Primer group and kit for high-flux targeted detection of pathogens and drug-resistant genes of camel mastitis and application of primer group and kit

Abstract

The invention discloses a primer group and a kit for high-flux targeted detection of pathogens and drug-resistant genes of camel mastitis and application of the primer group and the kit. The primer group consists of 185 pairs of primers with nucleotide sequences as shown in SEQ ID NO: 1-370. According to the primer group, the kit and the detection method disclosed by the invention, specific amplification is carried out on key areas of 20 pathogen target genes and 77 drug-resistant genes of camel mastitis; the kit has the following remarkable advantages: 1) high precision and specificity: sequencing is performed for a specific region, so that the detection accuracy is remarkably improved, low-abundance pathogenic bacterium nucleic acid can be effectively detected, and early diagnosis is assisted; 2) high efficiency and economy: parallel detection of various pathogenic bacteria and drug-resistant genes can be realized through a single experiment, and the detection flux is greatly improved; compared with whole genome sequencing, the cost of targeted sequencing is lower; 3) the method is simple, convenient and universal, the data analysis complexity is remarkably reduced, the method is suitable for various clinical samples such as blood, tissues and secretions, and a unified and efficient detection scheme is provided for different sample types.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of pathogenic microorganism detection, and more particularly to a primer set for high-throughput targeted detection of pathogens and drug resistance genes of camel mastitis, a kit and application thereof. BACKGROUND

[0002] After camel milk is converted from a semi-wild state to centralized breeding, the incidence of camel mastitis has increased explosively, and the infection rate of mastitis in some camel breeding farms has exceeded 30.00%. Camel mastitis is a disease caused by camel mammary gland tissue due to pathogenic microorganisms, physical and chemical factors, etc., and pathogenic microorganism infection is the most important inducement.

[0003] Clinical mastitis can be diagnosed by typical clinical symptoms, and subclinical mastitis needs to be diagnosed by laboratory detection methods, including somatic cell counting, microbial culture and isolation identification, PCR, and gene sequencing technology, etc. However, traditional detection technologies represented by somatic cell counting and microbial culture and isolation identification often have limitations such as insufficient sensitivity, limited specificity, long time consumption, and narrow range of pathogenic bacteria species that can be simultaneously detected. The existing gene detection methods for camel mastitis pathogens have problems such as low sensitivity, poor specificity, incomplete target coverage, long process time, and low detection efficiency. In order to overcome these challenges, it is urgent to develop high-throughput, high-sensitivity targeted detection primers, kits and matching detection systems for multiple important pathogens and drug resistance genes of camel mastitis. SUMMARY

[0004] The present application relates to the technical field of pathogenic microorganism detection, and more particularly to a primer set for high-throughput targeted detection of pathogens and drug resistance genes of camel mastitis, a kit and application thereof.

[0005] According to one aspect of the present application, a primer set for high-throughput targeted detection of pathogens and drug resistance genes of camel mastitis is provided, which consists of 185 pairs of primers with nucleotide sequences as shown in SEQ ID NO: 1-370, each pair of primers consisting of an upstream primer and a downstream primer, and the 185 pairs of primers being used to amplify pathogenic target genes and drug resistance genes of camel mastitis.

[0006] In some embodiments, the 185 pairs of primers are respectively directed to 20 pathogenic target genes and 77 drug resistance genes of camel mastitis, and each pathogenic target gene or drug resistance gene is provided with 1-2 pairs of primers.

[0007] In some embodiments, the odd-numbered sequence in each pair of primers is an upstream primer, and the even-numbered sequence in each pair of primers is a downstream primer, and both the upstream primer and the downstream primer have an index adapter sequence.

[0008] In some embodiments, the index adaptor sequence of the upstream primer is AATGATACGGCGACCACCGAGATCTACAC, and the index adaptor sequence of the downstream primer is CAAGCAGAAGACGGCATACGAGAT.

[0009] According to another aspect of the present application, there is provided an application of the primer set for high-throughput targeted detection of pathogens and drug resistance genes of camel mastitis in detection or auxiliary detection of 20 pathogenic target genes and 77 drug resistance genes of camel mastitis for non-disease diagnosis purposes.

[0010] According to another aspect of the present application, there is provided a kit for high-throughput targeted detection of pathogens and drug resistance genes of camel mastitis, which comprises the primer set for high-throughput targeted detection of pathogens and drug resistance genes of camel mastitis.

[0011] In some embodiments, the kit further comprises a DNA extraction kit, a multiplex PCR amplification system, a PCR product recovery and purification kit, a terminal repair and adaptor ligation kit, a library enrichment kit, a library purification kit, and a Truseq PE Cluster Kit v3-cBot-HS cluster generation kit.

[0012] According to a fourth aspect of the present application, there is provided an application of the kit for high-throughput targeted detection of pathogens and drug resistance genes of camel mastitis in detection of 20 pathogenic target genes and 77 drug resistance genes of camel mastitis.

[0013] According to a fifth aspect of the present application, there is provided a method for high-throughput targeted detection of pathogens and drug resistance genes of camel mastitis, which uses the kit for high-throughput targeted detection of pathogens and drug resistance genes of camel mastitis, and which is a non-disease diagnosis purpose method, comprising the following steps: S1. DNA extraction; S2. multiplex PCR amplification using the primer set for high-throughput targeted detection of pathogens and drug resistance genes of camel mastitis according to any one of claims 1-4; S3. recovery and purification of the PCR product of step S2 using a PCR product recovery and purification kit; S4. terminal repair, 3' end A addition, and index adaptor ligation using a Nano DNA Sample Prep Kit; S5. library enrichment, library purification, and library quantification; S6. bridge PCR using a Truseq PE Cluster Kit v3-cBot-HS cluster generation kit to amplify a single DNA molecule into a cluster; S7. High-throughput sequencing.

[0014] In some embodiments, the DNA extracted in step S1 has a concentration of ≥ 0.1 ng / uL.

[0015] Advantages of the present application: The primer set, kit and detection method provided by the present application target the specific regions of 20 pathogen target genes and 77 drug-resistant genes of camel mastitis, significantly improve the accuracy and specificity of detection, not only can efficiently realize the one-time synchronous detection of multiple related pathogens and drug-resistant genes, but also has high sensitivity, can effectively detect trace pathogen nucleic acids, and helps early diagnosis; its high-throughput characteristics support the completion of a large number of sample detection in a short time, significantly improve the efficiency; at the same time, compared with whole genome sequencing, targeted sequencing significantly reduces the detection cost, and focusing on the specific regions of target genes and drug-resistant genes simplifies the complexity of data analysis. The method has strong compatibility and is suitable for various clinical sample types such as blood, tissue, and secretion, providing a unified and efficient technical solution for pathogenic bacteria detection of different source samples. BRIEF DESCRIPTION OF DRAWINGS

[0016] Fig. 1 The figure is the reads base composition distribution graph detected by the embodiment 3 of the present application.

[0017] Fig. 2 The figure is the reads base quality distribution graph detected by the embodiment 3 of the present application. DETAILED DESCRIPTION

[0018] The present application will be described in detail below with reference to the embodiments of the present application and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present application, not all. Based on the embodiments in the present application, all other embodiments that can be obtained by those skilled in the art belong to the scope of protection of the present application.

[0019] Embodiment 1: Primer set for high-throughput targeted detection of pathogens and drug-resistant genes of camel mastitis Common pathogens of camel mastitis were selected by statistics and analysis, and public database resources such as NCBI and GenBank were integrated to establish a reference database covering target genes (20 kinds) and drug-resistant genes (77 kinds) of common pathogens of camel mastitis. According to the above-mentioned reference database of pathogen target gene and drug-resistant gene sequence covering pathogens, multiple designs, analyses, and comparisons were performed, 1-2 pairs of specific primers were designed for each gene, and a total of 185 pairs of primers were designed. The above-mentioned 185 pairs of primers were synthesized by Shanghai Ling'en Biotechnology Co., Ltd., and the nucleotide sequences are shown in SEQ ID NO. 1-SEQ ID NO. 370. See Table 1 for details.

[0020] Table 1. Primer sequence listing for high-throughput targeted detection of pathogens and drug resistance genes in camel mastitis.

[0021]

[0022]

[0023]

[0024]

[0025]

[0026] Example 2: A high-throughput targeted detection method for pathogens and drug resistance genes in camel mastitis. Library construction was performed using the primer set from Example 1, and the specific steps are as follows: S1. DNA Extraction DNA was extracted from the sample using a DNA extraction kit; S2. Multiplex PCR amplification Using the DNA extracted in step 1 as a template, multiplex PCR amplification was performed using the primer set and multiplex PCR reaction system of Example 1. The reaction system and reaction procedure are shown in Tables 2 and 3. Table 2 Multiplex PCR reaction system

[0027] Table 3 Multiplex PCR reaction procedure

[0028] S3. Purify the PCR product obtained in step S2 using the OMEGA Gel Extraction Kit; S4. Use the Nano DNA Sample Prep Kit to perform end repair, 3' end A addition, and index adapter ligation on the purified PCR product obtained in step S3. S5. The products obtained in S4 were amplified and enriched by PCR using the Nano DNA Sample Prep Kit. The PCR products enriched by the library were purified using the OMEGA Gel Extraction Kit. The purified PCR products were then processed using PicoGreen. ® Nucleic acid dyes were used to quantitatively detect dsDNA, and library quantification was performed on a TBS-380 miniature fluorometer. The reaction system and procedure for library enrichment are shown in Tables 4 and 5. Table 4 Library enrichment PCR reaction system

[0029] Table 5 Library enrichment reaction procedure

[0030] S6. Bridge PCR is performed on a cBot system using a Truseq PE Cluster Kit v3-cBot-HS cluster generation kit to amplify single DNA molecules into clusters; S7. 2*150 bp sequencing is performed on an Illumina Hiseq sequencing platform using a Truseq SBS Kit.

[0031] Example 3 Method performance evaluation In this example, the genomes of 15 camel mastitis pathogenic bacteria were extracted, and tNGS library construction was performed using the primer set of Example 1 and the detection method of Example 2, and sequencing analysis was performed. The detection results are shown in Table 6 and Figs. 1-2 .

[0032] Table 6 Detection results of 15 kinds of camel mastitis pathogenic bacteria

[0033] reads reads higher than 1000 are considered to be detected, and as shown in Table 6, the 15 kinds of camel mastitis pathogenic bacteria in the sample are all normally detected. The primer set, kit and detection method of the present application can be used for detecting the pathogens of camel mastitis, and the detection results are accurate and reliable.

[0034] The above only describes some embodiments of the present application, and for those skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which all belong to the protection scope of the present application.

Claims

1. A primer set for high-throughput targeted detection of pathogens and drug resistance genes of camel mastitis, characterized in that, The primer set consists of 185 pairs of primers with nucleotide sequences shown in SEQ ID NO: 1-370, each pair of primers consisting of an upstream primer and a downstream primer, and the 185 pairs of primers being used to amplify camel mastitis pathogen target genes and drug resistance genes.

2. The primer set for high-throughput targeted detection of pathogen and drug resistance gene of camel mastitis according to claim 1, characterized in that, The 185 pairs of primers are respectively for 20 kinds of camel mastitis pathogen target genes and 77 kinds of drug resistance genes, and each pathogen target gene or drug resistance gene is provided with 1-2 pairs of primers.

3. The primer set for high-throughput targeted detection of pathogen and drug resistance gene of camel mastitis according to claim 1, characterized in that, The odd number sequence in each pair of primers is an upstream primer, and the even number sequence in each pair of primers is a downstream primer, and the upstream primer and the downstream primer both have an index adapter sequence.

4. The primer set for high-throughput targeted detection of pathogen and drug resistance gene of camel mastitis according to claim 3, characterized in that, The index adapter sequence of the upstream primer is AATGATACGGCGACCACCGAGATCTACAC, and the index adapter sequence of the downstream primer is CAAGCAGAAGACGGCATACGAGAT.

5. Use of the primer set for high-throughput targeted detection of camel mastitis pathogens and drug resistance genes according to any one of claims 1-4 in detection or auxiliary detection of 20 kinds of camel mastitis pathogen target genes and 77 kinds of drug resistance genes for non-disease diagnosis purposes.

6. A kit for high throughput targeted detection of pathogens and drug resistance genes of camel mastitis characterized in that, The kit comprises the primer set for high-throughput targeted detection of camel mastitis pathogens and drug resistance genes according to any one of claims 1-4.

7. The kit for high throughput detection of pathogen and drug resistance genes of camel mastitis according to claim 6, characterized in that, The kit further comprises a DNA extraction kit, a multiplex PCR amplification system, a PCR product recovery and purification kit, a terminal repair and adapter ligation kit, a library enrichment kit, a library purification kit, and a Truseq PE Cluster Kit v3-cBot-HS cluster generation kit.

8. Use of the kit for high-throughput targeted detection of camel mastitis pathogens and drug resistance genes according to any one of claims 6-7 in detection of 20 kinds of camel mastitis pathogen target genes and 77 kinds of drug resistance genes.

9. A method for high-throughput targeted detection of camel mastitis pathogen and drug resistance genes, characterized in that, The method uses the kit for high-throughput targeted detection of camel mastitis pathogens and drug resistance genes according to any one of claims 6-7, and the method is a non-disease diagnosis purpose method, comprising the following steps: S1. DNA extraction; S2. Multiplex PCR amplification using the primer set for high-throughput targeted detection of camel mastitis pathogens and drug resistance genes according to any one of claims 1-4; S3. Recovery and purification of the PCR product of step S2 using a PCR product recovery and purification kit; S4. Terminal repair, 3' end A addition, and index adapter ligation using a Nano DNA Sample Prep Kit; S5. Library enrichment, library purification, and library quantification; S6. Bridge PCR using a Truseq PE Cluster Kit v3-cBot-HS cluster generation kit to amplify individual DNA molecules into clusters; S7. High-throughput sequencing.

10. The method of claim 9, wherein the method is a high-throughput method for detecting pathogens and drug resistance genes of camel mastitis. The concentration of the DNA extracted in step S1 is ≥0.1 ng / uL.

Images