A molecular marker related to a mussel variety, a primer pair and application thereof
By designing specific molecular markers and primer pairs, the problem of accurately identifying purple mussels and thick-shelled mussels and their hybrid offspring in existing technologies has been solved, enabling accurate identification and screening of mussel varieties and promoting the orderly development of mussel seedling breeding and aquaculture production.
Patent Information
- Application Number
- CN202511706301.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-20
- Publication Date
- 2026-03-03
- Estimated Expiration
- 2045-11-20
AI Technical Summary
Existing technologies make it difficult to accurately identify purple mussels and thick-shelled mussels and their hybrid offspring, resulting in problems such as slow growth, small size, and poor uniformity in mussel breeding and aquaculture. Furthermore, the existing molecular marker primer sequences have high uncertainty and cannot effectively distinguish mussel varieties.
Specific molecular markers and primer pairs were designed, including molecular marker 1 and molecular marker 2 with nucleotide sequences such as SEQ ID NO.1 and SEQ ID NO.2, and forward and reverse primers with nucleotide sequences such as SEQ ID NO.3 and SEQ ID NO.4, for the identification of mussel species by PCR amplification, and to distinguish between purple mussels, thick-shelled mussels and their hybrid offspring.
It has enabled accurate identification of purple mussels, thick-shelled mussels, and hybrid mussels, promoting the orderly development of mussel seedling and aquaculture production and improving identification efficiency and accuracy.
Smart Images

Figure CN121137185B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and in particular to a molecular marker, primer pair and its application related to mussel species. Background Technology
[0002] The purple mussel (Mytilus galloprovincialis) and the thick-shelled mussel (Mytilus coruscus) are two common mussel species belonging to the class Bivalvia, order Mytiloides, family Mytilidae, and genus Mytilus. They are widely distributed along the coast of my country and are important aquaculture species. my country's mussel farming output exceeds 900,000 tons, with the purple mussel and the thick-shelled mussel being the main farmed species. The combined output of these two species accounts for more than 85% of the total mussel production.
[0003] Mussel farming is mainly concentrated in the northern coastal areas such as Liaoning and Shandong, relying heavily on wild seedlings. Thick-shelled mussel farming, on the other hand, is mainly concentrated in the southern sea areas such as Zhejiang and Fujian, using artificially bred seedlings. In their natural state, both species of mussels are found along the northern and southern coasts of my country, with overlapping ecological niches, and experiments have shown that they can hybridize. In the artificial breeding production of mussels, problems such as slow offspring growth, small size, and poor uniformity have emerged, possibly due to contamination of the broodstock, leading to phenotypic segregation in the offspring. Because the shell shapes of the two mussel species and their self-crossed offspring are similar and highly malleable, it is difficult to distinguish them based solely on appearance when selecting broodstock, which seriously hinders the orderly development of artificial breeding and farming production of mussels.
[0004] Currently, there are two main methods for identifying mussel species: one is the traditional method based on external morphological characteristics. However, due to the similarity in shell shape and high plasticity, its reliability has been questioned, and it is unsuitable for identifying hybrid offspring. The other method uses molecular biology techniques, utilizing certain mitochondrial or nuclear gene sequences for species identification. While there are reports on the identification of thick-shelled mussels and blue mussels, mussels have unique genetic characteristics, including the biparental inheritance of mitochondria and the co-evolution of some genes, making them unsuitable for identifying hybrid mussels. A few existing studies have provided PCR primer sequences for distinguishing between blue mussels, thick-shelled mussels, and hybrids of blue mussels and thick-shelled mussels. Their main drawback is the lack of genomic coordinate information for the primer sequences, making it impossible to pre-assess their usability. When the applicant searched public databases for some primer sequences, they found that they did not match well with corresponding species sequences in the NCBI public genome sequence database, indicating uncertainty in existing primers. Therefore, it is necessary to develop new methods for identifying blue mussels, thick-shelled mussels, and their hybrid offspring. Summary of the Invention
[0005] The purpose of this invention is to provide a molecular marker, primer pair and its application related to mussel species, in order to solve the problems existing in the prior art.
[0006] To achieve the above objectives, the present invention provides the following solution:
[0007] The present invention provides a molecular marker related to mussel species, the molecular marker comprising molecular marker 1 with nucleotide sequence as shown in SEQ ID NO.1 and molecular marker 2 with nucleotide sequence as shown in SEQ ID NO.2.
[0008] Preferably, the mussel species include purple mussels, thick-shelled mussels, and hybrid mussels of purple mussels and thick-shelled mussels.
[0009] The present invention provides primer pairs for amplifying the above-mentioned molecular markers, the primer pairs comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.4.
[0010] The present invention provides a reagent or kit for identifying mussel species, the reagent or kit comprising the primer pair described above.
[0011] Preferably, the mussel species include purple mussels, thick-shelled mussels, and hybrid mussels of purple mussels and thick-shelled mussels.
[0012] This invention provides the application of the above-mentioned molecular markers, primer pairs, or reagents or kits in the identification of mussel species.
[0013] Preferably, the mussel species include purple mussels, thick-shelled mussels, and hybrid mussels of purple mussels and thick-shelled mussels.
[0014] This invention provides a method for identifying mussel species, the method comprising the following steps:
[0015] Using the genomic DNA of the mussel to be tested as a template, PCR amplification was performed on the template using the primer pairs described above, and the species of the mussel to be tested was determined using the PCR amplification results.
[0016] Preferably, if only one 453bp molecular marker electrophoresis band is amplified using the primer pair, the mussel to be tested is identified as a purple mussel; if only one 891bp molecular marker electrophoresis band is amplified using the primer pair, the mussel to be tested is identified as a thick-shelled mussel; if only one 453bp molecular marker electrophoresis band and one 891bp molecular marker electrophoresis band are amplified using the primer pair, the mussel to be tested is identified as a hybrid mussel of purple mussel and thick-shelled mussel.
[0017] This invention provides the use of the above-described molecular markers, primer pairs, or reagents or kits in any of the following:
[0018] (1) Screening for mussels of the purple mussel, thick-shelled mussel, or hybrid mussels of purple mussel and thick-shelled mussel;
[0019] (2) Mussel seedling cultivation;
[0020] (3) Mussel farming.
[0021] The present invention discloses the following technical effects:
[0022] This invention provides a molecular marker associated with mussel species. The molecular marker includes molecular marker 1 with the nucleotide sequence shown in SEQ ID NO.1 and molecular marker 2 with the nucleotide sequence shown in SEQ ID NO.2. An amplification primer pair was designed based on molecular marker 1 and molecular marker 2. Results from specific embodiments of this invention show that the primer pair can accurately identify *Mussela purpurea*, *Mussela sclerotinia*, and hybrid mussels using actual samples. Therefore, the molecular marker and primer pair provided by this invention can be used to identify and screen *Mussela purpurea*, *Mussela sclerotinia*, or hybrid mussels of *Mussela purpurea* and *Mussela sclerotinia*, promoting the orderly development of artificial breeding and aquaculture production of mussels. Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 Electrophoretic images of some purple mussels, thick-shelled mussels, and hybrid mussels of purple mussels and thick-shelled mussels. Detailed Implementation
[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0028] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0029] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0030] Example 1: Design of upstream and downstream primers
[0031] DNA sequences from the genomes of the purple mussel (NCBIAccNo.: GCF_965363235.1) and the thick-shelled mussel (NCBIAccNo.: GCA_017311375.1) were paired using the blastn program. Genomic structural variation regions suitable for differentiation by agarose gel electrophoresis of conventional PCR amplification products were searched according to the following conditions:
[0032] (1) The sequences of purple mussel and thick-shelled mussel are located in homologous chromosome sequence pairs;
[0033] (2) The overall length of the sequence alignment is between 100 and 10000 bp;
[0034] (3) The overall consistency of the matched sequences (excluding gaps) is greater than 90%;
[0035] (4) Insertion-deletion structural variations with a length of 100-1000 bp were found in the sequence alignment;
[0036] (5) High homology regions with sequence identity exceeding 100% exist in the flanking sequences of structural variations;
[0037] (6) In step (5), there are subsequences with a length greater than 20bp, a GC content of 35-60%, and no repetitive or low-complexity sequences in the high homology region;
[0038] (7) The subsequence in step (6) was submitted to NCBI for online blastn alignment, which was able to match the genome sequences of purple mussels and thick-shelled mussels;
[0039] (8) The matching in step (7) needs to achieve a “three perfect” match, namely, 100% location (unique genomic region matching), 100% coverage (the full sequence length of the subsequence can be matched), and 100% consistency (100% consistency of the bases of the full sequence of the subsequence).
[0040] (9) Subsequences satisfying the conditions of step (8) can be found in both flanking sequences of the insertion / deletion structural variation in step (4);
[0041] (10) Perform conventional PCR primer design in the subsequence of step (9), requiring primer length to be 19-26 bp, primer GC content to be 35-55%, and expected amplification product to be 200-2000 bp;
[0042] (11) The primer sequences in step (10) were used to perform PCR amplification on the genomic DNA of mussels and thick-shelled mussels. Primers that were stable in amplification and whose PCR product size difference between the two mussels was 100-500 bp were selected.
[0043] After the above steps, the NC_134844.1:34609755-34610206 region was found in the genome of the purple mussel (GCF_965363235.1), and the LG10:64655862-64656750 region was found in the genome of the thick-shelled mussel (GCA_017311375.1), which met the requirements of steps (1)-(11) above. These regions were used as molecular marker 1 and molecular marker 2.
[0044] Molecular marker 1 is the sequence shown in SEQ ID NO.1, located in the NC_134844.1:34609755-34610206 region of the mussel genome (GCF_965363235.1). The underlined sequences are the upstream primer sequence and the reverse complementary sequence of the downstream primer, as shown below:
[0045] GGTCAGCATCATCATAGAATCAACTTTGATAAATAGTAAGTATTGGTCAATGATTATTAGGTCAGAGTGTCCGAAACTTTGTCGGACTTAAAATGGCAGACAAATATTCATTTGGTCCGACAACTATTTAGATTTTTTAGTGGCAAAGGTCAAATTCTTAACATAATGAACATGTTTTGAAAGAGCCAGTGTGCGTTATTCAATCTTGTCTTGTTTTTTTTTTTGT AAAATTTTTTAAAATCTACAGTGCCAATTTTAACCGTTTGCATTAGCAATCATTTTTACATCATGTTTTTGGAAAATTCATAAGATGTTTAGGAGTAGAGTTACAGCAACATTAATATTATGTTAACATATAAAAGCTAATTTAAAGTGTATAATTTAACCAATTATGATATATGATATATTTTCAATATTATTTGACAGCCA TCCTGGTTACTTCGGTAAA GTAG .
[0046] Molecular marker 2 is the sequence shown in SEQ ID NO.2, located in the LG10:64655862-64656750 region of the thick-shelled mussel genome (GCA_017311375.1). The underlined sequences are the upstream primer sequence and the reverse complementary sequence of the downstream primer, as shown below:
[0047] GGTCAGCATCATCATAGAATCAACTTTGATAAATAGTAAGTATTGTTCAATGATTATTATGTATATATATAGGATTTATAAGTGATAAAAATGAAAGAAATATGCTAGAGAAGTTCAGAAATTTATTACCAAACATGGAACCTGGAAATTTAAGTTGCACTCTTTTAGTTTAAACCCCATAGATTAAAATGTCAGATTAATATTTTTGGGGATTTAAATTCTACTGGAGATAAATCTTCAAAATAGCATTAATGATTCTTGTGCATTATCTGTATCGTTATCAATCTAGGGAAATGAGAAATTATTGTTAGTGTGTAAGAAAATCTTAATCCATCAGATGCTTTTGTTAATTAATCAGATAACAATCCACCCATAAGCATGTGAGTATATGGTTACCTATCCAACTATATATTTTTGATATAGGCTTTCCTTGTCTTGTCTTGAA AGGGCCAGTGTGAGCTTTTCTATCTTATCTCTTCATGTCCTTTGTTAACATTTACTCAAATCTTCTGCCAAACTACTGGGCCAATTGGAACCACAGTCCGAGGCAATCATCCTTGCGGTATCATGTTTTATACATTTGTAAAATGTGTCGGATGATAACACCTACCAACCAACATGGTGGCCTAGGCAAAAAAATAGAACATTGGGGTAAATATTGTCTTGAAATACCTAGTCTTTTTTTAACAAAAATTGTAAGACATCTCCTTTTTAGAATTTTCAGCCTTATATGATGACTTTTTTTTTAAAGAAATGAACACGAGGTGTATTAGTAGATGTTATGTAAACATAAAAAAAGCTTATTTATAGCGCACATGTATAATTAAACTAATTATGAAATGATATTCAATATTATTTGACAGCCA TCCTGGTTACTTCGGTAAAGTAG 。
[0048] Based on the above information, the upstream primer sequence designed in this embodiment is: GGTCAGCATCATCATAGAATCAAC (SEQ ID NO.3); the coordinate position of this upstream primer in the NCBI mussel genome GCF_965363235.1 is: NC_134844.1:34609755-34609778 positive strand; the coordinate position of this upstream primer in the NCBI thick-shelled mussel genome GCA_017311375.1 is: LG10:64655862-64655885 positive strand.
[0049] The downstream primer sequence designed in this embodiment is: CTACTTTACCGAAGTAACCAGGA (SEQ ID NO.4); the coordinate position of this downstream primer in the NCBI mussel genome GCF_965363235.1 is: NC_134844.1:34610184-34610206 (negative strand); the coordinate position of this downstream primer in the NCBI thick-shelled mussel genome GCA_017311375.1 is: LG10:64656728-64656750 (negative strand).
[0050] The upstream and downstream primers provided by this invention produce PCR amplification products of 453 bp in the genomic DNA of *Mussela purpurea* and 891 bp in the genomic DNA of *Mussela thick-shelled mussel*. The PCR amplification products in the genomic DNA of first-generation hybrid individuals of *Mussela purpurea* and *Mussela thick-shelled mussel* are 453 bp and 891 bp in length, respectively.
[0051] Example 2: Validation of Known Samples
[0052] Twenty purple mussels were collected from the Rizhao sea area of Shandong Province, 20 thick-shelled mussels were collected from the Zhoushan sea area of Zhejiang Province, and 20 hybrid mussels (first generation individuals of hybrids of purple mussels and thick-shelled mussels) were collected from the Rizhao mussel hatchery in Shandong Province. Using a conventional marine animal genomic DNA extraction kit, the whole genome DNA of the mussel soft tissue was extracted according to the instructions.
[0053] (1) The reaction system for PCR amplification was: ddH2O 20μL, 2 × Phanta Max Buffer 25μL, dNTPMix 1μL, upstream primer 1μL, downstream primer 1μL, Phanta Max Super-Fidelity DNA Polymerase 1μL, and template DNA 2μL.
[0054] The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 20 s, 53℃ annealing for 22 s, 72℃ extension for 65 s, 37 cycles; and a final extension at 72℃ for 6 min.
[0055] (2) The PCR amplification products of mussel genomic DNA were detected by agarose gel electrophoresis. Purple mussels had only one main band, 453 bp in length; thick-shelled mussels had only one main band, 891 bp in length; the F1 hybrids of purple and thick-shelled mussels had two main bands, 453 bp and 891 bp in length, respectively. The detection results are shown in Table 1. Electrophoresis images of some purple mussels, thick-shelled mussels, and hybrid mussels are shown below. Figure 1 As shown in the figure. The results show that the upstream and downstream primers provided by this invention can accurately identify purple mussels, thick-shelled mussels, and hybrid mussels.
[0056] Table 1. Detection results of Example 2
[0057]
[0058] Example 3: Detection of Unknown Samples
[0059] (1) Twenty mussels purchased from a shellfish farm in Qingdao, Shandong Province and twenty mussels purchased from a shellfish farm in Ningbo, Zhejiang Province were dissected and their adductor muscle, gills, mantle and other tissues were taken and frozen in liquid nitrogen.
[0060] (2) Take a small amount of the above muscle tissue and extract whole genome DNA using a conventional marine animal genomic DNA extraction kit, following the instructions.
[0061] (3) Primer synthesis is performed. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4.
[0062] (4) The mussel DNA obtained in step (2) was amplified by PCR using the primers in (3). The PCR amplification reaction system was as follows: ddH2O 20 μL, 2 × Phanta Max Buffer 25 μL, dNTP Mix 1 μL, upstream primer 1 μL, downstream primer 1 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, and template DNA 2 μL. The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 20 s, 53℃ annealing for 22 s, 72℃ extension for 65 s, 37 cycles; and a final extension at 72℃ for 6 min.
[0063] (5) The PCR amplification products from step (4) were detected by agarose gel electrophoresis, and the results are shown in Table 2. The results showed that the 20 mussel individuals from Qingdao had only one main band with a length of around 450bp, i.e., 453bp, and were therefore all identified as purple mussels. It was found that the 17 mussel individuals from Ningbo had only one main band with a length of around 900bp, i.e., 891bp, and were identified as thick-shelled mussels; 3 mussel individuals had two main bands with lengths of around 450bp and 900bp, i.e., 453bp and 891bp, and were identified as hybrid individuals of purple mussels and thick-shelled mussels. The detection results were consistent with the identification results using external morphological characteristics and the genome sequencing results. It can be seen that the upstream and downstream primers provided by this invention can accurately identify purple mussels, thick-shelled mussels, and hybrid mussels of purple mussels and thick-shelled mussels.
[0064] Table 2 Detection results of Example 3
[0065]
[0066] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A molecular marker associated with mussel species, characterized in that, The molecular markers include molecular marker 1 with a nucleotide sequence as shown in SEQ ID NO.1 and molecular marker 2 with a nucleotide sequence as shown in SEQ ID NO.2; The mussel species include purple mussels, thick-shelled mussels, and hybrid mussels of purple mussels and thick-shelled mussels; Molecular marker 1 is derived from the purple mussel; molecular marker 2 is derived from the thick-shelled mussel.
2. The application of the primer pair for amplifying the molecular marker of claim 1 in the identification of mussel species, characterized in that, The primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.4; The mussel species include purple mussels, thick-shelled mussels, and hybrid mussels of purple mussels and thick-shelled mussels.
3. A method for identifying mussel species, characterized in that, The method includes the following steps: Using the genomic DNA of the mussel to be tested as a template, PCR amplification of the template is performed using the primer pair described in claim 2, and the species of the mussel to be tested is determined using the PCR amplification results. If the primer pair can only amplify one molecular marker electrophoresis band with a nucleotide sequence as shown in SEQ ID NO.1, then the mussel to be tested is identified as a purple mussel; if the primer pair can only amplify one molecular marker electrophoresis band with a nucleotide sequence as shown in SEQ ID NO.2, then the mussel to be tested is identified as a thick-shelled mussel; if the primer pair can only amplify one molecular marker electrophoresis band with a nucleotide sequence as shown in SEQ ID NO.1 and one molecular marker electrophoresis band with a nucleotide sequence as shown in SEQ ID NO.2, then the mussel to be tested is identified as a hybrid mussel of purple mussel and thick-shelled mussel.
4. The application of the primer pair for amplifying the molecular marker of claim 1 in screening for mussels of the purple mussel, the thick-shelled mussel, or a hybrid of the purple mussel and the thick-shelled mussel, characterized in that, The primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.4.