Nanoparticles with curcumin embedded in Sanzan gum composite carrier and preparation method of nanoparticles

By encapsulating curcumin nanoparticles in a double layer of triazine and zein, the problems of low stability and low bioavailability in high-load encapsulation of curcumin were solved, achieving high encapsulation efficiency and stable nanoparticle structure.

CN121154577APending Publication Date: 2025-12-19TIANJIN AGRICULTURE COLLEGE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511344544.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-19
Publication Date
2025-12-19

AI Technical Summary

Technical Problem

Existing high-load encapsulation technologies for curcumin suffer from problems such as poor carrier encapsulation stability, easy aggregation of nanoparticles, and low bioavailability.

Method used

Curcumin nanoparticles were encapsulated in a double layer of triazine and zein. By modifying the triazine with octenyl succinic anhydride, a tight interfacial bond was formed, enhancing hydrophobicity and electrostatic repulsion, thus creating a stable nanoparticle structure.

Benefits of technology

It significantly improved the encapsulation efficiency and stability of curcumin, improved particle dispersibility, enhanced its protective effect in the gastrointestinal tract, and increased its bioavailability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121154577A_ABST
    Figure CN121154577A_ABST
Patent Text Reader

Abstract

The invention discloses a Sanzan gum composite carrier embedded curcumin nano-particle and a preparation method thereof, and the preparation method comprises the following steps: preparing a curcumin-zein solution, preparing a Sanzan gum solution, preparing an OSA modified Sanzan gum solution, preparing a curcumin-zein nano-particle dispersion liquid, and preparing the Sanzan gum composite carrier embedded curcumin nano-particle. And dropwise adding the dispersion liquid into a Sanzan gum solution or an OSA modified Sanzan gum solution, stirring to form a curcumin-zein-Sanzan gum nanoparticle dispersion liquid, and carrying out vacuum freeze drying to obtain the nanoparticles with the Sanzan gum composite carrier embedded with curcumin. Through synergistic double-layer wrapping of the Sanzan gum and the zein, the stability of the curcumin is improved, the particle dispersity is improved, the encapsulation efficiency is improved, and the double-layer structure realizes a better protection effect of the curcumin in a stomach simulation liquid and improves the bioavailability of the curcumin in an intestinal simulation liquid.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of embedding delivery of fat-soluble active substances, in particular to a curcumin-embedded nanoparticle with a triple-zan gum composite carrier and a preparation method thereof. BACKGROUND

[0002] Curcumin is a polyphenolic drug extracted from the rhizomes of the plant Curcuma longa, which has multiple biological activities. In traditional medicine, curcumin is often used to treat diseases such as ulcers, arthritis, and acne. From modern pharmacological research, curcumin has pharmacological activities such as anticancer, antioxidant, anti-inflammatory, and antibacterial, and has potential application value in the treatment of potential diseases such as tumors, metabolism, and lung cancer. Although curcumin is of great significance in maintaining human health, its bioavailability is low due to low solubility, poor absorption, and fast metabolism, and its use is limited. At present, various drug delivery systems have been developed to deliver curcumin, including encapsulating it in cyclodextrin, emulsion gel, nanoemulsion, and polymeric nanoparticle carriers to improve the bioavailability of curcumin. Among them, the delivery system of protein and polysaccharide biopolymer nanoparticles has unique advantages and application potential in drug delivery systems due to its biodegradability and good biocompatibility.

[0003] Zein is a plant protein extracted from corn. Due to its unique hydrophobicity, it is insoluble in water but soluble in high-concentration ethanol aqueous solution. It is a natural carrier material commonly used to encapsulate hydrophobic active ingredients, which can spontaneously assemble into stable nanoparticles after combining with bioactive compounds. However, the application of zein as a drug delivery carrier is easily affected by non-acidic environment, salt concentration, and high temperature, and is prone to aggregation, thereby affecting its stability in aqueous systems and the bioavailability of the loaded substance. Related studies have shown that constructing a polysaccharide coating on the surface of zein nanoparticles through electrostatic interaction can effectively improve this problem.

[0004] Triple-zan gum is a new type of microbial-derived polymer material synthesized by sphingomonas, and in 2020, the National Health Commission of China has officially approved its use in the food industry. Due to its good gelation, emulsification, and biocompatibility, triple-zan gum can be used to construct hydrogels, gel spheres, edible films, and nanoemulsions, and has significant advantages in drug controlled release. SUMMARY

[0005] The present application aims to overcome the shortcomings of the prior art and provide a triple-zan gum / zein double-layer wrapped curcumin nanoparticle and a preparation method thereof, to solve the core problems of "poor stability of single carrier wrapping, easy aggregation of nanoparticles, and low bioavailability of curcumin" in current high-loading embedding technology of curcumin.

[0006] The technical scheme adopted by the present application to solve its technical problems is: A kind of curcumin nano-particle embedded by tripartite gum composite carrier and its preparation method, comprising the following steps: Step 1, curcumin and zein are weighed and added to an aqueous ethanol solution, stirred and mixed, fully dissolved to obtain a curcumin-zein ethanol solution.

[0007] Step 2, tripartite gum is weighed and added to water under stirring, fully stirred until completely dissolved to obtain a tripartite gum solution.

[0008] Step 3, octenyl succinic anhydride (OSA) is weighed and added to anhydrous ethanol to prepare a 3% (m / v) OSA solution, stirred until completely dissolved, and stored in the dark to obtain an OSA solution; the OSA solution is added dropwise to a 0.6% (m / v) tripartite gum solution, stirred at 35°C in the dark for 1-5 h, and every 30 min, 0.5 M NaOH solution is added dropwise to adjust the pH to 8.0, and after the reaction is completed, 0.5 M HCl solution is added dropwise to adjust the pH to 4.5; add 3 times the volume of anhydrous ethanol, stir at 100 r / min, then stand for 1 h, centrifuge at 6000 r / min for 30 min, wash the precipitate with anhydrous ethanol 3 times, and vacuum freeze-dry to obtain OSA modified tripartite gum in white powder. The OSA modified tripartite gum is weighed and added to water under stirring, fully stirred until completely dissolved to obtain an OSA modified tripartite gum solution.

[0009] Step 4, under stirring, the curcumin-zein ethanol solution obtained in step 1 is added dropwise to deionized water at pH 7.0, and stirred at 900 r / min for 3 min to obtain a curcumin-zein nanoparticle dispersion.

[0010] Step 5, under stirring, the curcumin-zein nanoparticle dispersion obtained in step 4 is added dropwise to the tripartite gum solution obtained in step 2 or the OSA modified tripartite gum solution obtained in step 3, and stirred at 900 r / min for 10 min to obtain a curcumin-zein-triptolide nanoparticle dispersion.

[0011] Step 6, take the curcumin-zein-triptolide nanoparticle dispersion obtained in step 5, remove the excess ethanol by negative pressure rotary evaporation, and vacuum freeze-dry to obtain a tripartite gum composite carrier embedded curcumin nanoparticle.

[0012] In the above scheme, in step 1, the concentration of curcumin is 0.5 ~ 2.0 mg / mL, and the concentration of zein is 10 ~ 30 mg / mL.

[0013] In the above scheme, in the step 2, the concentration of the tragacanth gum is 0.05 ~ 0.15% (m / v).

[0014] In the above scheme, in the step 3, the mass ratio of the OSA to the tragacanth gum is 3 ~ 8 : 100.

[0015] In the above scheme, in the step 3, the concentration of the OSA modified tragacanth gum solution is 0.05 ~ 0.15% (m / v).

[0016] The advantages and positive effects obtained by the present application are: The OSA modified tragacanth gum has better amphiphilicity, the hydrophobic octenyl long chain and the inner layer zein hydrophobic region strengthen each other to form a tight interface combination to improve the encapsulation rate, the hydrophilic group gives the nanoparticle a stable negative charge, and the electrostatic repulsion inhibits agglomeration, and the dense outer layer after modification can also isolate light and heat to enhance the stability of curcumin; the synergistic double-layer wrapping of zein and OSA modified tragacanth gum not only significantly improves the stability of high-load curcumin, improves the particle dispersibility, and improves the encapsulation rate, and the double-layer structure realizes better protection of curcumin in the gastric simulation solution and improves the bioavailability in the intestinal simulation solution. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 Stability of the nanoparticle dispersion in a salt solution; wherein the left graph is Example 1, and the right graph is Example 3.

[0018] Figure 2 Appearance of the nanoparticle, electron microscope graph, and particle size distribution.

[0019] Figure 3 UV stability of the nanoparticle. DETAILED DESCRIPTION

[0020] The present application is further described below in conjunction with examples, which are descriptive rather than limiting, and cannot be used to limit the protection scope of the present application.

[0021] The various experimental operations involved in the specific examples are all conventional techniques in the art, and the parts not specially noted in this paper can be implemented by referring to various commonly used tool books, scientific and technical literature or related instructions, manuals, etc. before the application date of the present application.

[0022] Example 1 A kind of nanoparticle of curcumin embedded by tragacanth gum composite carrier and its preparation method is prepared according to the following method: Step 1, weigh curcumin and zein into aqueous ethanol solution, the concentration of curcumin is 0.5 mg / mL, the concentration of zein is 10 mg / mL, mix and stir, and fully dissolve to obtain curcumin-zein ethanol solution.

[0023] Step 2, under stirring conditions, the curcumin-zein ethanol solution obtained in step 1 is added dropwise into deionized water with pH 7.0, and stirring is continued at 900 r / min for 3 min to obtain curcumin-zein nanoparticle dispersion.

[0024] Step 3, take the curcumin-zein nanoparticle dispersion obtained in step 2, remove the excess ethanol by negative pressure rotary evaporation, and vacuum freeze-dry to obtain curcumin-zein nanoparticles.

[0025] It is detected that the encapsulation efficiency of curcumin is 61.7%, the particle size of the nanoparticles is 127.6 nm, the PDI is 0.20, the Zeta potential is 16.9, the retention rate of curcumin after 90°C heat treatment for 30 min is 82.4%, the retention rate of curcumin after ultraviolet irradiation treatment for 150 min is 65.8%, and the stability in NaCl solution with a concentration of 0~300 mmol / L is as shown in Figure 1 It can be seen that the curcumin-zein nanoparticles are unstable and aggregate under high salt conditions, in the in vitro simulation release test, the release rate of curcumin in the gastric simulation solution is 32.3% in 2h, and the release rate of curcumin in the intestinal simulation solution is 50.4% in 3h.

[0026] Example 2 A kind of tripartite gel composite carrier embedding curcumin nanoparticles and its preparation method, according to the following method is prepared: Step 1, weigh curcumin and zein into aqueous ethanol solution, the concentration of curcumin is 0.5 mg / mL, the concentration of zein is 20 mg / mL, mix and stir, and fully dissolve to obtain curcumin-zein ethanol solution.

[0027] Step 2, weigh tripartite gel, and add water under stirring conditions, the concentration of tripartite gel is 0.05% (m / v), fully stir until completely dissolved to obtain tripartite gel solution.

[0028] Step 3, under stirring conditions, the curcumin-zein ethanol solution obtained in step 1 is added dropwise into deionized water with pH 7.0, and stirring is continued at 900 r / min for 3 min to obtain curcumin-zein nanoparticle dispersion.

[0029] Step 4, under stirring condition, the curcumin-Zeatin nanoparticle dispersion solution obtained in step 3 was added dropwise into the trihydroxyglucoside solution obtained in step 2, and stirred at 900 r / min for 10 min to obtain a curcumin-Zeatin nanoparticle dispersion solution.

[0030] Step 5, the curcumin-Zeatin nanoparticle dispersion solution obtained in step 4 was taken, and the excess ethanol was removed by negative pressure rotary evaporation, and vacuum freeze-drying was performed to obtain a curcumin-Zeatin nanoparticle.

[0031] It was detected that the encapsulation efficiency of curcumin was 84.5%, the particle size of the nanoparticle was 153.6 nm, the PDI was 0.15, the Zeta potential was -25.0, and in the in vitro simulation release test, the release rate of curcumin in the gastric simulation fluid was 12.5% in 2 h, and the release rate of curcumin in the intestinal simulation fluid was 61.9% in 3 h.

[0032] Example 3 A curcumin-embedded nanoparticle of a Zeatin composite carrier and a preparation method thereof are prepared according to the following method: Step 1, curcumin and zein were weighed and added into an ethanol aqueous solution, the concentration of curcumin was 1.0 mg / mL, and the concentration of zein was 25 mg / mL, and they were stirred and mixed to be fully dissolved to obtain a curcumin-zein ethanol solution.

[0033] Step 2, trihydroxyglucoside was weighed and added into water under stirring condition, the concentration of trihydroxyglucoside was 0.1% (m / v), and it was fully stirred until completely dissolved to obtain a trihydroxyglucoside solution.

[0034] Step 3, under stirring condition, the curcumin-zein ethanol solution obtained in step 1 was added dropwise into deionized water with pH 7.0, and stirred at 900 r / min for 3 min to obtain a curcumin-zein nanoparticle dispersion solution.

[0035] Step 4, under stirring condition, the curcumin-zein nanoparticle dispersion solution obtained in step 3 was added dropwise into the trihydroxyglucoside solution obtained in step 2, and stirred at 900 r / min for 10 min to obtain a curcumin-zein-trihydroxyglucoside nanoparticle dispersion solution.

[0036] Step 5, the curcumin-zein-trihydroxyglucoside nanoparticle dispersion solution obtained in step 4 was taken, and the excess ethanol was removed by negative pressure rotary evaporation, and vacuum freeze-drying was performed to obtain a curcumin-zein-trihydroxyglucoside nanoparticle.

[0037] It was detected that the encapsulation efficiency of curcumin was 94.0%, the particle size of the nanoparticle was 149.5 nm, Figure 2), PDI is 0.12, Zeta potential is -31.6, the retention rate of curcumin is 89.0% after heat treatment at 90℃ for 30 min, and the retention rate of curcumin is 70.9% after ultraviolet irradiation treatment for 150 min Figure 3 ), the stability in the NaCl solution with the concentration of 0~300 mmol / L is shown as Figure 1 indicated, the curcumin-corn protein zein-traganth nanometer particles are stable and do not produce aggregation under high salt conditions, in the in vitro simulation release test, the release rate of curcumin in the gastric simulation solution is 7.8% in 2h, and the release rate of curcumin in the intestinal simulation solution is 82.4% in 3h. It can be seen that the encapsulation rate of the curcumin-corn protein zein-traganth nanometer particles is improved, the stability to heat, ultraviolet and salt is improved, curcumin has better protection effect in the gastric simulation solution, and the bioavailability in the intestinal simulation solution is improved.

[0038] Example 4 A kind of traganth composite carrier embedding curcumin nanometer particles and its preparation method, according to the following method is prepared: Step 1, curcumin and corn protein zein are weighed and added to an aqueous ethanol solution, the concentration of curcumin is 1.2 mg / mL, and the concentration of corn protein zein is 30 mg / mL, mixed and dissolved, to obtain a curcumin-corn protein zein ethanol solution.

[0039] Step 2, traganth is weighed and added to water under stirring, the concentration of traganth is 0.15% (m / v), and fully stirred until completely dissolved, to obtain a traganth solution.

[0040] Step 3, under stirring, the curcumin-corn protein zein ethanol solution obtained in step 1 is added dropwise to deionized water with pH 7.0, and stirring is continued at 900 r / min for 3 min, to obtain a curcumin-corn protein zein nanometer particle dispersion.

[0041] Step 4, under stirring, the curcumin-corn protein zein nanometer particle dispersion obtained in step 3 is added dropwise to the traganth solution obtained in step 2, and stirring is continued at 900 r / min for 10 min, to obtain a curcumin-corn protein zein-traganth nanometer particle dispersion.

[0042] Step 5, the curcumin-corn protein zein-traganth nanometer particle dispersion obtained in step 4 is taken, and excess ethanol is removed by negative pressure rotary evaporation, and vacuum freeze-drying is performed to obtain curcumin-corn protein zein-traganth nanometer particles.

[0043] The encapsulation efficiency of curcumin is 93.6%, the particle size of the nanoparticles is 159.1 nm, the PDI is 0.17, the Zeta potential is -34.2, and in the in vitro simulation release test, the release rate of curcumin in the gastric simulation fluid is 7.5% in 2 hours, and the release rate of curcumin in the intestinal simulation fluid is 80.5% in 3 hours.

[0044] Example 5 A kind of triazine glue composite carrier embedding curcumin nanoparticles and its preparation method, according to the following method is prepared: Step 1, curcumin and zein are weighed and added to an aqueous ethanol solution, the concentration of curcumin is 1.5 mg / mL, and the concentration of zein is 25 mg / mL, the mixture is stirred and dissolved, and a curcumin-zein ethanol solution is obtained.

[0045] Step 2, weigh the octenyl succinic anhydride (OSA) and add it to anhydrous ethanol to prepare a 3% (m / v) OSA solution, stir until completely dissolved, and store in the dark to obtain the OSA solution; drop the OSA solution into the 0.6% (m / v) triazine glue solution, the mass ratio of OSA to triazine glue is 3:100. Stir at 35°C in the dark for 1 hour, add 0.5M NaOH solution every 30 minutes to adjust the pH to 8.0, after the reaction is completed, add 0.5M HCl solution to adjust the pH to 4.5; add 3 times the volume of anhydrous ethanol, stir at 100 r / min, then stand for 1 hour, centrifuge at 6000 r / min for 30 minutes, wash the precipitate with anhydrous ethanol 3 times, and vacuum freeze-dry to obtain OSA modified triazine glue in white powder. Weigh the OSA modified triazine glue, add water under stirring conditions, the concentration of OSA modified triazine glue is 0.07% (m / v), stir thoroughly until completely dissolved, and obtain the OSA modified triazine glue solution.

[0046] Step 3, under stirring conditions, the curcumin-zein ethanol solution obtained in step 1 is added to deionized water with pH 7.0, and stirring is continued at 900 r / min for 3 minutes to obtain a curcumin-zein nanoparticle dispersion.

[0047] Step 4, under stirring conditions, the curcumin-zein nanoparticle dispersion obtained in step 3 is added to the OSA modified triazine glue solution obtained in step 2, and stirring is continued at 900 r / min for 10 minutes to obtain a curcumin-zein-triazine glue nanoparticle dispersion.

[0048] Step 5, take the curcumin-zein-triazine glue nanoparticle dispersion obtained in step 4, remove the excess ethanol by negative pressure rotary evaporation, and vacuum freeze-dry to obtain curcumin-zein-triazine glue nanoparticles.

[0049] The encapsulation efficiency of curcumin was 81.7%, the particle size of the nanoparticles was 152.6 nm, the PDI was 0.19, the Zeta potential was -42.3, and in the in vitro simulation release test, the release rate of curcumin in the gastric simulation fluid was 9.0% in 2 h, and the release rate of curcumin in the intestinal simulation fluid was 75.2% in 3 h.

[0050] Example 6 A kind of triazine glue composite carrier embedding curcumin nanoparticles and its preparation method, according to the following method is prepared: Step 1, curcumin and zein are weighed and added to an aqueous ethanol solution, the concentration of curcumin is 2.0 mg / mL, and the concentration of zein is 30 mg / mL, the mixture is stirred and dissolved, and a curcumin-zein ethanol solution is obtained.

[0051] Step 2, weigh octenyl succinic anhydride (OSA) and add it to anhydrous ethanol to prepare a 3% (m / v) OSA solution, stir until completely dissolved, and store in the dark to obtain an OSA solution; drop the OSA solution into a 0.6% (m / v) triazine glue solution, the mass ratio of OSA to triazine glue is 5:100. Stir at 35°C in the dark for 2 h, add 0.5 M NaOH solution every 30 min to adjust the pH to 8.0, after the reaction is completed, add 0.5 M HCl solution to adjust the pH to 4.5; add 3 times the volume of anhydrous ethanol, stir at 100 r / min, then stand for 1 h, centrifuge at 6000 r / min for 30 min, wash the precipitate with anhydrous ethanol 3 times, and vacuum freeze-dry to obtain OSA-modified triazine glue in white powder. Weigh the OSA-modified triazine glue, add water under stirring conditions, the concentration of OSA-modified triazine glue is 0.1% (m / v), stir thoroughly until completely dissolved, and obtain an OSA-modified triazine glue solution.

[0052] Step 3, under stirring conditions, drop the curcumin-zein ethanol solution obtained in step 1 into deionized water with pH 7.0, and continuously stir at 900 r / min for 3 min to obtain a curcumin-zein nanoparticle dispersion.

[0053] Step 4, under stirring conditions, drop the curcumin-zein nanoparticle dispersion obtained in step 3 into the OSA-modified triazine glue solution obtained in step 2, and continuously stir at 900 r / min for 10 min to obtain a curcumin-zein-triazine glue nanoparticle dispersion.

[0054] Step 5, take the curcumin-zein-triazine glue nanoparticle dispersion obtained in step 4, remove the excess ethanol by negative pressure rotary evaporation, and vacuum freeze-dry to obtain curcumin-zein-triazine glue nanoparticles.

[0055] The encapsulation efficiency of curcumin was 92.6%, the particle size of the nanoparticles was 133.9 nm, the PDI was 0.15, the Zeta potential was -57.3, the retention rate of curcumin was 91.2% after 90°C heat treatment for 30 min, the retention rate of curcumin was 81.0% after ultraviolet irradiation treatment for 150 min, the nanoparticles were stable and did not aggregate in a NaCl solution with a concentration of 0-300 mmol / L, in the in vitro simulation release test, the release rate of curcumin in the gastric simulation fluid was 5.5% in 2 h, and the release rate of curcumin in the intestinal simulation fluid was 82.7% in 3 h. It can be seen that the Zeta potential of the curcumin-corn alcohol soluble protein-OSA modified tara gum nanoparticles is high, the high encapsulation efficiency can be achieved under the condition of high loading, the stability to heat, ultraviolet and salt is improved, curcumin has better protection effect in the gastric simulation fluid, and the bioavailability in the intestinal simulation fluid is improved.

[0056] Example 7 A kind of tara gum composite carrier embedding curcumin nanoparticles and its preparation method, according to the following method is prepared: Step 1, curcumin and corn alcohol soluble protein are weighed and added to an aqueous ethanol solution, the concentration of curcumin is 2.0 mg / mL, and the concentration of corn alcohol soluble protein is 30 mg / mL, the mixture is stirred and dissolved, and a curcumin-corn alcohol soluble protein ethanol solution is obtained.

[0057] Step 2, octenyl succinic anhydride (OSA) is weighed and added to anhydrous ethanol to prepare a 3% (m / v) OSA solution, which is stirred until completely dissolved and stored in the dark, obtaining an OSA solution; the OSA solution is added dropwise to a 0.6% (m / v) tara gum solution, and the mass ratio of OSA to tara gum is 8:100. Stir at 35°C in the dark for 5 h, add 0.5 M NaOH solution every 30 min to adjust the pH to 8.0, and add 0.5 M HCl solution after the reaction to adjust the pH to 4.5; add 3 times the volume of anhydrous ethanol, stir at 100 r / min, then stand for 1 h, centrifuge at 6000 r / min for 30 min, wash the precipitate with anhydrous ethanol 3 times, and vacuum freeze-dry to obtain OSA modified tara gum in white powder. Weigh the OSA modified tara gum and add water under stirring, the concentration of OSA modified tara gum is 0.15% (m / v), and the OSA modified tara gum solution is obtained by stirring until completely dissolved.

[0058] Step 3, under stirring, the curcumin-corn alcohol soluble protein ethanol solution obtained in step 1 is added dropwise to deionized water with pH 7.0, and stirring is continued at 900 r / min for 3 min to obtain a curcumin-corn alcohol soluble protein nanoparticle dispersion.

[0059] Step 4, under stirring condition, the curcumin-Zein nanoparticle dispersion obtained in step 3 was added dropwise into the OSA modified tara gum solution obtained in step 2, and stirred at 900 r / min for 10 min to obtain curcumin-Zein-tara gum nanoparticle dispersion.

[0060] Step 5, the curcumin-Zein-tara gum nanoparticle dispersion obtained in step 4 was taken, and the excess ethanol was removed by negative pressure rotary evaporation, and vacuum freeze-drying to obtain curcumin-Zein-tara gum nanoparticles.

[0061] It was detected that the encapsulation efficiency of curcumin was 90.2%, the particle size of the nanoparticles was 180.7 nm, the PDI was 0.31, the Zeta potential was -50.9, and in the in vitro simulation release test, the release rate of curcumin in the gastric simulation fluid was 8.3% in 2h, and the release rate of curcumin in the intestinal simulation fluid was 89.8% in 3h.

[0062] Example 8 Detection method of curcumin-embedded nanoparticles of tara gum composite carrier.

[0063] The curcumin-embedded nanoparticles of tara gum composite carrier in Example 3 were taken, ground and crushed, 9 times the mass of deionized water was added, vortex mixed uniformly, and placed at 4℃ for 8h. After centrifugation at 3000r / min for 15min, the supernatant was taken, and the genomic DNA was extracted using a bacterial genomic DNA extraction kit according to the instructions. The extracted DNA was used as a template, 5'TAAGGTCCCCAAGTCACGTC 3' was used as an upstream primer, and 5'TCTCTCAAGCGCCTTGGTAT 3' was used as a downstream primer for PCR amplification. The PCR amplification system was: 10-30ng / uL of template DNA 1μL, 10 μM of upstream primer and downstream primer each 0.5 μL, 10 mM of dNTP 0.5 μL, 10 x buffer 2.5 μL, 5 U / μL of Taq enzyme 0.5 μL, and ultrapure water to 25 μL. The PCR reaction conditions were: 95℃ pre-denaturation for 5min; 94℃ for 45s, 59℃ for 45s, 72℃ for 1min, 30 cycles; 72℃ extension for 10min. The PCR amplification band detected by electrophoresis was about 560bp, the PCR amplification product was sequenced, the sequence near the primer affecting the accuracy of sequencing was removed, and the specific molecular marker SEQ ID NO.1 representing tara gum was obtained.

[0064] 1 CCTTTAAAGA AAGCGTAACA GCTCACTGGT CTAAACAAGA GATCCTGCGG CGAAGATGTA 61 ACGGGGCTCA AGACGTGCAC CGAAGCTTAG GGTGTGGATT TGTCCACGCG GTAGCGGAGC 121 GTTCCGTAAG CCGGTGAAGC GGTCTGGTAA TGGACCGTGG AGGTATCGGA AGTGCGAATG 181 CAGACATGAG TAGCGATAAA GAGGGTGAGA TGCCCTCTCG CCGAAAGCCC AAGGGTTCCT 241 GCGCAAGGCT AATCCGCGCA GGGTGAGTCG GCCCCTAAGA CGAGCCCGAA GGGGGTAGTC 301 GATGGGAATC AGGTTAATAT TCCTGAACCT GGTGGTGTGT GACGGATCTC GTGTGTTGTC 361 ATCCCTTAAC GGATTGGGAT GGCCTCGAAG AGGTTC Example 9 Method for detecting curcumin nanoparticles embedded in tripterygium wilfordii hook complex carrier.

[0065] The curcumin nanoparticles embedded in tripterygium wilfordii hook complex carrier in Example 6 were ground and pulverized, 9 times the mass of deionized water was added, vortex mixed uniformly, and placed at 4°C for 8h. After centrifugation at 3000r / min for 15min, the supernatant was taken, and the genomic DNA was extracted using a bacterial genomic DNA extraction kit according to the instructions. The extracted DNA was used as a template, 5'TCAGGCCGTGTGGGGAA 3' was used as an upstream primer, and 5'GATCCGATCCAGCTTTCGGG 3' was used as a downstream primer for PCR amplification. The PCR amplification system was: 10-30ng / uL of template DNA 1μL, 10 μM of upstream primer and downstream primer each 0.5 μL, 10mM of dNTP 1.0μL, 10×buffer 2.5μL, 5U / μL of Platinum Taq DNA polymerase 0.5μL, and ultra-pure water to 25μL. The PCR reaction conditions were: 95°C pre-denaturation for 5min; 94°C for 45s, 62°C for 45s, 72°C for 1min, 30 cycles; 72°C extension for 10min. The PCR amplification band detected by electrophoresis was about 950bp, the PCR amplification product was sequenced, the sequence near the primer affecting the accuracy of sequencing was removed, and the specific molecular marker SEQ ID NO.2 representing tripterygium wilfordii hook was obtained.

[0066] 1 ACGGCAGGAC CTCGCCTTGC AGCAGCCGCG TCGCCTGGCG ACGGTCGAGC GCGCGCGAGA 61 AGAGGAAGCC TTGGCCATAT TTGCAGCCAT AGCGCTGCAG CAGCCGGCAC TGCGCCTCCG 121 TCTCGATTCC CTCGGCGACG ACCCGCAGCT TGAGACCGTC GGCAATCGCG ATCAGCCCCT 181 GCACGATCGC AGCGCTGCCC GCATCGGTGC CGAGCTGCTG GACGAAGGAG CGGTCGATCT 241 TGATGATGTC CACCGGCACC GAGAGCAGGT GCGTCAGCGA GGCATAGCCG GTACCGAAAT 301 CGTCGAGCGC GATGCGGAGC CCGCGCGCCT GCAATCCTTC GAGAACGCGG CGCACGGTAT 361 CGGCGCGCCG GTCCATATGG ACCGTCTCGG TCACTTCGAC GACCAGATGG CCGAGCGGCA 421 CGCGGGCATG CTCGAACGTG TCGGCCAGCG TGCGTTCGAG CAGGCCGCCG CCATGGATGT 481 CGGCGGAGCC GACGTTGATC GAGATCTGCG GATCGGCGAT GCCCAGCCGC ATCCAGTGCG 541 CGATGTCGCC GGCGACGATC CTCAGCATCC GTCGCGTGAG TTCCGGGGCG ATGCGCGGGT 601 GCGACATCGC TTGGTGGAAG GCGGCGGCCG GCAGCACTTC GCCCGTGGAC GTCGTCAGGC 661 GGCAGAGCGC CTCGAACGAC GTTACCGCCC ATGTCTCCAG TTCGACGACC GGCTGATAAT 721 AGGCGTCGAT ACGATCTTCG TGCAGTGCGC GCTCAAGATC GTGCAACGCG TCGGGATGGC 781 TCGCCACCGC ATTGCCCAGG CTCGCGGAAT AAGCGAGGTG GCCGCCGCGG TGCGACTGCT 841 TGGCGTGCTG CAGCGCATTG GTGGCATGTT CGAACAGAAT GTCGGACGTC TTCGCCGGAT 901 CGCTGATCGC AAAGCCGATG While the embodiments of the application have been disclosed for illustrative purposes, those skilled in the art can appreciate that various alternatives, variations and modifications are possible without departing from the spirit and scope of the application and the appended claims, and therefore the scope of the application is not limited to what is disclosed in the embodiments.

Claims

1. A method for preparing nanoparticles containing curcumin encapsulated on a triac-gel composite carrier, characterized in that, Includes the following steps: Step 1: Weigh out curcumin and zein, add them to an ethanol-water solution, stir and mix until fully dissolved to obtain a curcumin-zein ethanol solution; Step 2: Weigh out the Sanzan gum, add water while stirring, and stir thoroughly until completely dissolved to obtain a Sanzan gum solution; Step 3: Weigh octenyl succinic anhydride (OSA), add it to anhydrous ethanol to prepare a 3% (m / v) OSA solution, stir until completely dissolved, and store in the dark to obtain an OSA solution; add the OSA solution dropwise to a 0.6% (m / v) triazine gum solution, stir at 35℃ in the dark for 1-5 h, add 0.5M NaOH solution every 30 min to adjust the pH to 8.0, and after the reaction is complete, add 0.5M HCl solution to adjust the pH to 4.5; add 3 times the volume of anhydrous ethanol, stir at 100 r / min, let stand for 1 h, centrifuge at 6000 r / min for 30 min, wash the precipitate 3 times with anhydrous ethanol, and freeze-dry under vacuum to obtain a white powder of OSA-modified triazine gum. Weigh the OSA-modified triazine gum, add water under stirring, and stir thoroughly until completely dissolved to obtain an OSA-modified triazine gum solution; Step 4: Under stirring conditions, the curcumin-zein ethanol solution obtained in Step 1 is added dropwise to deionized water at pH 7.0, and the mixture is stirred continuously at 900 r / min for 3 min to obtain a curcumin-zein nanoparticle dispersion; Step 5: Under stirring conditions, the curcumin-zein nanoparticle dispersion obtained in Step 4 is added dropwise to the triazine solution obtained in Step 2 or the OSA-modified triazine solution obtained in Step 3, and stirred continuously at 900 r / min for 10 min to obtain the curcumin-zein-triazine nanoparticle dispersion; Step 6: Take the curcumin-zein-triazine nanoparticle dispersion obtained in Step 5, remove excess ethanol by negative pressure rotary evaporation, and freeze-dry under vacuum to obtain curcumin nanoparticles embedded in the triazine composite carrier.

2. The preparation method according to claim 1, characterized in that, In step 1, the concentration of curcumin is 0.5 ~ 2.0 mg / mL, and the concentration of zein is 10 ~ 30 mg / mL.

3. The preparation method according to claim 1, characterized in that, In step 2, the concentration of the triazine gel is 0.05~0.15% (m / v).

4. The preparation method according to claim 1, characterized in that, In step 3, the mass ratio of OSA to triazine is 3~8:100, and the concentration of the OSA-modified triazine solution is 0.05~0.15% (m / v).

5. The nanoparticles containing curcumin encapsulated in the triac-gel composite carrier as described in claim 1, characterized in that: The molecular marker of the triazine is SEQ ID NO.1 or SEQ ID NO.

2.

6. The application of the nanoparticles containing curcumin encapsulated in the triac-gel composite carrier obtained by the preparation method according to any one of claims 1 to 4.