A lac2 gene related to poplar rooting, a molecular marker and application thereof
By detecting a 154bp insertion variation in the promoter region of the poplar LAC2 gene as a molecular marker, the unresolved issue of differences in poplar rooting ability was addressed. This enabled efficient screening and regulation of poplar rooting ability, enhanced the rooting ability of white poplar, solved the difficulties in hardwood cutting propagation of white poplar, and promoted the popularization and production practice of poplar varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING FORESTRY UNIVERSITY
- Filing Date
- 2025-09-08
- Publication Date
- 2026-04-10
AI Technical Summary
The lack of functional analysis of poplar rooting-related genes and structural variations (SVs) in existing technologies leads to unclear understanding of the genes and causal variations that differentiate poplar rooting ability, affecting the success rate of poplar cuttings, especially making hardwood cuttings of the poplar species difficult, thus hindering variety promotion and production practices.
Genome-wide association analysis revealed a 154bp insertion structural variation in the promoter region of the LAC2 gene, which was used as a molecular marker. Primer sets SV-F and SV-R were designed to detect the rooting ability of poplar trees. The rooting ability of poplar trees was regulated by overexpression or knockout of the LAC2 gene. Overexpression vectors and gene knockout recombinant vectors were constructed to improve the rooting ability of poplar trees.
This technology enables accurate and efficient screening of superior germplasm in the early stages of poplar growth, significantly enhances rooting ability, solves the problem of difficult hardwood cutting propagation of poplar, shortens the breeding cycle, and promotes variety dissemination and production practices.
Smart Images

Figure CN121160745B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, specifically relating to a method related to poplar rooting. LAC2 Genes, molecular markers and their applications. Background Technology
[0002] Poplar, an important fast-growing timber species in northern my country, relies heavily on rooting for its survival rate and resilience. Rooting from cuttings is a crucial process of adventitious root regeneration based on a plant's regenerative capacity, and a key factor in successful tree propagation. Poplars are categorized into several types, including Chinese poplar, white poplar, black poplar, desert poplar, and large-leaved poplar. Among these, the white poplar is particularly difficult to propagate from hardwood cuttings, severely hindering variety promotion and production practices. Furthermore, the genes and causal variations influencing rooting differences among species remain unclear.
[0003] In recent years, structural variation (SV) has become an important entry point for understanding differences between species due to its significant impact on gene expression regulation and phenotypic diversity. Structural variation involves large chromosomal segments (≥50 bp) of deletion, duplication, inversion, and translocation, and can simultaneously affect multiple genes or regulatory elements, leading to changes in gene expression, protein structure, or chromosomal rearrangements. Its effects on complex traits are often more significant and diverse. Related studies have shown that adventitious root formation requires the coordination and dynamic regulation of hormone crosstalk and transcription factors (TFs). Differences in rooting ability within natural poplar populations indicate a complex molecular mechanism within their genetic regulatory network.
[0004] Current technologies lack functional analysis of poplar rooting-related genes and SVs. Therefore, it is necessary to develop genes and key SV molecular markers that can affect rooting ability, determine the genetic effects of key SV molecular markers on poplar cutting rooting, clarify the regulatory molecular mechanism of poplar rooting ability, efficiently and accurately screen superior poplar germplasm with strong rooting ability, and improve poplar species that are difficult to root. Summary of the Invention
[0005] To overcome the above problems, the inventors, based on a genome-wide association analysis strategy and relying on poplar varietal populations, detected a SV locus at the whole genome level that is significantly associated with rooting. This SV locus is a 154bp insertion structural variation located at... LAC2 The gene promoter region. Using this inserted SV fragment as a molecular marker to detect poplar rooting ability, the strength of poplar rooting ability can be determined, enabling accurate and efficient screening of superior plants with high survival rates in the early stages of poplar growth, effectively shortening the breeding cycle, providing theoretical support for molecular design breeding of poplar rooting ability, and further demonstrating its effectiveness through overexpression in poplar plants. LAC2 The gene can significantly enhance the rooting ability of poplar trees, which is of great significance for the selection of superior poplar plants and the innovation of poplar germplasm resources, thus completing this invention.
[0006] Specifically, the present application aims to provide the following aspects:
[0007] In a first aspect, a gene related to the rooting ability of poplar is provided, and the gene is LAC2 a gene whose coding region has the nucleotide sequence shown in SEQ ID NO. 2.
[0008] In a second aspect, a SV molecular marker related to the rooting ability of poplar is provided, and the SV molecular marker is located in the upstream promoter region of the poplar gene LAC2, and the upstream promoter region sequence of the gene LAC2 is shown in SEQ ID NO. 4.
[0009] In a third aspect, a primer set for detecting the SV molecular marker of the second aspect is provided, and the primers of the primer set are SV-F and SV-R, and the nucleotide sequences thereof are shown in SEQ ID NO. 6 and SEQ ID NO. 7, respectively.
[0010] In a fourth aspect, the SV molecular marker related to the rooting ability of poplar of the second aspect is applied to the detection and / or regulation of the rooting ability of poplar.
[0011] In a fifth aspect, a method for genetically improving poplar is provided, and the genetic improvement is to improve the rooting ability of poplar,
[0012] and the method comprises the step of subculturing and selecting poplar individuals with the SV molecular marker of the second aspect and eliminating poplar individuals without the molecular marker.
[0013] The present application has the following beneficial effects:
[0014] (1) The SV molecular marker related to the rooting ability of poplar provided by the present application is located in the upstream promoter region of the poplar LAC2 gene, positively regulates the rooting process of poplar, and by determining the molecular marker of the test plant, the rooting ability of poplar can be accurately judged, so that high-survival-rate superior plants can be accurately and efficiently screened in the early growth stage of poplar, and the breeding cycle is significantly shortened;
[0015] (2) The gene related to the rooting ability of poplar provided by the present application LAC2 can regulate the rooting ability of poplar by overexpression or knockout in poplar plants, wherein LAC2 the gene overexpression strain can significantly enhance the rooting ability of poplar, and is of great significance for breeding superior poplar plants and poplar germplasm innovation;
[0016] (3) The primer pairs for detecting molecular markers provided by the present invention can be effectively used for molecular marker-assisted breeding, thereby enabling the screening of superior tree species with strong rooting ability in a short time, at low cost and with high accuracy;
[0017] (4) The application of the SV molecular marker provided by this invention in detecting and / or regulating the rooting ability of poplar trees, by overexpressing the SV molecular marker-regulated in poplar plants. LAC2 Genes were used to enhance the rooting ability of poplar trees, thus effectively solving the problem of difficult hardwood cutting propagation of poplar trees in existing technologies, and promoting the popularization and production practice of poplar varieties. Attached Figure Description
[0018] Figure 1 The SV-GWAS identification results in Example 1 are shown, with the arrows indicating the most significant SVs identified. Figure 2 The most prominent SV in Example 1 is shown. LAC2 Location of the gene promoter region; Figure 3 The verification electrophoresis diagram of candidate individuals SV in Example 2 is shown; Figure 4 The following image shows the fluorescence signal results of transient transcription of SV in Example 3; Figure 5 The quantitative analysis results of the relative fluorescence activity of transient SV transcription in Example 3 are shown; Figure 6 The RT-qPCR detection in Example 7 is shown. LAC2 Transcriptional levels in overexpressing plants; error bars represent standard deviation. Figure 7 This illustrates the DNA editing method for detecting gene knockout in Example 7; Figure 8 Example 8 is shown LAC2 Rooting phenotypes of overexpressing plants, wild-type plants, and gene knockout plants. Detailed Implementation
[0019] The present invention will be further described in detail below through preferred embodiments and examples. Through these descriptions, the features and advantages of the present invention will become clearer and more apparent.
[0020] The term “exemplary” as used herein means “serving as an example, embodiment, or illustration.” Any embodiment illustrated herein as “exemplary” is not necessarily to be construed as superior to or better than other embodiments.
[0021] In a first aspect, the present invention provides a gene related to the rooting ability of poplar trees. LAC2 Its nucleotide sequence is shown in SEQ ID NO.1, and its coding region sequence is shown in SEQ ID NO.2.
[0022] Among them, genes LAC2(LACCASE2) belongs to the laccase gene family and is a multi-copper oxidase that is widely involved in the biosynthesis of lignin and the modification of plant cell walls.
[0023] Preferably, the gene LAC2 The amino acid sequence of the encoded protein is shown in SEQ ID NO.3.
[0024] More preferably, the poplar is a white poplar, and more preferably an 84k poplar.
[0025] Among them, the 84k poplar refers to both silver poplar and glandular poplar (silver poplar × glandular poplar). Populus alba × Populus glandulosa The asexual varieties produced by hybridization belong to the superior species of poplar. They are often selected as ideal models for genetic transformation because of their easy rooting, rapid growth, excellent wood quality and wide adaptability. At the same time, their transformation conditions are easier to standardize.
[0026] In this invention, the poplar's rooting ability specifically refers to the rooting ability of the poplar's adventitious roots.
[0027] Preferably, the rooting ability is the root length.
[0028] A second aspect of the invention provides an SV molecular marker associated with the rooting ability of poplar trees, which is located in the poplar gene. LAC2 Upstream startup sub-region,
[0029] The poplar gene LAC2 The sequence of the upstream promoter region is shown in SEQ ID NO.4, and the SV molecular marker is located at position 208 of the sequence shown in SEQ ID NO.4.
[0030] Preferably, the SV molecule is a 154bp structural variation at position 208 of the sequence shown in SEQ ID NO.4, and its sequence is shown in SEQ ID NO.5.
[0031] Among them, the SV can significantly activate genes. LAC2 Transcription, regulation LAC2 The expression.
[0032] In this invention, when poplar genes LAC2 When the SV molecular marker is present at position 208 of the upstream promoter region, poplar trees exhibit strong rooting ability; when the poplar gene... LAC2 When the SV molecular marker is missing at position 208 of the upstream promoter region, the rooting ability of poplar trees is weak.
[0033] In a preferred embodiment, the SV molecular marker related to the rooting ability of poplar is obtained by a method comprising the following steps:
[0034] Using GEMMA (v0.98.5) software, SV-GWAS analysis is performed on 59,105 SVs of high confidence and the cuttage rooting and non-rooting phenotype data of 140 poplar variety populations at the whole genome level, and population structure and kinship matrix are added to screen 175 significant SV sites, wherein one significantly associated site is annotated to the promoter region of the gene LAC2 p =2.39E-13), specifically, an insertion type structural variation with a size of 154 bp located at the 208th bp of the promoter region of the gene LAC2 The nucleotide sequence is shown in SEQ ID NO. 5.
[0035] Further, after obtaining the significantly associated SV site, its function is verified, that is, the genomic DNA of several individuals randomly selected from the poplar variety population germplasm resource library planted in Guan County, Shandong is extracted, PCR amplification and electrophoresis detection are performed, and the rooting ability is evaluated.
[0036] After verification, it is found that the individuals with SVs all root by hardwood cutting and are P. alba; the individuals without SVs all do not root by hardwood cutting and are P. alba.
[0037] That is, the SV molecular marker can be amplified in the poplar individuals rooting by hardwood cutting, indicating that the SV is retained in the poplar with strong rooting ability; the SV molecular marker cannot be amplified in the poplar individuals not rooting by hardwood cutting, indicating that the SV is deleted in the poplar with weak rooting ability.
[0038] Further, in order to clarify whether the insertion variation of the promoter of the gene LAC2 in the present application affects the promoter activity, verification is carried out by using a dual luciferase experiment, and the results show that the SV described in the present application can significantly activate the transcription of the gene LAC2 , positively regulates the expression of LAC2 .
[0039] In a third aspect of the present application, a primer set for detecting the SV molecular marker of the second aspect is provided, and the primers of the primer set are SV-F and SV-R, and the nucleotide sequences thereof are shown in SEQ ID NO. 6 and SEQ ID NO. 7, respectively.
[0040] Based on the primer set, a detection reagent or kit containing the primer set is provided.
[0041] In this invention, the primer set is designed based on the upstream and downstream sequences of the SV molecular marker position, taking into account various principles of primer design.
[0042] A fourth aspect of the present invention provides the application of the SV molecular markers described in the second aspect in detecting and / or regulating the rooting ability of poplar trees.
[0043] Preferably, the poplar is a white poplar, and more preferably an 84k poplar.
[0044] In a preferred embodiment, detecting the rooting ability of poplar trees using SV molecular markers includes the following steps:
[0045] Step 1: Perform PCR amplification on the genomic DNA of poplar trees.
[0046] Preferably, the primers used for PCR amplification are SV-F and SV-R, whose nucleotide sequences are shown in SEQ ID NO.6 and SEQ ID NO.7, respectively.
[0047] Step 2: Electrophoretic identification of the amplification products.
[0048] Preferably, the presence of the SV molecular marker in the amplification product is determined. If the SV molecular marker is present, the poplar has a strong rooting ability; if the SV molecular marker is not present, the poplar has a weak rooting ability.
[0049] In a preferred embodiment, the products amplified using primers SV-F and SV-R are detected by electrophoresis: when only a 300bp band is obtained, it is determined that poplar has SV molecular markers and strong rooting ability; when only a 146bp band is obtained, it is determined that poplar does not have SV molecular markers and weak rooting ability.
[0050] Preferably, the 300bp product obtained by amplification has the sequence shown in SEQ ID NO.8; the 146bp product obtained by amplification has the sequence shown in SEQ ID NO.9.
[0051] In a preferred embodiment, regulating the rooting ability of poplar trees using SV molecular markers includes the following steps: [The text abruptly shifts to a different topic] ...in poplar plants, [the text abruptly shifts again] ...regulated by SV molecular markers... LAC2 Genes are overexpressed or knocked out.
[0052] Preferably, by overexpressing in poplar plants LAC2 Genes are used to enhance the rooting ability of poplar trees by knocking out [a specific gene] in the poplar plant. LAC2 Genes are used to weaken the rooting ability of poplar trees.
[0053] More preferably, by overexpressing in poplar plants LAC2 Genes are used to enhance the rooting ability of poplar trees.
[0054] The present inventors have found through extensive research that overexpression of the LAC2 gene in a poplar plant can effectively enhance the rooting ability of the poplar, and thus, it is preferred to enhance the rooting ability of the poplar by overexpressing the LAC2 gene in a poplar plant, thereby effectively solving the problem of difficulty in cutting of hard branches of the poplar in the prior art, and promoting the popularization of varieties and production practice.
[0055] In a preferred embodiment, overexpression of the LAC2 gene in a poplar plant comprises the following steps:
[0056] First, an overexpression vector of the LAC2 gene is constructed, and is introduced into Agrobacterium to obtain a LAC2 gene overexpression positive bacteria.
[0057] Preferably, the overexpression vector of the LAC2 gene is obtained by constructing the CDS sequence of the LAC2 gene on a pROKII-GFP vector, and the CDS sequence of the LAC2 gene is shown as SEQ ID NO. 2.
[0058] The pROKII-GFP vector is 13618 bp in total, contains a 35S strong promoter (CaMV35S), and is double digested by XbaI and KpnI enzyme digestion sites.
[0059] Secondly, the overexpression positive bacteria are used to infect poplar materials, and transgenic culture is performed to obtain overexpression positive plants.
[0060] In the present application, the leaf disc method is preferably used to infect the poplar materials, and the poplar materials are preferably 84k poplar.
[0061] Preferably, the identification of the overexpression positive plants comprises DNA level identification and transcription level identification.
[0062] More preferably, the DNA level identification is PCR amplification reaction, and the transcription level identification is achieved by RT-qPCR reaction.
[0063] The primers of the RT-qPCR reaction are LAC2-qPCR-F and LAC2-qPCR-R, and the nucleotide sequences thereof are shown as SEQ ID NO. 10 and SEQ ID NO. 11, respectively.
[0064] The reaction procedure of RT-qPCR is as follows: 95℃ for 3 min; (95℃ for 5 sec; 60℃ for 30 sec; 72℃ for 15 sec) for 40 cycles; 72℃ for 5 min; 4℃ for infinity.
[0065] Then, the overexpression positive plants are subjected to soil culture to obtain poplar plants with strong rooting ability.
[0066] In a preferred embodiment, the LAC2 gene is knocked out in the poplar plant. LAC2 The method comprises the following steps:
[0067] Step i, constructing LAC2 The gene knockout recombinant vector.
[0068] Preferably, the LAC2 The gene knockout recombinant vector is obtained by constructing the editing target fragment of the gene onto a CRISPR / Cas9 binary vector. LAC2 The gene knockout recombinant vector is obtained by constructing the editing target fragment of the gene onto a CRISPR / Cas9 binary vector.
[0069] Preferably, step i comprises the following sub-steps:
[0070] Step i-1, designing a gene knockout target sequence.
[0071] Preferably, the target is LAC2-1 and LAC2-2, wherein,
[0072] The nucleotide sequence of LAC2-1 is GGCGAGGACCTGGGAACTT, and the nucleotide sequence of LAC2-2 is GCAAAGTCCGGCACTAAAGA.
[0073] Step i-2, designing vector primers and expression cassette amplification primers.
[0074] Preferably, the gene editing vectors of the two targets need to use pYLgRNA-AtU3d vector and pYLgRNA-AtU3b vector, and the two vectors are connected to the Cas9 binary vector pYLCRISPR / Cas9-DN.
[0075] Preferably, the vector primers are SP-DL and SP-R, and the expression cassette amplification primers are U-F, gRNA-R, Uctcg-B1', gRctga-B2, Uctga-B2', and gRcggt-BL.
[0076] The sequences of the vector primers and the expression cassette amplification primers are shown in Table 1:
[0077] Table 1
[0078]
[0079] Step i-3, design of target adapter primers.
[0080] The target adapter primers LAC2-3d-F, LAC2-3d-R, LAC2-3b-F and LAC2-3b-R are designed according to the gRNA cassette vector.
[0081] Preferably, the sequence of the primer LAC2-3d-F is GTCATCTTTAGTGCCGGACTTTGCAGG, the sequence of the primer LAC2-3d-R is AAACCCTGCAAAGTCCGGCACTAAAGA, the sequence of the primer LAC2-3b-F is GTCAAAGTTCCCAGGTCCTCGCC, and the sequence of the primer LAC2-3b-R is AAACGGCGAGGACCTGGGAACTT.
[0082] Step i-4, construction of the vector.
[0083] In a preferred embodiment, first, two target adapters, LAC2-3d and LAC2-3b, are obtained; then the method of cutting and connecting is used to connect the target adapters LAC2-3d and LAC2-3b with the pYLgRNA-AtU3d and pYLgRNA-AtU3b vectors, respectively.
[0084] Preferably, the target adapters are obtained by the method comprising the following steps: the target adapter primers are dissolved in ddH2O to 10 μM, and 10 μL of each of the pair of adapter primers is added to 80 μL of ddH2O to dilute to 1 μM. A PCR instrument is used at 90℃ for 30 s, and after the end, the annealing is completed at room temperature.
[0085] Further, in order to obtain stable and correct specific products and avoid amplification of double adapter primers or empty primers, two rounds of nested PCR amplification are used in the present application.
[0086] Preferably, the first round of PCR comprises reaction 1 and reaction 2, the primers of reaction 1 are U-F, LAC2-3d-R and LAC2-3b-R, and the primers of reaction 2 are gRNA-R, LAC2-3d-F and LAC2-3b-F.
[0087] More preferably, the reaction conditions of the first round of PCR are as follows: 95℃ for 3 min; (95℃ for 16 sec; 60℃ for 16 sec; 72℃ for 30 sec) for 27 cycles; 72℃ for 5 min; 4℃ for ∞.
[0088] Preferably, the primers of the second round of PCR are PR1 and PR2L, wherein the primer PR1 is composed of Uctcg-B1' and gRctga-B2, and the primer PR2L is composed of Uctga-B2' and gRcggt-BL.
[0089] More preferably, the reaction conditions of the second round of PCR are: 95℃ 3min; (95℃ 16sec; 60℃ 30sec; 72℃ 35sec) 20 cycles; 72℃ 3min; 4℃ ∞.
[0090] Further, the ligation of the gRNA expression cassette and the pYLCRISPR / Cas9-DN vector is performed by the method of cutting and ligating.
[0091] Step ii, transforming the gene knockout recombinant vector into Agrobacterium to obtain LAC2 a gene knockout positive bacterium.
[0092] Step iii, infecting the poplar material with the gene knockout positive bacterium to perform transgenic culture, and obtaining a gene knockout positive plant through identification.
[0093] Preferably, the identification comprises PCR identification and CRISPR edited DNA mutation detection.
[0094] Through the identification of the overexpression transgenic plant and the gene knockout mutant plant, the present application clarifies LAC2 the key regulatory role of the gene in the rooting process of poplar, LAC2 the gene overexpression mutant can significantly improve the rooting ability of poplar, providing important genetic resources for breeding new varieties of poplar with strong rooting ability, and at the same time, can accurately and efficiently screen superior plants with high survival rate in the early growth stage of poplar, effectively shortening the breeding cycle.
[0095] In the fifth aspect of the present application, a poplar genetic improvement method is provided, and the genetic improvement is to improve the rooting ability of poplar.
[0096] Preferably, the method comprises the step of subculture breeding the poplar individuals with the SV molecular marker and eliminating the poplar individuals without the molecular marker.
[0097] More preferably, the poplar genetic improvement method comprises the following steps:
[0098] Step I, extracting the genomic DNA of poplar;
[0099] Step II, performing PCR amplification with the poplar genomic DNA as a template;
[0100] Step III, determining whether the poplar has the SV molecular marker according to the amplification result to determine the rooting ability of the poplar.
[0101] In step II, the primers for PCR amplification are SV-F and SV-R, whose nucleotide sequences are shown in SEQ ID NO.6 and SEQ ID NO.7, respectively.
[0102] In step III, the amplification results show that: if only a 300bp band is obtained, it is determined that poplar has SV molecular markers and strong rooting ability; if only a 146bp band is obtained, it is determined that poplar does not have SV molecular markers and weak rooting ability.
[0103] Preferably, the product with a 300bp band obtained by amplification has the sequence shown in SEQ ID NO.8; the product with a 146bp band obtained by amplification has the sequence shown in SEQ ID NO.9.
[0104] In this invention, utilizing Example 1 Obtaining Populus rooting-related structural variation SV The 154bp insertion SV structural variation in the upstream promoter region of the gene can quickly determine the strength of poplar rooting ability, accurately and efficiently screen superior plants with high survival rates in the early stage of poplar growth, effectively shorten the breeding cycle, and provide theoretical support for molecular design breeding of poplar rooting ability.
[0105] Example
[0106] The present invention is further described below through specific examples; however, these examples are merely exemplary and do not constitute any limitation on the scope of protection of the present invention.
[0107] Unless otherwise specified, the reagents involved in the following examples are all commercially available conventional reagents, the methods used are all commonly used methods in this technical field, and the parameters are all conventionally set.
[0108] LAC2
[0109] Molecular markers associated with poplar rooting ability were obtained using the following steps:
[0110] Using GEMMA (v0.98.5) software, SV-GWAS analysis was performed at the whole-genome level on the phenotypic data of rooting status of 59,105 high-confidence SVs and 140 poplar cultivars. Population structure and phylogenetic matrices were also incorporated, resulting in the identification of 175 significant SV loci. One significantly associated locus was annotated to […]. Figure 1 The promoter region of the gene (p=2.39E-13), such as LAC2 As shown (the arrow points to the site of the significant association).
[0111] Figure 2The promoter sequence of the gene is shown as SEQ ID NO. 4, and the significantly associated SV site is located at 208 bp of the sequence shown as SEQ ID NO. 4, which is an insertion-type structural variation of 154 bp, and the nucleotide sequence is shown as SEQ ID NO. 5. Example 2 Identification method for Populus rooting ability based on SV
[0112] Among them, 59,105 high-confidence SVs were obtained by using the VG toolkit program (https: / / www.nature.com / articles / s41467-025-60254-x). For each structural variation (SV) detected, only high-confidence variations with a "PASS" label were retained to improve the reliability of the detection results. The identified PAVs (presence-absence variations) were integrated at the population level using the Survivor software to efficiently merge multiple sample SVs, ensuring the uniformity and comparability of the variation data.
[0113] The 140 Populus varieties were obtained from the main cultivated varieties of forest farms across the country and were cultivated in Shandong Guan County through cuttage and grafting in 2023.
[0114] The method for obtaining the rooting phenotype of cuttage is as follows: based on the 140 Populus varieties, cuttage experiments were conducted, and one-year-old branches were cut from Populus. The branches were cut into 10 cm long stem segments, and the morphological lower end was cuttaged in a flowerpot filled with vermiculite, with 1-2 buds exposed at the top. The water content of the vermiculite in the flowerpot was maintained by spraying and tray irrigation, and the cuttaged branches were collected after 3 weeks. Whether the branches rooted or not was determined according to the rooting state.
[0115] The GWAS results were obtained by the R software package CMplot (https: / / github.com / YinLiLin / CMplot).
[0116] Figure 3
[0117] Using the upstream and downstream sequences of the SV molecular marker position related to Populus rooting in Example 1, and considering various principles of primer design, the upstream and downstream primers for amplifying the SV sequence were designed: the upstream primer is SV-F, and the nucleotide sequence is shown as SEQ ID NO. 6; the downstream primer is SV-R, and the nucleotide sequence is shown as SEQ ID NO. 7.
[0118] Then, 8 individuals were randomly selected from the Populus variety population germplasm resource library planted in Shandong Guan County as described in Example 1, and genomic DNA was extracted for SV verification, and the rooting trait of Populus was evaluated.
[0119] The specific operation is as follows:
[0120] (1) The crude extraction of Populus DNA to be detected:
[0121] (i) Sample processing: Take a piece of sample leaf to be extracted and place it in a 2 mL centrifuge tube and add 1 steel ball. After quick freezing with liquid nitrogen, crush the sample with a tissue crusher at 80 Hz for 3 min until the sample becomes a powder.
[0122] (ii) Buffer treatment: Add 500 μL of TBS buffer to the sample, mix well, and then place it in a 65°C water bath for 10 min.
[0123] (iii) Initial centrifugation and precipitation: centrifuge at 12000 rpm for 15 min, transfer the supernatant to a new tube, add an equal volume of isopropanol, and let it stand at room temperature for 30 min until a white flocculent DNA precipitate appears.
[0124] (iv) Nucleic acid collection: centrifuge at 12000 rpm for 15 min, carefully discard the supernatant, and add 1 mL of 75% ethanol to wash the precipitate, repeat twice.
[0125] (v) Ethanol removal: centrifuge at 7500 rpm for 10 min, and completely aspirate the residual liquid with a pipette.
[0126] (vi) Drying and dissolution: dry in a 40°C oven for 2 h, add 50 μL of ddH2O to dissolve the DNA precipitate, and store it in a -20°C refrigerator for future use.
[0127] (2) Identification of SV
[0128] Using the DNA of different Populus varieties obtained in step (1) above as a template, PCR amplification was performed, and the reaction system was as follows: 2 × Phanta Max Master Mix (Dye Plus) 25 μL; template DNA (100 ng / μL) 2 μL; SV-F (10 μM) 2 μL; SV-R (10 μM) 2 μL; ddH2O 19 μL.
[0129] The reaction conditions were as follows: 95°C for 3 min; (94°C for 30 s; 55°C for 30 s; 72°C for 60 s) for 35 cycles; 72°C for 5 min; 4°C ∞.
[0130] The amplification results are shown in LAC2 As can be seen, only the 300 bp band is amplified, which proves the existence of the SV molecular marker, and only the 146 bp band is amplified, which proves the absence of the SV molecular marker.
[0131] (3) Comparison of the identification results of the SV-based molecular marker and the rooting of hardwood cuttings
[0132] Whether the one-year-old hardwood cuttings from eight randomly selected poplar individuals rooted was compared with molecular markers based on SV. The results are shown in Table 2:
[0133] Table 2
[0134]
[0135]
[0136] Among them, homozygous variant refers to a homozygous genotype of an individual carrying a structural variant (SV), that is, both alleles contain the SV; no variant refers to a homozygous genotype of an individual without the SV, that is, neither allele contains the SV.
[0137] As can be seen from Table 2: individuals with SV all rooted from hardwood cuttings and were Populus tomentosa; individuals without SV all failed to root from hardwood cuttings and were Populus alba.
[0138] As can be seen from the above, the SV sequence can be amplified in poplar individuals that have rooted from hardwood cuttings, indicating that SV is retained in poplars with strong rooting ability; the SV sequence cannot be amplified in poplar individuals that have not rooted from hardwood cuttings, indicating that SV is missing in poplars with weak rooting ability.
[0139] Example 3 Structural variant SV pairs LAC2 Analysis of the regulatory role of gene promoter activity
[0140] Given that SV in this invention is located LAC2 In order to clarify the gene promoter region LAC2 Whether gene promoter insertion variations affect their promoter activity was verified using a dual-luciferase assay, the specific procedure of which is as follows:
[0141] (1) LAC2 Cloning of gene fragments with two promoter types (with and without SV structural variations)
[0142] (i) The 108 Populus DNA extracted in Example 2 was used as the template DNA with SV fragment insertion, and Populus tomentosa 1316 was used as the template DNA without SV fragment.
[0143] (ii) Reference LAC2 The nucleotide sequence of the gene promoter and the primer design method are the same as in Example 2, resulting in primers P1 and P2. The sequence of primer P1 is: CTATAGGGCGAATTGGGTACCTGTATAATTGCCTTCCTAGAGACAATATG; the sequence of primer P2 is: CGCTCTAGAACTAGTGGATCCATTAAGCTTATGCTCTCTCTCTCAACA.
[0144] PCR was performed using the DNA in step (i) above as a template, and the PCR experimental reaction system (50 μL) was as follows: template DNA (100 ng / μL) 2 μL; 2 × Phanta Max Master Mix (Dye Plus) 25 μL; ddH2O 19 μL; primer P1 (10 μM) 2 μL; primer P2 (10 μM) 2 μL.
[0145] The PCR amplification program was as follows: 95°C for 3 min; (95°C for 25 s; 58°C for 30 s; 72°C for 30 s) for 35 cycles; 72°C for 5 min; 4°C for infinity.
[0146] (iii) The product of the PCR reaction was subjected to agarose gel electrophoresis, and after detection, it was purified using the DNA Clean-up Kit of Jiangsu Kangweishijishe Biological Technology Co., Ltd. After purification, the purity and concentration of the DNA purified product were determined using an instrument.
[0147] (2) Enzymatic digestion of pGreenII 0800 expression vector
[0148] The pGreenII 0800 vector plasmid was subjected to double enzyme digestion with KpnI and BamHI endonucleases, and the enzyme digestion reaction system was as follows: vector plasmid 2 μg; 10X FastDigest Green Buffer 5 μL; FastDigest KpnI 1 μL; FastDigest BamHI 1 μL; ddH2O To 50 μL.
[0149] The enzyme digestion reaction conditions were as follows: 37°C metal bath for 3 h, and the plasmid after enzyme digestion was recovered by gel and used as a linearized vector skeleton, which was stored at -20°C.
[0150] (3) pGreenII 0800- LAC2 Pro -LUC and pGreenII 0800- LAC2 ProSV Construction of pGreenII 0800-
[0151] (i) Ligation of the expression vector
[0152] The seamless cloning kit Uniclone One Step Seamless Cloning Kit of Beijing Jinsha Biological Technology Co., Ltd. was used to respectively ligate LAC2 Pro (without SV) and LAC2 ProSVPromoter fragment was constructed into pGreenII 0800 vector to obtain recombinant vector. 50℃ for 15 min, and the ligation product was used to transform E. coli DH5a competent cells.
[0153] (ii) Transforming E. coli DH5a competent cells
[0154] DH5a competent cells were purchased from Shanghai Weidi Biology.
[0155] ①DH5a competent cells were taken out from -80℃ and quickly inserted into ice. After 5 minutes, the bacterial mass was melted, 5 μL of ligation product was added, and the EP tube bottom was gently mixed by hand (avoiding using gun suction). It was placed in ice for 25 minutes.
[0156] ②42℃ water bath heat shock for 45 seconds, quickly put back on ice and stand for 2 minutes, shaking will reduce the transformation efficiency.
[0157] ③700 μL of sterile LB medium without antibiotics was added to the centrifuge tube, mixed well, and then incubated at 37℃ on a shaker at 200 rpm for 60 minutes.
[0158] ④5000 rpm centrifugation for 1 minute to collect the bacterial mass, and about 100 μL of supernatant was taken to resuspend the bacterial mass and spread on LB medium containing Kana antibiotic.
[0159] ⑤The plate was inverted and placed in a 37℃ incubator for overnight culture.
[0160] (iii) PCR identification of positive clones
[0161] A sterile gun head was used to pick single colonies from pGreenII 0800- LAC2 Pro -LUC and pGreenII 0800- LAC2 ProSV -LUC plates, 250 μl of LB liquid medium containing Kana was added, and the plate was incubated at 37℃ and 200 rpm for about 3 hours. The positive and negative controls were set up using the PCR purified product and ddH2O as templates. The vector primers P3 and P4 of pGreenII 0800 were used as primers for identifying positive clones, and 2xTaq Plus Master Mix from Nanjing Vazyme Company was used for PCR amplification.
[0162] The sequence of primer P3 is: CGGCCAGTGAATTGTAATACG;
[0163] The sequence of primer P4 is: CATCTTCCAGCGGATAGAATG.
[0164] PCR reaction system: 2x Taq Plus Master Mix 10 μL; template DNA 1 μL; P3 (10 μM) 1 μL; P4 (10 μM) 1 μL; ddH2O 7 μL.
[0165] Reaction conditions: 95°C 3 min; (94°C 30 s; 54°C 30 s; 72°C 40 s) 35 cycles; 72°C 5 min; 4°C ∞.
[0166] The PCR product was detected by 1% agarose gel electrophoresis. The colonies that could amplify the same band as the positive control were positive clones.
[0167] (iv) Positive clone plasmid extraction
[0168] The positive clones detected by PCR were taken to 6 ml LB liquid medium containing Kana and cultured at 37°C, 200 rpm overnight. Plasmid extraction was performed using the plasmid extraction kit from Jiangsu Kangwei Reagent Co., Ltd., and sequencing was performed by Beijing Ruibo Xingke Biotechnology Co., Ltd. After the sequence was determined and compared without error, the vector construction was completed.
[0169] (4) Transformation of recombinant plasmid into Agrobacterium
[0170] (i) Take about 1 μg of pGreenII 0800-LAC2Pro-LUC and pGreenII 0800-LAC2ProSV-LUC recombinant plasmid and add it to 100 μL of Agrobacterium GV3101 competent cells, mix gently.
[0171] (ii) In turn, stand on ice for 5 min, freeze in liquid nitrogen for 1 min, immediately put into 37°C water bath for 5 min, and ice bath for 5 min.
[0172] (iii) Add 700 μL of YEP liquid medium without antibiotics to the bacterial solution, mix thoroughly, and then incubate at 28°C, 200 rpm for 2-3 hours. After the recovery culture is completed, centrifuge the bacterial solution at 5000 rpm for 1 minute, discard part of the supernatant, and retain 100 μL of supernatant mixed with the bacterial solution. Use a disposable sterile coating rod to evenly coat the bacterial solution on the surface of YEP solid medium containing 50 mg / L Rif and 50 mg / L Kana, and then place it in a 28°C incubator for inverted culture for 72-90 hours.
[0173] (iv) After the single colonies grow, use a sterile gun tip to pick several single colony spots and place them in a 2 mL centrifuge tube containing 250 μL YEP liquid medium (50 mg / L Rif and 50 mg / L Kana), and place them in a shaker at 30°C, 200 rpm for 3 h. After the culture is completed, take the bacterial liquid for PCR identification, the method is the same as described in Example 2. The correct positive bacterial liquid is added with 50% glycerol, and then is quickly frozen in liquid nitrogen, and is stored in a refrigerator at -80°C for subsequent experiments.
[0174] (5) Tobacco transient transformation experiment
[0175] (i) Take the Agrobacterium liquid containing pGreenII 0800- LAC2 Pro -LUC and pGreenII 0800- LAC2 ProSV -LUC plasmid from a refrigerator at -80°C, and streak them on YEP solid medium (50 mg / L Rif and 50 mg / L Kana), and seal the plate, and place them in a 28°C dark incubator for 2-3 days.
[0176] (ii) Use a sterile gun tip to pick single colonies from the plate and inoculate them in 3 mL YEP liquid medium (50 mg / L Rif and 50 mg / L Kana), and place them in a shaker at 30°C, 200 rpm for overnight culture. Take 1 mL of the bacterial liquid and transfer it into a 250 mL sterile conical flask containing 100 mL YEP liquid medium (50 mg / L Rif and 50 mg / L Kana), and place them in a shaker at 30°C, 200 rpm for 4-5 h until the OD600 is 0.8-1.0.
[0177] (iii) In a clean bench, transfer 100 mL of the bacterial liquid into two 50 mL sterile centrifuge tubes, and centrifuge them at 5000 rpm, 4°C for 20 min. Collect the bacterial bodies. In the clean bench, discard the supernatant, and resuspend the bacterial bodies in a sterile wide-mouth bottle with 100 mL of resuspension solution. The bacterial liquid is used for subsequent tobacco transient transformation experiments. The resuspension solution is prepared as follows: acetosyringone 0.03924 g; MES 2.1325 g; MgCl2 2.033 g; ddH2O is added to 1 L.
[0178] (iv) After the single colonies grow, use a sterile gun tip to pick several single colony spots and place them in a 2 mL centrifuge tube containing 250 μL YEP liquid medium (50 mg / L Rif and 50 mg / L Kana), and place them in a shaker at 30°C, 200 rpm for 3 h. After the culture is completed, take the bacterial liquid for PCR identification, the method is the same as described in Example 2. The correct positive bacterial liquid is added with 50% glycerol, and then is quickly frozen in liquid nitrogen, and is stored in a refrigerator at -80°C for subsequent experiments. LAC2 Pro -LUC, pGreenII 0800- Figure 4 ProSV-LUC bacterial suspension, incubated at room temperature for 2-3 hours. Select healthy tobacco leaves and inject the mixed bacterial suspension into the lower epidermis using a needleless syringe. Infected tobacco plants were then placed in a greenhouse for 12 hours of dark incubation, followed by 48-72 hours of incubation under a 16-hour light / 8-hour dark cycle. Imaging was performed using a molecular imaging system (IVIS Lumina XRMS Series III, PerkinElmer, Waltham, USA). The results are shown below. Figure 4 As shown. By LAC2 It can be seen that the fluorescence intensity of tobacco leaves injected with SV fragments is stronger, indicating that the presence of SV can activate... LAC2 Gene expression.
[0179] Approximately 100 mg of infected tobacco leaf tissue was collected, ground in liquid nitrogen, and then luciferase activity was measured using a Dual-Luciferase Reporter Assay System (Promega, Madison, USA) according to the kit's instructions. The luminescence intensity (LUC) of firefly luciferase was measured using a multi-functional microplate reader (Varioskan LUX, Thermo Fisher, Waltham, USA). Subsequently, 100 μL of Stop & Glo® Reagent was added, and the luminescence intensity (REN) of renal luciferase was measured. Using renal luciferase as an internal control, the ratio of firefly luciferase to renal luciferase luminescence intensity (LUC / REN) was calculated to measure the effect of SV on... Figure 5 The activation activity was determined. The experiment was repeated at least three times, with three biological replicates each time. A control experiment was performed using an empty plasmid following the above method, and the results were as follows: Figure 5 As shown. By LAC2 It can be seen that SV can significantly activate LAC2 Transcription, regulation LAC2 The expression.
[0180] Example 4 LAC2 Construction of gene overexpression vectors
[0181] (1) Enzyme digestion vector
[0182] The overexpression vector used in this embodiment is pROKⅡ-GFP, which is 13618bp in length and contains a strong 35S promoter (CaMV35S). Double digestion was performed using XbaI and KpnI restriction sites. The digestion reaction system was as follows: 1 μg pROKⅡ-GFP plasmid; 5 μL 10X FastDigest Green Buffer; 1 μL FastDigest XbaI; 1 μL FastDigest KpnI; 50 μL ddH2OTo.
[0183] The enzyme digestion reaction conditions were: 37℃ water bath for 3 hours. The digested plasmid was recovered by gel extraction and used as a vector backbone for later use, and stored at -20℃.
[0184] The enzyme-digested products were purified by gel extraction using the Kangwei Century Gel Extraction Kit.
[0185] (2) Obtain the target segment
[0186] Based on the 84k Yang reference genome LAC2 The CDS sequence of the gene, as shown in SEQ ID NO.2, was obtained by extracting RNA from wild-type 84K poplar using the plant RNA extraction kit from Beijing TransGen Biotech Co., Ltd.; the RNA was reverse transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (Nanjing Novizan Biotechnology Co., Ltd.), and the cDNA obtained by reverse transcription was used as a template.
[0187] Based on the primer design principles in Example 2, overexpression primers P5 and P6 were obtained. The sequence of primer P5 is: AGACACGGGGGACTCTAGAATGGGCAACTCTCCGCGT; the sequence of primer P6 is: CCCTTGCTCACCATGGTACCGCACTTTGGAAGATCAGACGGT.
[0188] The PCR reaction system (50 μL) consisted of: template 1 μL; dNTP 1 μL; Phanta Max Super-Fidelity DNA Polymerase 1 μL; 2×Phanta Max Buffer 25 μL; ddH2O 18 μL; primer P5 (10 μM) 2 μL; primer P6 (10 μM) 2 μL.
[0189] The reaction conditions were as follows: 95℃ for 3 min; (94℃ for 30 s; 58℃ for 30 s; 72℃ for 60 s) for 35 cycles; 72℃ for 5 min; 4℃ ∞.
[0190] The product of the PCR reaction was subjected to agarose gel electrophoresis, and after correct detection, a DNA Clean-up Kit reagent box from Jiangsu Kangwei Shijis Century Biotechnology Co., Ltd. was used for purification. After purification, the purity and concentration of the DNA purified product were determined using an instrument.
[0191] (3) Connecting the expression vector, transforming the E. coli DH5a competent cells, and PCR identifying positive clones.
[0192] Among them, the primers used are pROKII-GFP vector primers P7 and P8, the sequence of primer P7 is: GTGGATTGATGTGATATCTCCA; the sequence of primer P8 is: TTGCCGTAGGTGGCATCGCCCT.
[0193] LAC2 The gene overexpression PCR reaction system is: 2x Taq Plus Master Mix 10 μL; template DNA 1 μL; P7 (10 μM) 1 μL; P8 (10 μM) 1 μL; ddH2O 7 μL.
[0194] The PCR product was detected by 1% agarose gel electrophoresis, and the colony that could amplify the same band as the positive control was the positive clone. Subsequently, after sequence determination and comparison, the vector construction was completed.
[0195] Example 5 LAC2 Construction of gene knockout recombination vectors
[0196] (1) Target design
[0197] The gDNA sequence of the gene was queried in the 84k genome (https: / / figshare.com / articles / dataset / 84K_genome_zip / 12369209) using Tbtools LAC2 The sequence is shown as SEQ ID NO. 12. Based on this sequence, the CRISPR online target site design service (http: / / crispr.dbcls.jp / ) was used to consider the target position in the coding region and select the GC% content as high as possible. Finally, the specific target LAC2-1 and LAC2-2 of the gene were obtained LAC2 The nucleotide sequence of LAC2-1 is: GGCGAGGACCTGGGAACTT, and the nucleotide sequence of LAC2-2 is: GCAAAGTCCGGCACTAAAGA.
[0198] (2) Design vector primers and expression cassette amplification primers
[0199] Two target gene editing vectors, pYLgRNA-AtU3d and pYLgRNA-AtU3b, were used and connected to the Cas9 binary vector pYLCRISPR / Cas9-DN. The selection resistance in dicotyledonous plants was kanamycin.
[0200] The vector primers and expression cassette amplification primers are shown in Table 1.
[0201] (3) Target adapter primer design
[0202] The target adapter primers LAC2-3d-F, LAC2-3d-R, LAC2-3b-F, and LAC2-3b-R were designed according to the gRNA cassette vector.
[0203] The sequence of primer LAC2-3d-F is GTCATCTTTAGTGCCGGACTTTGCAGG, the sequence of primer LAC2-3d-R is AAACCCTGCAAAGTCCGGCACTAAAGA, the sequence of primer LAC2-3b-F is GTCAAAGTTCCCAGGTCCTCGCC, and the sequence of primer LAC2-3b-R is AAACGGCGAGGACCTGGGAACTT.
[0204] (4) Vector construction
[0205] (i) Target adapter preparation
[0206] The adapter primers were dissolved in ddH2O to 10 μM, and 10 μL of each pair of adapter primers was added to 80 μL of ddH2O to dilute to 1 μM. The PCR instrument was used at 90°C for 30 s, and after the end, it was moved to room temperature to complete the annealing. This step obtained two target adapters: LAC2-3d and LAC2-3b.
[0207] (ii) Connection of target and gRNA expression cassette
[0208] The target adapters LAC2-3d and LAC2-3b were connected to the pYLgRNA-AtU3d and pYLgRNA-AtU3b vectors, respectively, using the method of cutting and connecting. The reaction system is shown in Table 3:
[0209] Table 3
[0210]
[0211] The conditions of the above reaction are: (37°C for 5 min; 20°C for 5 min) for 5 cycles; 4°C for ∞.
[0212] (iii) First round amplification of gRNA expression cassette
[0213] To get stable and correct specific products and avoid amplifying double linker primers or empty products, two rounds of nested PCR amplification were used in this example. One gRNA expression cassette was used for two PCR reactions, which were named reaction 1 and reaction 2. The primers for reaction 1 were selected as U-F and target linker reverse primer. The primers for reaction 2 were selected as gRNA-R and target linker forward primer.
[0214] The system of reaction 1 is shown in Table 4:
[0215] Table 4
[0216]
[0217] The system of reaction 2 is shown in Table 5:
[0218] Table 5
[0219]
[0220]
[0221] The conditions of the first round of PCR reactions (reaction 1 and reaction 2) were as follows: 95℃ for 3 min; (95℃ for 16 sec; 60℃ for 16 sec; 72℃ for 30 sec) for 27 cycles; 72℃ for 5 min; 4℃ for ∞.
[0222] (iv) Second round amplification of gRNA expression cassette
[0223] Template preparation: 1 μL of the products of reaction 1 and reaction 2 of the first round of PCR was diluted in 9 μL of ddH2O, and 1 μL of the diluted product was mixed to form 2 μL of template, which had two templates at this time.
[0224] Position-specific primer preparation: two target points required PR1 (B1’ Uctcg-+ gRctga-B2) and PR2L (Uctga-B2’+ gRcggt-BL) primers, which were mixed into 10× working solution. For example, 3 μL of 10 μM Uctcg-B1’ and 3 μL of 10 μM gRctga-B2 were added to 14 μL of ddH2O to form 1.5 μM 10× working solution.
[0225] The system of the second round of PCR amplification is shown in Table 6:
[0226] Table 6
[0227]
[0228] Reaction conditions: 95°C 3 min; (95°C 16 sec; 60°C 30 sec; 72°C 35 sec) 20 cycles; 72°C 3 min; 4°C ∞.
[0229] Take 4 μL of the amplification product and check the band with 1% gel electrophoresis. Mix two products with correct band size and purify them with DNA Clean-up Kit. After purification, measure the concentration.
[0230] (v) Connection of gRNA expression cassette and pYLCRISPR / Cas9-DN
[0231] Use the method of cutting and connecting, connect the gRNA expression cassette and pYLCRISPR / Cas9-DN vector. The reaction system is shown in Table 7.
[0232] Table 7
[0233]
[0234] The reaction conditions are as follows: 37°C 10 min.
[0235] After the reaction, quickly add 1 μL T4 DNA ligase and 1 μL 10 x T4 DNA ligase buffer. Put it into the PCR instrument, and the reaction program is as follows: (37°C 120 s, 10°C 3 min, 20°C 5 min) 15 cycles; 37°C 2 min; 16°C ∞.
[0236] Take 5 μL of the reaction product and transform E. coli competent DH5α. The method is the same as in Example 3. Identify positive clones by bacterial liquid PCR. The primers used are vector primers SP-DL and SP-R. The reaction system is shown in Table 8.
[0237] Table 8
[0238]
[0239] PCR products are detected by 1% agarose gel electrophoresis. The colonies that can amplify 750 bp bands are positive clones. Then, sequence determination and comparison are performed to complete the construction of the vector.
[0240] Example 6 LAC2 Genetic transformation of genes
[0241] (1) The gRNA expression recombinant vector plasmid obtained in Example 4 and the gene knockout recombinant vector plasmid obtained in Example 5 are transformed into Agrobacterium according to the method described in Example 3. LAC2
[0242] (2) Activation of Agrobacterium
[0243] (i) Take out the Agrobacterium liquid containing overexpressed recombinant vector plasmid and gene q knockout recombinant vector plasmid from the -80℃ refrigerator, streak inoculate on YEP solid medium (50 mg / L Rif and 50 mg / L Kana) respectively, seal the plate, and invert culture in a 28℃ dark incubator for 2-3 days.
[0244] (ii) Use a sterile gun head to pick single colonies from the plate and inoculate into 3 mL YEP liquid medium (50 mg / L Rif and 50 mg / L Kana), and place in a shaker at 28℃ 200 rpm for overnight culture. Take 2 mL bacterial liquid and transfer into a 250 mL sterile conical flask containing 100 mL YEP liquid medium (50 mg / L Rif and 50 mg / L Kana), and place in a shaker at 30℃ 200 rpm for 4-5 h of culture until the OD600 is 0.3-0.5.
[0245] (iii) In the clean bench, transfer 100 mL bacterial liquid into two 50 mL sterile centrifuge tubes, centrifuge at 5000 rpm and 4℃ for 20 min. Collect the bacterial bodies. In the clean bench, discard the supernatant, resuspend the bacterial bodies in a sterile wide-mouth bottle with 100 mL 1 / 2MS resuspension solution (1 / 2MS + 30 g / L sucrose), and use the bacterial liquid for subsequent infection experiments.
[0246] (3) Leaf disc method infection
[0247] In the clean bench, cut off the whole plant of 1-month-old wild type tissue culture seedlings, select the leaves with good growth state, cut off the leaf tips, cut each leaf with 2-3 wounds with a scalpel, cut 3-4 tissue culture seedlings, and transfer all the cut leaves into a wide-mouth bottle containing bacterial liquid, and place in a shaker at 28℃ 180 rpm for 20-30 min.
[0248] (4) Co-culture
[0249] In the clean bench, take out the leaves from the bacterial liquid with tweezers, absorb the excess bacterial liquid with sterile filter paper, and place the leaves with the back down on the co-culture plate, and invert culture in the dark at 25℃ for 2 days.
[0250] The co-culture medium is prepared according to the following ingredients and amounts: MS (4.32 g) + NAA (0.1 mg) + 6-BA (0.5 mg) + TDZ (0.002 mg) + sucrose (30 g) + AS (80 μM) + agar (8.3 g) + ddH2O (make up to 1 L). The pH is 5.2, and the medium is sterilized at 121℃ for 20 min and then used.
[0251] (5) Selection culture
[0252] After co-cultivation, the leaves are washed with cefotaxime aqueous solution (300 mg / L) 4 times, then washed with deionized water 2 times, the residual water on the leaves is absorbed with filter paper, the leaves are laid flat on the differentiation medium added with cefotaxime (300 mg / L) and Kana antibiotic (200 mg / L) with the back of the leaves downward, and selection culture is carried out to induce callus. During the period, the leaf discs are transferred to new differentiation medium every ten days, and the replacement is continued for 3-4 weeks until white or light yellow callus grows on the edge of the leaf discs. The whole process is cultured in a 25℃ light incubator. The differentiation medium is prepared according to the following ingredients and amounts: MS (4.32 g) + NAA (0.1 mg) + 6-BA (0.5 mg) + TDZ (0.002 mg) + sucrose (30 g) + agar (8.3 g) + ddH2O (constant volume to 1 L). pH 5.8, 121℃ 20min high temperature sterilization is used.
[0253] (6) Cluster bud induction rooting
[0254] After 1-2 months of growth on the differentiation selection medium, adventitious buds can be differentiated, and when the adventitious buds grow to about 1 cm, they can be cut and transferred to the rooting selection medium to culture into complete plants.
[0255] The rooting selection medium is prepared according to the following ingredients and amounts: 1 / 2MS (2.18 g) + IBA (0.05 mg) + NAA (0.05 mg) + sucrose (20 g) + agar (8 g) + ddH2O (constant volume to 1 L). pH 5.8, 121℃ 20min high temperature sterilization is used.
[0256] Example 7 LAC2 Identification of gene overexpression and knockout plants
[0257] (1) LAC2 Crude extraction of DNA of gene overexpression plants and LAC2 gene knockout plants, the method is referred to Example 2.
[0258] (2) LAC2 Identification of gene overexpression plants
[0259] (2.1) Identification at the DNA level
[0260] The crudely extracted gDNA of the overexpression plants is used as a template, and Taq Plus Master Mix is used for PCR identification, and the PCR reaction system is as follows: LAC2 The gene overexpression PCR reaction system is as follows: 2x Taq Plus Master Mix 10 μL; template DNA 1 μL; P7 (10 μM) 1 μL; P8 (10 μM) 1 μL; ddH2O 7 μL.
[0261] Run the PCR products directly onto an electrophoresis apparatus to check if the bands are correct. If correct, then... LAC2 Plants with overexpressed genes.
[0262] (2.2) Identification of transcription level
[0263] RT-PCR detection LAC2 Overexpression plants:
[0264] (i) RNA was extracted from leaf tissue of the overexpressing plant and reverse transcribed to obtain template cDNA. The method was the same as in Example 4. The reaction system (20 μL) was: 4×All-in-One Ultra RT SuperMix 5 μL; template RNA Total RNA: 1 pg-1 μg; RNase-free ddH2O to 20 μL.
[0265] The reaction procedure was: 50℃ for 5 min; 85℃ for 5 sec.
[0266] (ii) RT-qPCR experiments were performed using 2×ChamQ SYBR Color qPCR Master Mix. This example is based on 84K Yang's... Figure 6 The gene sequence was used to design the following real-time PCR primers, LAC2-qPCR-F and LAC2-qPCR-R, with sequences shown in SEQ ID NO.10 and SEQ ID NO.11, respectively. The nucleotide sequence of the internal control primer Actin-F is: TCATCGGAATGGAAGCTGCTGGTA; the nucleotide sequence of Actin-R is: TAGTGGAACCACCACTGAGCACAA.
[0267] The reaction system is shown in Table 9.
[0268] Table 9
[0269]
[0270] The reaction program was as follows: 95℃ for 3 min; (95℃ for 5 sec; 60℃ for 30 sec; 72℃ for 15 sec) for 40 cycles; 72℃ for 5 min; 4℃ to infinity.
[0271] Overexpression detection results as follows LAC2 As shown, in the OE6, OE9, and OE10 lines LAC2 The expression level reached more than 4000 times that of the wild type, and it was identified as... LAC2 Positive strains with overexpression of the gene.
[0272] (3) LAC2 Identification of gene knockout plants
[0273] PCR identification was performed using Taq Plus Master Mix with the gDNA of the crude extracted gene knockout plant as a template, and the reaction system was referred to Table 8 in Example 5. The PCR product was directly run electrophoresis to check whether the band was correct, and if correct, it was Figure 7 The gene knockout plant was completed with the primary screening.
[0274] The DNA of the plant screened above was sent to a sequencing company, and the sequencing results were compared to check whether editing appeared near the target. The editing mode was as shown in LAC2 It can be seen that the plants numbered KO3, KO4, KO5 and KO6 were all homozygous mutations, indicating that the gene editing was successfully achieved.
[0275] Example 8 LAC2 Phenotypic analysis of gene overexpression and gene knockout plants
[0276] The Figure 8 gene overexpression plant, the gene knockout plant and the 84k wild type plant were cultured in the artificial climate chamber at the same time, and the root phenotype of the plant was determined and photographed, and the results were as shown in LAC2 From left to right, they were Figure 8 the phenotype of the overexpression plant (numbered OE6, OE9, OE10), the phenotype of the wild type (marked as WT) and the phenotype of the gene knockout plant (numbered KO3, KO4, KO5).
[0277] It can be seen from LAC2 When the plant with terminal bud was cut, there was no significant difference in the time of root primordium callus, which appeared on the 4th day of cutting; but after 7 days of cutting, compared with the wild type, LAC2 the root length of the overexpression plant was longer, while the growth of the root length of the gene knockout plant was significantly inhibited.
[0278] The above results show that promoting the elongation of poplar roots is of great significance for breeding poplar excellent plants and poplar germplasm resource innovation.
[0279] The present application has been described in detail in combination with specific embodiments and exemplary examples, but these descriptions cannot be understood as limitations of the present application. Those skilled in the art understand that various equivalent replacements, modifications or improvements can be made to the technical solutions and embodiments of the present application without departing from the spirit and scope of the present application, and these all fall within the scope of the present application.
Claims
1. A primer set for detecting SV molecular markers related to the rooting ability of poplar trees, characterized in that, The primers of the primer set are SV-F and SV-R, and their nucleotide sequences are shown in SEQ ID NO.6 and SEQ ID NO.7, respectively. The SV molecular marker is located in the promoter region upstream of the poplar gene LAC2, and the sequence of the upstream promoter region of gene LAC2 is shown in SEQ ID NO.4; the SV molecular marker is located in the gene shown in SEQ ID NO.
4. LAC2 An insertional structural variant of 154 bp at the 208th bp position of the promoter region, the sequence of which is shown in SEQ ID NO.5; When poplar genes LAC2 When the SV molecular marker is present at position 208 of the upstream promoter region, poplar trees exhibit strong rooting ability; when the poplar gene... LAC2 When the SV molecular marker is missing at position 208 of the upstream promoter region, the rooting ability of poplar trees is weak.
2. The application of the primer set for detecting SV molecular markers related to poplar rooting ability as described in claim 1 in detecting poplar rooting ability.
3. The application according to claim 2, characterized in that, The detection of poplar rooting ability using a primer set that detects SV molecular markers includes the following steps: Step 1: Perform PCR amplification on the genomic DNA of poplar trees; Step 2: Electrophoretic identification of the amplification products; If the SV molecular marker is present, the poplar has a strong rooting ability; if the SV molecular marker is not present, the poplar has a weak rooting ability.
4. A method for genetic improvement of poplar trees, characterized in that, The genetic improvement aims to enhance the rooting ability of poplar trees. The method includes the steps of subgeneration selection of poplar individuals with SV molecular markers related to poplar rooting ability, and elimination of poplar individuals without the molecular markers; The SV molecular marker is located in the promoter region upstream of the poplar gene LAC2, and the sequence of the upstream promoter region of gene LAC2 is shown in SEQ ID NO.4; the SV molecular marker is located in the gene shown in SEQ ID NO.
4. LAC2 An insertional structural variant of 154 bp at the 208th bp position of the promoter region, the sequence of which is shown in SEQ ID NO.5; When poplar genes LAC2 When the SV molecular marker is present at position 208 of the upstream promoter region, poplar trees exhibit strong rooting ability; when the poplar gene... LAC2 When the SV molecular marker is missing at position 208 of the upstream promoter region, the rooting ability of poplar trees is weak.
Citation Information
Patent Citations
Transcription factor gene PeSHR2 for adjusting and controlling poplar root system architecture and application thereof
CN103757031A
Method for screening out poplar growth characters by combined utilization of lncRNA and target genes thereof, kit and application
CN108467900A