Method for enhancing RNAi efficiency of lepidoptera insects by adopting dendritic mesoporous silica nanoparticles and application

Abstract

The invention discloses a method for enhancing the RNAi efficiency of lepidoptera insects by adopting dendritic mesoporous silica nanoparticles and application. The method comprises the following steps: mixing dendritic mesoporous silica nanoparticles with a dsRNA solution of a target gene of the lepidoptera insect, carrying out repeated vortex oscillation and on-ice incubation for multiple times to prepare a dsRNA-DMSNs compound, and carrying out RNAi (Ribonucleic Acid Interference) on the insect by adopting the dsRNA-DMSNs compound. The invention also provides an application of the dendritic mesoporous silica nanoparticles for enhancing the RNAi efficiency of the lepidoptera insects, the RNAi efficiency of the lepidoptera insects can be enhanced, and after the dsRNA-DMSNs compound is used for performing RNAi on the insects, isoprocarb or triazophos is applied, so that the sensitivity of the insects to insecticides can be enhanced.

Description

Technical Field

[0001] This invention belongs to the field of agricultural pest control technology, specifically relating to a method and application of using dendritic mesoporous silica nanoparticles to enhance the RNAi efficiency of lepidopteran insects. Background Technology

[0002] RNA interference (RNAi) is a highly conserved gene silencing mechanism triggered by double-stranded RNA (dsRNA). It specifically degrades homologous mRNA, thereby inhibiting the expression of target genes. Since its discovery in nematodes in 1998, RNAi technology has been widely used in functional genomics research and disease treatment due to its high target specificity and designability. In agricultural pest control, RNAi technology has shown great potential and is considered a green control strategy that can replace or reduce the use of chemical pesticides. The basic principle of applying RNAi technology to agricultural pest control is to design specific dsRNAs targeting essential pest genes, introduce them into the pest's body, and induce gene silencing, leading to inhibited growth and development, reduced reproductive capacity, and even death, thus achieving precision control.

[0003] However, despite the significant success of RNAi technology in theoretical research and laboratory models, its practical application in the field of important agricultural pests such as Lepidoptera still faces major challenges. Lepidoptera pests are diverse, and many species (such as the cotton bollworm, diamondback moth, and meadow moth) have a huge impact on global agricultural production. These pests exhibit a series of biological barriers that limit the efficiency of RNAi: First, lepidopteran insects have high activity of nucleases (such as dsRNase), and exogenously injected dsRNA is easily and rapidly degraded in the hemolymph and midgut, resulting in a significantly shortened half-life and an inability to accumulate to a concentration sufficient to induce efficient gene silencing. Second, the cellular ribonucleic acid interference mechanisms (such as the activity of the Dicer and RISC complex) in lepidopteran insects are relatively inefficient, and the endocytosis and systemic spread of dsRNA are poor, making RNAi responses often limited to local tissues and difficult to achieve systemic gene silencing. In addition, the delivery efficiency and silencing effect of dsRNA vary significantly among different species and even different populations, and this species- and gene-dependent variability further increases the complexity of the technology application.

[0004] Currently, strategies to improve RNAi efficiency in lepidopteran insects mainly include: 1. Chemically modifying dsRNA (such as thiophosphorylation and 2'-fluorine modification) to enhance its stability, but this method is costly and complex in synthesis; 2. Using viral vectors (such as baculoviruses) or engineered bacteria to deliver dsRNA, but this method has biosafety risks and host range limitations; 3. Using nanomaterials as dsRNA delivery carriers, utilizing the protective effects and enhanced endocytosis properties of nanomaterials to improve dsRNA stability and delivery efficiency. Currently, existing technologies include various nanomaterials such as liposomes, polymer nanoparticles, layered double hydroxides (LDH), silica nanoparticles, and mesoporous silica nanoparticles (MSNs). Among them, mesoporous silica nanoparticles have attracted attention due to their good biocompatibility, high specific surface area, ease of functionalization, and tunable pore structure. However, traditional MSNs often face problems such as low loading efficiency, easy dsRNA leakage, and weak interaction with insect cells.

[0005] Chinese invention patent application No. 202211580010.8 discloses a nanopesticide formulation using dendritic mesoporous silica as a carrier, its preparation method, and its application. Dendritic mesoporous silica nanoparticles (DMSNs) are a special structural form of MSNs, possessing a centrally radial pore structure, larger pore size, and higher specific surface area, theoretically more conducive to the loading and protection of large dsRNA molecules. However, current research on the application of DMSNs in insect RNAi is still in its early stages. Its enhancement efficiency, universality (cross-species, cross-genetic), mechanism of action, and integration with actual pest control scenarios all require in-depth and systematic research.

[0006] Therefore, there is an urgent need in the existing technology for a dsRNA delivery technology that can effectively overcome the RNAi barrier in lepidopteran insects, which is a pressing requirement for the development of a new generation of green pest control products. Summary of the Invention

[0007] The purpose of this invention is to overcome the shortcomings of the existing technology and provide a method and application for enhancing the RNAi efficiency of lepidopteran insects using dendritic mesoporous silica nanoparticles.

[0008] The objective of this invention is achieved through the following technical solution: a method for enhancing the RNAi efficiency of lepidopteran insects using dendritic mesoporous silica nanoparticles, comprising the following steps: mixing dendritic mesoporous silica nanoparticles with a dsRNA solution targeting a lepidopteran insect gene, wherein the mass ratio of dendritic mesoporous silica nanoparticles to dsRNA targeting a lepidopteran insect gene is 0.25-2.0:1; after repeated vortexing and ice incubation, a dsRNA-DMSNs complex is prepared; and the dsRNA-DMSNs complex is used to perform RNAi on insects.

[0009] Furthermore, the mass ratio of the dendritic mesoporous silica nanoparticles to the dsRNA of the target gene of the lepidopteran insect is 1.0-2.0:1.

[0010] Furthermore, the lepidopteran insects mentioned are grass moths, fall armyworms, rice stem borers, beet armyworms, diamondback moths, cotton bollworms, rice leaf rollers, cotton bollworms, pine caterpillars, gypsy moths, soybean pod borers, apple leaf rollers, corn borers, oriental armyworms, tea geometrid moths, cicadas, large bridge-building insects, cutworms, or cabbage white butterflies.

[0011] An application of dendritic mesoporous silica nanoparticles to enhance RNAi efficiency in lepidopteran insects involves mixing dendritic mesoporous silica nanoparticles with a dsRNA solution targeting a lepidopteran insect gene at a mass ratio of 0.25-2.0:1. After repeated vortexing and ice incubation, a dsRNA-DMSNs complex is prepared. This dsRNA-DMSNs complex is then used to perform RNAi on insects, thereby enhancing the RNAi efficiency in lepidopteran insects.

[0012] Furthermore, the mass ratio of the dendritic mesoporous silica nanoparticles to the dsRNA of the target gene of the lepidopteran insect is 1.0-2.0:1.

[0013] Furthermore, after RNAi treatment of insects using the aforementioned dsRNA-DMSNs complex, the application of isoprocarb or triazophos can enhance the insects' sensitivity to insecticides.

[0014] The beneficial effects of this invention are: 1. Significant improvement in gene silencing efficiency. This invention achieves a breakthrough improvement in RNAi efficiency. Experimental results show that, compared with using dsRNA alone, the silencing efficiency of the target gene can be increased by more than 2 times after loading with DMSNs. Specifically, when treating larvae of the grass moth with dsace1 at a dose of 50 ng / pest, the silencing efficiency of dsRNA alone is only 31.58%, while the silencing efficiency is significantly increased to 62.7% after loading with an equal mass of DMSNs (1:1). This significant improvement in efficiency is mainly due to the unique hierarchical pore structure and high specific surface area of ​​DMSNs, which can effectively load and protect dsRNA from degradation by nucleases in vivo, thereby improving its bioavailability and stability.

[0015] 2. Significantly Improved RNAi Response Speed ​​of this Invention. This invention significantly shortens the onset time of RNAi. Typically, dsRNA alone requires 48-72 hours to observe a significant gene silencing effect. However, this invention achieves significant inhibition of target gene expression within 24 hours after injection of the dsRNA-DMSNs complex. This rapid response characteristic stems from the dendritic pore structure of DMSNs, which facilitates rapid release and cellular uptake of dsRNA. Simultaneously, its positively charged surface promotes effective interaction with the negatively charged cell membrane, accelerating the internalization process. This feature is of great significance for practical pest control applications, enabling faster control effects.

[0016] 3. This invention has broad cross-species applicability. This invention demonstrates its universal effectiveness against a variety of lepidopteran pests. Experimental results show that this method is not only effective against the model insect *Loxostege sticticalis*, but also exhibits significant RNAi enhancement effects against important agricultural pests such as the cotton bollworm (*Helicoverpa armigera*), the diamondback moth (*Plutella xylostella*), and the Asian corn borer (*Ostrinia furnacalis*). This cross-species applicability indicates that the DMSNs-mediated dsRNA delivery strategy overcomes the differences in cellular uptake and systemic dispersal among different lepidopteran species, and has broad prospects for widespread application.

[0017] 4. This invention possesses multi-gene versatility. It also demonstrates a universal enhancement effect on multiple different target genes within the same insect. Experiments on 10 randomly selected different functional genes in the grass moth showed that DMSN loading significantly improved the RNAi efficiency of these genes, with silencing efficiency increases ranging from 40% to 100%. This characteristic indicates that the enhancement mechanism of this method is not gene-specific, but rather operates through universal mechanisms such as improving dsRNA delivery and stability. Therefore, it is applicable to silencing various essential genes within pests, providing a technical basis for designing multi-target pest control strategies.

[0018] 5. This invention offers ease of operation and cost-effectiveness. The physical mixing method employed in this invention requires no complex chemical modifications or coupling reactions, and the operation process is simple and quick, capable of being completed under conventional laboratory conditions. The synthesis process of DMSNs is mature and stable, with low raw material costs, demonstrating good potential for large-scale production. Furthermore, the method requires a relatively low dose of dsRNA, further reducing application costs and providing economic feasibility for practical agricultural applications.

[0019] In summary, this invention, through the innovative application of a simple physical mixture of DMSNs and dsRNA, effectively solves the key technical problems of low efficiency, slow speed, and limited applicability that have long existed in the application of RNAi technology in lepidopteran insects, and provides a new solution for the development of efficient, green, and sustainable pest control technologies. Attached Figure Description

[0020] Figure 1 Flowchart for the preparation and injection of dsRNA-DMSNs complex; Figure 2 RNAi efficiency after injection of different doses of dsace1; Figure 3 For different proportions of DMSNs ace1 The high efficiency of gene silencing; Figure 3 A represents the relative expression level of the ace1 gene in second-instar larvae 24 hours after injection of the dsRNA-DMSNs complex. Figure 3 B represents the relative expression level of the ace1 gene in second-instar larvae 48 hours after injection of the dsRNA-DMSNs complex. Figure 3 C represents the relative expression level of the ace1 gene in second-instar larvae 72 hours after injection of the dsRNA-DMSNs complex. Figure 4 For different DMSNs doses ace1 Time progression of gene RNAi efficiency; Figure 4 A represents the RNAi efficiency of injecting 50 ng / pestdsace1; Figure 4B represents the RNAi efficiency of injecting 50 ng / pest dsace1 + 0.25 times DMSNs; Figure 4 C represents the RNAi efficiency of injecting 50 ng / pest dsace1 + 0.5 times DMSNs; Figure 4 D represents the RNAi efficiency of injecting 50 ng / pest dsace1 + 1 times DMSNs; Figure 4 E represents the RNAi efficiency of injecting 50 ng / pest dsace1 + 2 times DMSNs; Figure 5 To enhance the RNAi effect of different doses of dsace1 on equivalent DMSNs; Figure 5 A represents the relative expression level of the ace1 gene after injection of DMSNs+5ng / pest dsace1; Figure 5 B represents the relative expression level of the ace1 gene after injection of DMSNs + 10 ng / pest dsace1; Figure 5 C represents the relative expression level of the ace1 gene after injection of DMSNs + 30 ng / pest dsace1; Figure 5 D represents the relative expression level of the ace1 gene after injection of DMSNs + 50 ng / pest dsace1; Figure 6 To demonstrate the universal enhancement effect of DMSNs on multiple different genes in the meadow moth RNAi; Figure 7 To demonstrate the universal enhancement effect of DMSNs on RNAi of the ace1 gene in various lepidopteran insects; Figure 8 Grass moth under different RNAi treatments ( L. sticticalis Changes in larval insecticide sensitivity; Figure 8 A represents the larval mortality rate caused by the application of 3.5 ng / triazophos after injection of 50 ng / pest dsace1 + different doses of DMSNs; Figure 8 B represents the larval mortality rate caused by the application of 18.0 ng / pest isoprocarb after injection of 50 ng / pest dsace1 + different doses of DMSNs. Detailed Implementation

[0021] The present invention will now be described in detail with reference to the accompanying drawings. Example

[0022] 1. Synthesis of DMSNs: First, triethanolamine (TEA, 0.34 g) was dissolved in 125 mL of deionized water and stirred continuously at 80 °C for 30 minutes. Then, cetyltrimethylammonium bromide (CTAB, 1.9 g) and sodium salicylate (NaSal, 0.84 g) were added to the solution, and stirring continued for 1 hour. Next, 8 mL of bis[3-(triethoxysilyl)propyl]tetrasulfide (BTES) and 10 mL of tetraethyl orthosilicate (TEOS) were slowly added dropwise, and the reaction continued for 12 hours. The resulting product was collected by centrifugation, washed thoroughly with ethanol, and then refluxed at 60 °C for 6 hours in a solution containing 0.5 mL of hydrochloric acid (38% v / v) and 30 mL of ethanol (99.7% v / v) to remove the surfactant. This extraction step was repeated three times. Finally, the purified DMSNs were vacuum dried at room temperature for later use.

[0023] 2. Preparation of dsRNA-DMSNs complex: The dsRNA-DMSNs complex is prepared by mixing DMSNs and dsRNA in a specific mass ratio. See also Figure 1 Using dsRNA solution, the concentration of dsRNA in the solution was accurately determined. DMSNs powder was added to the dsRNA solution at DMSNs to dsRNA mass ratios of 0.25:1, 0.5:1, 1:1, and 2:1 to prepare dsRNA-DMSNs mixtures. All procedures were performed on ice to minimize RNA degradation. The dsRNA-DMSNs mixture was vortexed for 1 minute, followed by incubation on ice for 3 minutes. This step was repeated 5 times to promote dsRNA-DMSNs complex formation. The final dsRNA-DMSNs complex was stored on ice for short-term use (<6 hours). Before injection, the dsRNA-DMSNs complex solution was vortexed again for 1 minute to ensure homogeneity. Microinjection of the dsRNA-DMSNs complex into the second instar larvae of several lepidopteran pests, including the fall armyworm, rice stem borer, beet armyworm, diamondback moth, cotton bollworm, pine caterpillar, gypsy moth, soybean pod borer, apple leafroller, corn borer, armyworm, tea geometrid moth, cicada, giant bridge-building insect, cutworm, and cabbage white butterfly, was successfully performed. The preparation of the dsRNA-DMSNs complex requires no complex chemical modification, is simple and rapid, and highly practical.

[0024] 3. Microinjection procedure: RNA interference experiments were conducted on lepidopteran pests, including the fall armyworm, rice stem borer, beet armyworm, diamondback moth, cotton bollworm, rice leaf roller, cotton bollworm, pine caterpillar, gypsy moth, soybean pod borer, apple leafroller, corn borer, oriental armyworm, tea geometrid moth, cicada, giant bridge worm, cutworm, and cabbage white butterfly, using the microinjection method.

[0025] Synthesis of targeted acetylcholinesterase 1 ( ace1 The double-stranded RNA of the gene (gene sequence information is available on the Genebank website). The specific procedure is as follows: RNA was extracted from the above 20 insect species using Trizol (Invitrogen, USA). The RNA extraction steps were as follows: 1) Collect 15 insect samples of each of the above 20 insect species into sample collection tubes, and flash freeze them in liquid nitrogen, immersing the sample collection tubes completely. Store the samples in an ultra-low temperature freezer at -80°C; 2) Remove the samples, add 1 mL of Trizol reagent, and grind thoroughly; 3) Add 0.2 mL of chloroform, shake vigorously for 15 seconds until the solution turns pink, and let stand on ice for 10 minutes; 4) Centrifuge at 12000×g for 15 minutes at 4°C, and transfer the colorless aqueous phase to a new centrifuge tube, for a total of 480 μL of colorless aqueous phase; 5) Add 480 μL of isopropanol, mix slowly by inverting, and place in a freezer at -20°C for 30 minutes; 6) Centrifuge at 12000×g for 10 minutes at 4°C, and discard the supernatant; 7) Add 1 mL of Trizol reagent to the sample collection tubes. 8) Wash the precipitate with 75% ethanol (prepared fresh), shake until the precipitate floats; 9) Centrifuge at 12000×g for 5 min at 4℃, discard the supernatant; 10) Repeat steps 7) and 8); 11) Dry at room temperature for 10 min; 12) Dissolve in enzyme-free sterile water and mix thoroughly; 13) Use NanoDrop 2000 (ThermoFisher, USA) to detect the concentration, A260 / A280 and A260 / A230 values ​​of the extracted RNA; use gel electrophoresis to detect RNA integrity.

[0026] 2. Reverse transcription reaction, using the HiScript reverse transcription kit. ® III RT SuperMix for qPCR (Novizan, Nanjing, China), reaction system as follows: 1) Remove genomic DNA. The reaction system is shown in Table 1.

[0027] Table 1. Genomic DNA Removal Reaction System 4 × gDNA wiper Mix 4 μL Total RNA 1 μg RNase Free H2O Up to 16 μL Overall system 16 μL Reaction conditions: 42℃, 2 min, store at 4℃.

[0028] 2) Reverse transcription, the reaction system is shown in Table 2.

[0029] Table 2 Reverse transcription reaction system 5 × HiScript III qRT SuperMix 4 μL The reaction solution in the first step 16 μL Overall system 20 μL Reaction conditions: 37℃ for 15 min, 85℃ for 5 s, store at 4℃.

[0030] 3) Amplification of dsRNA template: Specific primers for dsRNA synthesis were designed using Primer 5 software. The dsRNA template amplification product was 400 bp in length. The T7 promoter sequence (TAATACGACTCACTATAGGG) was added to the 5' end of the selected upstream and downstream specific primers as the primer template for dsRNA synthesis. The enhanced green fluorescent protein (EFPP) gene was used as the template. eGFP () serves as a negative control. Primers used for dsRNA template amplification are shown in Table 3.

[0031] Table 3 Primer Information

[0032] Use 2×Phanta ® Sequence amplification was performed using the Max Master Mix kit (Novizan, Nanjing, China). The PCR reaction system is shown in Table 4.

[0033] Table 4 PCR reaction system 2 × Phanta Max Master Mix 25 μL Upstream primer (10 μM) 2 μL Downstream primer (10 μM) 2 μL template cDNA 2 μL <![CDATA[ddH2O]]> Up to 50 μL Overall system 50 μL PCR reaction conditions: 95℃, 3 min; 95℃ (15s), specific primer Tm (15s), 72℃ (30s), 10 cycles; 95℃ (15s), T7-specific primer Tm (15s), 72℃ (30s), 28 cycles; 72℃ total extension 5 min.

[0034] PCR amplification products were purified using a PCR product purification kit (TransGold, Beijing, China), and the concentration, A260 / A280, and A260 / A230 values ​​of the PCR products were detected using a NanoDrop 2000 instrument (Thermo Fisher, USA). The purified PCR products were then used as templates for in vitro transcription.

[0035] 4. dsRNA was synthesized using the T7 RiboMAX™ RNAi kit (Promega, USA). The dsRNA synthesis reaction system is shown in Table 5.

[0036] Table 5 dsRNA synthesis reaction system RiboMAX Express T7 2 × Buffer 10 μL T7 Express Enzyme Mix 2 μL DNA template 1 μg sterile enzyme-free water Up to 20 μL Overall system 20 μL Reaction conditions: 37℃, 6h; 70℃, 10min; slowly cool to room temperature. Then add 1µL RQ1 RNase-FreeDNase (diluted 200 times with sterile enzyme-free water, i.e., add 199µL of sterile enzyme-free water) and 1µL RNase Solution (diluted 200 times with sterile enzyme-free water), and incubate at 37℃ for 30min. 5. dsRNA purification:

[0037] 1) Add 2 μL of 3M sodium acetate and 50 μL of 95% ethanol to a 20 μL system of the product synthesized in the previous step, and place on ice for 5 min; 2) Centrifuge at 4℃, 16000×g for 10 min, and discard the supernatant; 3) Add 500 μL of pre-cooled 70% ethanol (prepared and used immediately), wash the precipitate, centrifuge at 12000×g for 5 min at 4℃, and discard the supernatant; 4) Repeat step 3) once; dry at room temperature for 15 minutes; 5) Add 50 μL of enzyme-free sterile water to fully dissolve the dsRNA; 6) Concentration was determined using a NanoDrop 2000 instrument (Thermo Fisher, USA), and dsRNA integrity and band length were detected by 2% agarose gel electrophoresis. The purified dsRNA was diluted to 3000 ng / μL and stored at -80°C.

[0038] The synthesized dsRNA was diluted to different concentrations for later use. Healthy, uniformly sized second-instar larvae were selected and lightly anesthetized for 30-40 seconds with a carbon dioxide flow (0.5 L / min). The anesthetized larvae were fixed ventrally upward in a pre-made agarose groove plate. Under a stereomicroscope (10-40× magnification), the intersegmental membrane between the third and fourth abdominal segments was selected as the injection target. Using a Nanoject microinjector, 20 nL of the prepared dsRNA-DMSNs complex solution was injected into the carbon dioxide-anesthetized lepidopteran larvae into the intersegmental membrane between the third and fourth abdominal segments.

[0039] 4. Effect Verification: 1) High efficiency: The relative expression level of the ace1 gene in second-instar larvae 48 hours after injection of dsace1 was tested by qPCR. Primers for real-time quantitative PCR were designed using Primer 3 (https: / / primer3.ut.ee / ), with amplified product length ranging from 100-200 bp, primer GC content of 40-60%, and Tm value of 60℃ (primers are shown in Table 6). 2 μL of cDNA diluted 10-fold was used as a template, and 10 μL of Taq enzyme premix (Novizan, Nanjing, China) and 0.4 μL (10 μmol / L) of upstream and downstream primers were added, respectively. Sterile, enzyme-free water was added to bring the total volume to 20 μL. The qRT-PCR program was: 95℃ pre-denaturation for 30 s; 95℃ for 5 s, 60℃ for 31 s, for 40 cycles; finally, melting curve amplification was performed on a QuantStudio Real-Time PCR System (Applied Biosystems, USA). Results are as follows: Figure 2 As shown, using 50 ng / per insect of dseGFP as a control (Ctrl), the RNAi efficiency of 50 ng / pest dsace1 (dsRNA) alone was only 31.58% after 48 hours. RNAi efficiency = (1 - relative expression level corresponding to the bar height in the bar chart) * 100%. However, after adding an equal amount (1:1) of DMSNs, the RNAi efficiency was significantly improved, reaching 59.40% after 24 hours (see...). Figure 3 A), the RNAi efficiency after 48 hours was 62.70% (see A). Figure 3 B), the RNAi efficiency after 72 hours was 63.30% (see B). Figure 3 C).

[0040] Table 6 Primer Information

[0041] 2) Speed: The mixing of DMSNs and dsRNA promotes rapid RNAi initiation. Without DMSNs, RNAi induction with 50 ng / pest dsace1 is not only less efficient but also takes longer to take effect (see...). Figure 4 A) Adding a small amount of DMSNs can improve RNAi efficiency, but it cannot accelerate RNAi. For example, adding 0.25 times (see...) Figure 4 B) and 0.50 times (see Figure 4 DMSNs of C). Add 1.00 times (see C) Figure 4 D) and 2.00 times (see D) Figure 4E) DMSNs can simultaneously enhance RNAi efficiency and accelerate RNAi occurrence, with significant gene silencing effects observed within 24 hours, while only 50 ng / pestdsace1 (see E) injections... Figure 4 A) It takes 48-72 hours to observe a significant gene silencing effect.

[0042] 3) Dosage flexibility: Within the dsRNA dosage range of 10-50 ng / pest, adding equivalent (of the same mass as the injected dsRNA) DMSNs effectively enhances RNAi efficiency. Changing the amount of dsace1 while adding an equal amount of DMSNs, except for adding 5 ng / pest of dsace1 which was too small to achieve RNAi efficiency (see...), Figure 5 A), add 10 ng / pest dsace1 (see Figure 5 B), 30 ng / pest dsace1 (see Figure 5 C), 50 ng / pest dsace1 (see Figure 5 D) can both improve RNAi efficiency.

[0043] 4) Universality (Different Genes): Ten genes from the meadow moth (ace1, UGT53, GTSe2, Antp, FoxO, CREB, AKT, MafB, HR3, and ILP1) were selected. Using the T7 RNAi transcription kit, dsRNAs from these ten different genes were synthesized (the synthesis method is the same as the corresponding section in "3. Microinjection Operation," primers are shown in Table 7). Then, dsRNAs or dsRNA-DMSNs were injected into second-instar larvae of the meadow moth via microinjection. Mixing DMSNs with dsRNA significantly improved RNAi efficiency (gene quantification primers are shown in Table 3). Figure 6 As shown, with a dosage of 50 ng / pest dsRNA, the RNAi efficiency of the ace1, UGT53, GTSe2, Antp, FoxO, CREB, AKT, MafB, HR3, and ILP1 genes increased from 31.60%, 17.60%, 20.70%, 24.40%, 18.80%, 15.30%, 28.50%, 23.40%, 25.90%, and 30.80% without DMSNs to 59.40%, 52.60%, 60.60%, 59.40%, 62.50%, 53.50%, 60.50%, 47.50%, 66.50%, and 58.50% after adding DMSNs (of the same quality as the injected dsRNA).

[0044] Table 7 Primer Information

[0045] Universality (Different Insects): Twenty lepidopteran pests of significant economic value were selected (including the fall armyworm, rice stem borer, beet armyworm, diamondback moth, cotton bollworm, rice leaf roller, cotton bollworm, pine caterpillar, gypsy moth, soybean pod borer, apple leafroller, corn borer, oriental armyworm, tea geometrid moth, oak silkworm, large bridge-building insect, cutworm, and cabbage white butterfly). The ace1 gene from these 20 lepidopteran insects was synthesized into dsace1 using the T7 RNAi transcription kit (the synthesis method is the same as the corresponding section in "3. Microinjection Operation"). Then, dsace1 or dsace1-DMSNs from different insects were injected into the corresponding second-instar larvae of the 20 insect species via microinjection. The mixture of DMSNs and dsace1 significantly enhanced the silencing effect of the ace1 gene. Figure 7 As shown, for 20 lepidopteran pests including the fall armyworm, rice stem borer, beet armyworm, diamondback moth, cotton bollworm, peach fruit moth, rice leaf roller, cotton bollworm, pine caterpillar, gypsy moth, soybean pod borer, apple leafroller, corn borer, oriental armyworm, tea geometrid moth, oak silkworm, large bridge-building insect, cutworm, and cabbage white butterfly, adding an equal amount (equivalent to the injected dsRNA) of DMSNs (50 ng / pest) to the ace1 gene can reduce the effect of using 50 ng / pest alone. The RNAi efficiency of dsace1 ranged from 31.60%, 26.40%, 18.80%, 17.60%, 12.70%, 24.80%, 25.20%, 28.40%, 19.70%, 31.20%, 26.40%, 24.80%, 19.80%, 20.10%, 18.70%, 23.60%, 24.80%, 17.70%, 13.60%, and 1 The percentages increased from 8.80% to 59.40%, 52.60%, 60.60%, 59.40%, 62.50%, 53.50%, 60.50%, 47.50%, 66.50%, 58.50%, 63.30%, 58.10%, 44.20%, 57.50%, 59.60%, 69.10%, 54.90%, 43.70%, 61.60%, and 42.40%.

[0046] 5. Bioassay and Application: Treatment with dsRNA-DMSNs complex (silencing) ace1The toxicity of insecticides to third-instar larvae of the grassland moth (gene) was determined. A drop method was used, diluting triazophos and isoprocarb with acetone. The diluted triazophos (1.17 mg / L) and isoprocarb (6 mg / L) were placed in a syringe of a micro-drip apparatus, and 3 μL was dropped onto the thorax of each larva. Acetone was used as a blank control. After the pesticide solution had completely evaporated, the larvae were transferred to rearing boxes containing fresh lamb's quarters and kept for 48 hours. The results showed that the larvae in the treated group were significantly more sensitive to both triazophos and isoprocarb than the control group. RNAi was performed using 50 ng / pest dsace1 and dsRNA-DMSNs complex, followed by bioassays using 3.5 ng / pest triazophos. The results showed that without the addition of DMSNs, the bioassay mortality rate after RNAi was not significantly increased (48.67%, compared to 45.82% in the control group). Adding 0.25-fold, 0.50-fold, 1.00-fold, and 2.00-fold DMSNs increased the mortality rate to 53.50%, 67.70%, 83.50%, and 84.70%, respectively (see...). Figure 8 A). Similarly, RNAi was performed using a 50 ng / pest dsace1 and dsRNA-DMSNs complex, followed by bioassays using 18.0 ng / pest isoprocarb. The results showed that without the addition of DMSNs, the mortality rate after RNAi was not significantly increased (52.26%, compared to 47.95% in the control). Adding 0.25-fold, 0.50-fold, 1.00-fold, and 2.00-fold DMSNs increased the mortality rate to 57.92%, 61.63%, 76.54%, and 78.38%, respectively (see [link to study]). Figure 8 B). This demonstrates that the method of the present invention can effectively improve the sensitivity of pests to chemical pesticides.

[0047] Pest control research mainly uses injection and feeding methods, both of which have the same working principle and effect. This invention uses the injection method for experimental research.

[0048] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A method for enhancing RNAi efficiency in lepidopteran insects using dendritic mesoporous silica nanoparticles, characterized in that... The process includes the following steps: mixing dendritic mesoporous silica nanoparticles with a dsRNA solution targeting a gene from lepidopteran insects, wherein the mass ratio of dendritic mesoporous silica nanoparticles to dsRNA targeting a gene from lepidopteran insects is 0.25-2.0:1; after repeated vortexing and incubation on ice, a dsRNA-DMSNs complex is prepared; and the dsRNA-DMSNs complex is used to perform RNAi on insects.

2. The method according to claim 1, characterized in that, The mass ratio of the dendritic mesoporous silica nanoparticles to the dsRNA of the target gene of the lepidopteran insect is 1.0-2.0:

1.

3. The method according to claim 2, characterized in that: The Lepidoptera insects mentioned are: fall armyworm, rice stem borer, beet armyworm, diamondback moth, cotton bollworm, rice leaf roller, cotton bollworm, pine caterpillar, gypsy moth, soybean pod borer, apple leaf roller, corn borer, oriental armyworm, tea geometrid moth, cicada, large bridge-building insect, cutworm, or cabbage white butterfly.

4. An application of using dendritic mesoporous silica nanoparticles to enhance RNAi efficiency in lepidopteran insects, characterized in that: Dendritic mesoporous silica nanoparticles were mixed with a solution of dsRNA targeting the target gene of lepidopteran insects at a mass ratio of 0.25-2.0:

1. After repeated vortexing and ice incubation, a dsRNA-DMSNs complex was prepared. The dsRNA-DMSNs complex was then used to perform RNAi on insects, thereby enhancing the RNAi efficiency of lepidopteran insects.

5. The application according to claim 4, characterized in that: The mass ratio of the dendritic mesoporous silica nanoparticles to the dsRNA of the target gene of the lepidopteran insect is 1.0-2.0:

1.

6. The application according to claim 5, characterized in that: Following RNAi treatment of insects with the aforementioned dsRNA-DMSNs complex, application of isoprocarb or triazophos can enhance the insects' sensitivity to insecticides.

Images