest species similarity. The species with the highest similarity was selected as the result for identification of the strain in this study.

[0054] 1.4 Results and Analysis 1.4.1 Morphological identification of the strain Based on the above experiments, this study screened out a heat-resistant strain, DW251, which possesses nitrification capabilities and can degrade starch, fats, and proteins (the colony morphology of strain DW251 is shown in the figure). Figure 1 As shown in the figure, the colonies are grayish-white and round, with short rod-shaped cells, a raised but rough surface, and intact edges. After Gram staining, they were identified as Gram-positive bacteria (G+).

[0055] 1.4.2 Molecular biological identification of the strain Phylogenetic analysis based on the 16S rDNA sequence revealed the taxonomic position of strain DW251 (the phylogenetic tree of strain DW251 is shown below). Figure 2 The strain DW251 is classified as *Bacillus subtilis*, belonging to the phylum Firmicutes, class Bacillus, order Bacillusales, family Bacillusaceae, and genus *Bacillus*. The nucleotide sequence of strain DW251 is shown in SEQ ID NO.1.

[0056] SEQ ID NO.1 (1486 bp): 1.4.3 Screening of strains The enzyme production activity of strain DW251 was screened using three specific culture media. All experiments were performed in triplicate, and the diameter of the hydrolysis zone was measured using vernier calipers (accuracy 0.02 mm). The degradation capacity of strain DW251 on different culture media is shown in Table 1. Figure 3 As shown in Table 2, the enzyme production capacity of strain DW251 is shown in Table 2.

[0057] ; ; As shown in Table 1-2, strain DW251 has high lipase, protease and amylase production activities, which can effectively decompose starch, fat and protein substances in fermentation, thereby accelerating the fermentation maturation process and improving fermentation efficiency.

[0058] The growth curve of strain DW251 is shown in the figure. Figure 4 As shown. By Figure 4 It can be seen that strain DW251 has a relatively long adaptation period (8 h), and its logarithmic growth rate is (μ). max =0.21 h -1 It reaches a stable period of 12-32 hours and enters the decline period after 32-38 hours.

[0059] 2. Optimization of culture conditions for sludge fermentation strains Single-factor experiments were conducted to investigate the effects of different fermentation temperatures, inoculum sizes, initial pH values ​​of the culture medium, and nitrogen sources on the growth of the strain. Before optimization, the strain was cultured in LB liquid medium until the logarithmic growth phase (OD2). 600 =0.4~0.6), prepared as seed liquid for subsequent experiments.

[0060] 2.1 Optimization of fermentation temperature A single-factor experimental design was used, setting up six temperature gradients (35℃, 40℃, 45℃, 50℃, 55℃, 60℃) to evaluate their effects on the growth of the bacterial strain. The experimental method is as follows: Fermentation system construction: 100 mL of LB liquid medium (initial pH 7.0) was added to a 250 mL Erlenmeyer flask, and the seed culture in the logarithmic growth phase was inoculated at a 10% inoculum. Culture conditions control: After inoculation, the conical flasks were placed under different temperature conditions (temperature ±0.5℃) and shaken for 12 h (150 r / min).

[0061] Detection and Analysis: After the culture was completed, the OD was measured using a spectrophotometer. 600 Values, with 3 biological replicates set for each group.

[0062] Determination of optimal fermentation temperature: The optimal fermentation temperature is determined by comparing the absorbance values ​​of different temperature groups.

[0063] 2.2 Optimization of inoculation volume This study systematically investigated the effect of inoculum size on bacterial growth by setting six inoculum size gradients: 3%, 5%, 7%, 9%, 11%, and 13%. 250 mL Erlenmeyer flasks were used as culture containers, each containing 100 mL of basal fermentation medium at pH 7.0. Logarithmic-phase seed culture was inoculated into each flask according to the pre-set gradient. All treatment groups were cultured at a constant temperature of 55℃ with shaking at 150 rpm for 12 h. After culture, the OD of the culture medium was measured spectrophotometrically. 600 Each treatment was replicated in triplicate. By comparing the trends in bacterial biomass under different inoculum sizes, the optimal inoculum size was determined.

[0064] 2.3 Optimization of initial pH value To determine the optimal initial pH conditions, this study set up seven pH gradients (3, 4, 5, 6, 7, 8, and 9) for single-factor experiments. The specific procedures are as follows: Culture medium preparation: Adjust the basic fermentation culture medium to the target pH value (3~9) and dispense it into 250 mL Erlenmeyer flasks, 100 mL per flask.

[0065] Inoculation and culture: Inoculate the logarithmic seed culture at a 10% inoculation rate and culture in a constant temperature shaker at 30℃ (150r / min) for 12 h.

[0066] Detection and Analysis: OD was measured using a spectrophotometer. 600 Values, with 3 biological replicates set for each group.

[0067] Determination of the optimal initial pH value: By comparing the cell growth (OD) under different pH conditions 600 ), determine the optimal initial pH value.

[0068] 2.4 Optimization of Nitrogen Source This study systematically evaluated the effects of different nitrogen sources on bacterial growth by setting up a comparative experiment with three different nitrogen sources (ammonium sulfate, ammonium chloride, and ammonium dihydrogen phosphate). A basal fermentation medium (pH 7.0) was used as the culture medium, with equal amounts of each nitrogen source added. Seed culture of the bacterial strain in the logarithmic growth phase was inoculated at a 10% inoculum into 100 mL of medium (250 mL Erlenmeyer flask) and cultured at a constant temperature of 30℃ with shaking at 150 r / min for 12 h. After the culture was terminated, the OD values ​​of the bacterial culture were measured using a UV spectrophotometer. 600To ensure data reliability, three replicates were set up for each treatment group. By comparing the growth of microorganisms under different nitrogen source conditions, and using statistical methods such as analysis of variance, the optimal nitrogen source for the growth of the strains was finally determined.

[0069] 2.5 Results and Analysis 2.5.1 Optimization of fermentation temperature The effect of different fermentation temperatures on the growth of strains, such as Figure 5 As shown. By Figure 5 It can be seen that strain DW251 exhibits optimal growth status and bacterial content at a temperature of 50℃, with OD... 600 The value reached 1.48±0.2.

[0070] 2.5.2 Optimization of Inoculation Dosage The effect of different inoculum amounts on the growth of the strain, such as Figure 6 As shown. By Figure 6 It can be seen that strain DW251 exhibits optimal growth at an inoculum size of 9%, with an OD value of [missing information]. 600 The value reached 0.5 ± 0.03.

[0071] 2.5.3 Optimization of initial pH value The effect of initial pH of different culture media on the growth of strains, such as Figure 7 As shown. By Figure 7 It can be seen that strain DW251 grows best under weakly acidic conditions with an initial pH of 5. OD 600 The value reached 1.15 ± 0.15.

[0072] 2.5.4 Optimization of Nitrogen Source The effects of different nitrogen sources on the growth of strains, such as Figure 8 As shown. By Figure 8 It can be seen that strain DW251 can grow under conditions where ammonium sulfate, ammonium chloride, and ammonium dihydrogen phosphate are used as nitrogen sources, with the best growth observed when ammonium chloride is used as the nitrogen source. 600 The value reached 0.45±0.02.

[0073] In summary, the optimal culture conditions for strain DW251 are: culture time of 10-20 h, culture temperature of 50℃, inoculum size of 9%, initial pH of the culture medium of 5, and ammonium chloride as the nitrogen source of the culture medium. Optimizing these culture conditions can significantly improve the cell yield and metabolic activity of strain DW251.

[0074] 3. Preparation of solid microbial agents for sludge fermentation Liquid microbial cultures are favored in the fermentation industry due to their rapid inoculum production, short fermentation cycle, and easily controllable fermentation conditions. Solid microbial inoculants demonstrate significant advantages in practical applications, particularly in stability, ease of transportation, and long-term preservation. To improve the overall performance of the inoculant, this study employed liquid fermentation technology, rigorously selecting suitable carrier materials to convert the liquid inoculant into a solid form. The specific preparation process included aseptic operation and drying to remove excess moisture and ensure the stability and activity of the solid inoculant. Crushed rapeseed straw possesses a porous structure, effectively adsorbing microbial cells and providing slow-release nutrients. Furthermore, rapeseed straw is rich in organic matter such as cellulose and lignin, and after composting, its carbon-to-nitrogen ratio is suitable, making it a suitable substrate for microbial growth.

[0075] 3.1 Preparation of microbial agents Under optimal growth conditions, strain DW251 was inoculated into LB liquid fermentation medium and cultured until the bacterial culture reached OD500. 600 The value is 1. Sterilized rapeseed straw and single-strain fermentation broth are mixed evenly in a 1:1 ratio and the moisture is drained to obtain a single-strain solid inoculant.

[0076] 3.2 Aerobic fermentation experiment of sludge 3.2.1 Fermentation Experiment Design To investigate the effect of a complex of functional bacteria used in sludge fermentation on the aerobic fermentation of cow manure, this experiment set up an experimental group with added bacteria and a control group without added bacteria. The fermentation materials were mixed thoroughly and then subjected to aerobic reaction in an 80 L polyethylene tank.

[0077] 3.2.2 Determination of physicochemical properties during fermentation (1) Changes in pH and EC The physicochemical properties of the samples were determined using the water extraction method. 10.00±0.01 g of sample and 100 mL of ultrapure water were accurately weighed into a clean 250 mL Erlenmeyer flask and extracted with shaking at 150 r / min for 1 h under constant temperature. After standing for 0.5 h to allow complete precipitation of the solid, the pH and EC values ​​of the supernatant were measured. Three parallel samples were used throughout the experiment, and all measurements were performed at a constant temperature of 25±1℃ to ensure the comparability and accuracy of the experimental data. The pH value was measured using the glass electrode method, and the EC value was measured using a conductivity meter. All instruments were calibrated with standard buffer solutions before use.

[0078] (2) Temperature change Record the ambient temperature at 12:00 noon every day and use a thermometer inserted into the stockpile to measure the temperature of the upper, middle and lower layers of material.

[0079] (3) Changes in total nitrogen, ammonia nitrogen and nitrate nitrogen The Kjeldahl method was used to determine the total nitrogen content of the samples. 0.5000 ± 0.0001 g of air-dried sample (passed through a 1 mm sieve) was accurately weighed, digested at high temperature using a concentrated sulfuric acid-hydrogen peroxide system, and the digestion solution was brought to a suitable volume. The total nitrogen content in the digestion solution was determined using a Kjeldahl nitrogen analyzer, which was calibrated with ammonium sulfate standard solution before use. An ultrapure water blank control was also provided to eliminate the influence of reagent background. Three parallel determinations were performed for each sample group, with relative deviations controlled within 5%. All glassware was treated with 10% hydrochloric acid during the experiment to avoid nitrogen contamination. The final nitrogen content (mg / g) = (sample measured value - blank value) × volume / sample mass, and the result was retained to three significant figures.

[0080] The compost sample needs to be extracted first to convert the solid nitrogen into the liquid phase: Weigh 10 g of fresh compost (or air-dry and pass through a 10-mesh sieve), add 100 mL of extraction agent (after standing, take the supernatant and filter it, store the filtrate at 4℃ and analyze it within 24 h), shake for 1 h (150 r / min), after standing, take the supernatant and filter it, store the filtrate at 4℃ and analyze it within 24 h.

[0081] Ammonia nitrogen: Nessler's reagent spectrophotometric method (National Standard HJ 535-2009).

[0082] Nitrate nitrogen: Dual-wavelength ultraviolet spectrophotometry (National Standard GB / T 32737-2016).

[0083] (6) Changes in the germination index (GI) The biological effects of the samples were assessed using a water extraction-seed germination method. 10.00 ± 0.01 g of sample was accurately weighed and placed in a 250 mL Erlenmeyer flask. 100 mL of ultrapure water was added at a ratio of 1:10 (w / v), and the sample was extracted at 25℃ with shaking at 150 r / min for 60 min. After standing for 30 min, the extract was filtered through qualitative filter paper to obtain the test solution. Ten radish seeds were evenly placed in 10 mL of the filtrate and cultured in a 25℃ incubator in the dark for 2 days. After culture, the germination rate was calculated as (number of germinated seeds / number of tested seeds × 100%), and the length of the taproot was measured using calipers (accuracy 0.01 mm). Each treatment was performed in triplicate, and all operations were conducted under aseptic conditions to ensure the reliability of the experimental results.

[0084] 3.3 Results and Analysis 3.3.1 Changes in pH and EC Changes in pH and EC in the fermentation pile are as follows Figure 9As shown in the results, the pH value during fermentation initially rose rapidly and then gradually decreased. Initially, it rose to around 8.5 due to ammoniation, and then gradually decreased to 7.8-8.0 with nitrification and organic acid generation, indicating that strain DW251 can effectively balance the acid-base environment. The electrical conductivity (EC) increased continuously from an initial 2.5 mS / cm to 5.1 mS / cm, reflecting salt accumulation, but the final value was below the phytotoxicity threshold (7.0 mS / cm), confirming the agricultural safety of the compost product.

[0085] 3.3.2 Temperature Change Temperature changes in the fermentation pile, such as Figure 10 As shown. By Figure 10 It was found that after inoculation with DW251 inoculant, the temperature of the pile rapidly rose to above 55°C in the initial stage, and the high-temperature period (>50°C) lasted for 10 days. The temperature curve showed a typical "steep rise-plateau-slow fall" characteristic. The high-temperature plateau period could significantly promote the inactivation of pathogens and the degradation of organic matter, confirming the high-temperature adaptability and metabolic activity of the strain.

[0086] 3.3.3 Changes in total nitrogen, ammonia nitrogen, and nitrate nitrogen Changes in total nitrogen, ammonia nitrogen, and nitrate nitrogen in the fermentation pile are as follows: Figure 11 As shown in the results, during the 28-day composting cycle, the total nitrogen retention rate of the DW251 strain group was significantly higher than that of the control group. The key mechanism was dynamic nitrogen transformation—ammonia nitrogen in the DW251 group peaked at 25.5 mg / kg on day 10 and then rapidly decreased to 8.7 mg / kg (28 days) due to nitrification by the strain, while nitrate nitrogen continuously accumulated from 5.1 mg / kg to 12.8 mg / kg, forming an efficient nitrogen retention pathway (ammonia nitrogen in the control group only decreased to 14.9 mg / kg, and nitrate nitrogen did not change significantly).

[0087] 3.3.4 Changes in germination index Changes in the germination index of the fermentation pile as follows Figure 12 As shown, the germination index (GI) of the DW251 group jumped from 18.9% on day 10 to 91.5% on day 28 (>80% safety threshold), while the control group remained below 20%. Simultaneously, the microbial agent in this study prolonged the high-temperature period of the compost pile, providing crucial environmental protection for enzymatic degradation and nitrification reactions, ultimately achieving a synergistic effect of reducing nitrogen loss by 35% and shortening the composting cycle by more than 30%.

[0088] Although the present invention has been described in detail above with general descriptions, specific embodiments, and experiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A strain of Bacillus subtilis DW251, characterized in that, The Bacillus subtilis DW251 was deposited at the China General Microbiological Culture Collection Center on January 20, 2025, with accession number CGMCC NO.33467.

2. The Bacillus subtilis DW251 according to claim 1, characterized in that, The nucleotide sequence of Bacillus subtilis DW251 is shown in SEQ ID NO.

1.

3. The method for culturing Bacillus subtilis DW251 as described in claim 1, characterized in that, The method involves first culturing the bacterial strain in LB liquid medium until the logarithmic growth phase to obtain a seed culture, and then inoculating the seed culture into a bacterial culture medium for further cultivation under the following conditions: The bacterial culture medium is any one of LB liquid medium, NH3 selective medium, LBSP medium, casein medium or rhodamine B medium; The incubation temperature is 35℃~60℃; The vaccination rate is 3% to 13%; The initial pH of the culture medium is 3-9; The nitrogen source for the culture medium is any one or more of ammonium sulfate, ammonium chloride, or ammonium dihydrogen phosphate.

4. The method for culturing Bacillus subtilis DW251 according to claim 3, characterized in that, The OD of the logarithmic phase bacterial culture 600 The value is 0.4 to 0.

6.

5. The method for culturing Bacillus subtilis DW251 according to claim 3, characterized in that, The specific culture conditions are as follows: The incubation temperature is 40℃~55℃; The vaccination rate is 7% to 11%; The initial pH of the culture medium is 5-9; The nitrogen source for the culture medium is any one or both of ammonium chloride or ammonium dihydrogen phosphate.

6. The method for culturing Bacillus subtilis DW251 according to claim 5, characterized in that, The specific culture conditions are as follows: The incubation temperature is 50℃; The vaccination rate was 9%; The initial pH of the culture medium was 5; The nitrogen source for the culture medium is ammonium chloride.

7. A solid microbial agent for sludge fermentation, characterized in that, The solid inoculant consists of sterilized rapeseed straw and fermentation broth of strain DW251, wherein: the fermentation broth of strain DW251 is prepared by inoculating strain DW251 into LB liquid fermentation medium and culturing until the bacterial culture reaches OD. 600 The value is 1; the mass ratio of the sterilized rapeseed straw to the fermentation broth of strain DW251 is 1:

1.

8. The method for preparing the solid microbial agent for sludge fermentation as described in claim 7, characterized in that, The method involves mixing sterilized rapeseed straw with the fermentation broth of strain DW251 in a certain proportion, then draining the water to obtain the final product.

9. The method for preparing the solid microbial agent for sludge fermentation according to claim 8, characterized in that, The temperature condition for controlling moisture is 55℃.

10. The application of Bacillus subtilis DW251 as described in claim 1 or the solid microbial agent for sludge fermentation as described in claim 7 in sludge fermentation.

Citation Information

Patent Citations

  • Perishable organic garbage degradation and elimination microbial agent, preparation method and used bacteria thereof

    CN102010844A

  • Bacillus subtilis SC228 with nitration function and application thereof

    CN105969708A

  • Bacillus subtilis and application thereof

    CN106754511A

  • Bacillus subtilis BS40-4 and application thereof

    CN111748499A

  • Bacillus subtilis and application thereof

    CN112375720A