Double-gated tumor gene silencing nano therapeutic agent as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biological medicines, and particularly discloses a double-gated tumor gene silencing nano therapeutic agent as well as a preparation method and application thereof. The double-gated tumor gene silencing nano therapeutic agent is prepared from ZIF-8 nano particles and AL-DNAzyme, wherein the AL-DNAzyme is loaded on the ZIF-8 nano particles; the AL-DNAzyme is a functional nucleic acid with an AP site modified on a catalytic arm of the DNAzyme. The invention discloses a double-gated tumor gene silencing nano therapeutic agent and a preparation method and application thereof, the nano therapeutic agent has high-selectivity tumor cell targeting, gene silencing high efficiency and structural stability, shows excellent application prospects in precise treatment of tumors, and has broad application prospects. A new scheme is provided for solving the problems of poor targeting, strong side effects and the like of traditional gene therapy.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a double-gated tumor gene silencing nano-therapeutic agent and a preparation method and application thereof. BACKGROUND

[0002] Cancer is a major disease that seriously threatens human health. Traditional treatment methods for cancer often cause non-specific damage to normal cells and tissues while killing cancer cells, resulting in serious side effects, significantly reducing the quality of life of patients and limiting the treatment effect. Therefore, developing precise treatment strategies with tumor cell selectivity has become a key requirement in the field of cancer treatment. Gene therapy, with its direct targeting of cancer cell genes, provides a new direction for cancer treatment. Among them, DNAzyme, as a catalytically active nucleic acid molecule, has shown great potential in gene silencing due to its high biological stability and independence from the endogenous RNA interference pathway. However, the clinical application of DNAzyme still faces two major challenges: first, the low cell delivery efficiency makes it difficult to effectively reach the target cells and exert its function; second, the lack of precise activation mechanism easily leads to non-specific reactions in normal cells, and the insufficient supply of auxiliary factors in cells limits the catalytic activity.

[0003] To solve the delivery problem, existing technologies attempt to use liposomes, metal nanoparticles, metal-organic frameworks (MOFs) and other carriers to load DNAzyme. However, the existing carrier systems still have obvious defects: most carriers only achieve physical loading of DNAzyme and do not solve the problem of premature activation in normal cells, resulting in poor targeting and significant side effects; at the same time, the concentration of auxiliary factors released by the carrier is insufficient, making it difficult to efficiently activate the catalytic function of DNAzyme, which limits the gene silencing efficiency. In addition, the abnormal energy metabolism of tumor cells is a key feature of their survival and proliferation, and glucose transporter protein (GLUT-1) as the main mediator of glucose into cells has become an important target for tumor treatment. However, existing gene silencing strategies targeting GLUT-1 often affect the glucose metabolism of normal cells due to the lack of tumor cell specificity, resulting in insufficient treatment safety.

[0004] Therefore, it is of great significance to develop a nano-therapeutic system that can achieve precise delivery of DNAzyme, tumor cell-specific activation, and efficient silencing of GLUT-1 gene, to improve the effectiveness and safety of cancer treatment. SUMMARY

[0005] This invention aims to provide a dual-gated tumor gene silencing nanotherapy agent, its preparation method, and its application. This nanotherapy agent has high selectivity for tumor cell targeting, high efficiency in gene silencing, and structural stability, showing excellent application prospects in precision tumor treatment and providing a new solution to the problems of poor targeting and strong side effects of traditional gene therapy.

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0007] A dual-gated tumor gene silencing nanotherapy agent, comprising ZIF-8 nanoparticles and AL-DNAzyme loaded on the ZIF-8 nanoparticles; wherein the AL-DNAzyme is a functionalized nucleic acid with AP sites modified on the catalytic arm of the DNAzyme.

[0008] Preferably, the AP site can be recognized and cleaved by APE1, which is highly expressed in tumor cells; the ZIF-8 nanoparticles can release Zn in response to the acidic environment of lysosomes. 2+ The Zn 2+ As a cofactor after the AL-DNAzyme is activated, the activated AL-DNAzyme specifically cleaves GLUT-1 mRNA in tumor cells to achieve gene silencing.

[0009] Preferably, the nucleotide sequence of the DNAzyme is shown in SEQ ID NO:1; the nucleotide sequence of the AL-DNAzyme is shown in SEQ ID NO:2.

[0010] Preferably, the nucleotide sequence of the DNAzyme is AGCGAGGCTCCGAGCCGGTCGAAATGAGGTGCA, as shown in SEQ ID NO:1; the nucleotide sequence of the AL-DNAzyme is AGCGAGGCTCCGAGCCGGTCGAAATGAGGTGCATTTTTTTTT GCACCTC / idSp / TTTCGA, where idSp is an AP site modification, as shown in SEQ ID NO:2.

[0011] Preferably, the 5' end of the AL-DNAzyme is modified with a Cy5 fluorophore.

[0012] Preferably, the 5' end of the AL-DNAzyme is modified with a Cy5 fluorophore, the sequence of which is Cy5-AGCGAGGCTCCGAGCCGGTCGAAATGAGGTGCATTTTTT TTTGCACCTC / idSp / TTTCGA, where idSp is an AP site modification.

[0013] Preferably, the GLUT-1 mRNA sequence cleavable by the AL-DNAzyme is shown as SEQ ID NO: 3.

[0014] Preferably, the GLUT-1 mRNA sequence cleavable by the AL-DNAzyme is TGCACCTCAT / rA / / rG / GCCTCGCT, wherein rA and rG are ribonucleotides, as shown in SEQ ID NO: 3.

[0015] The application also provides a preparation method of the nanotherapeutic agent, comprising the following steps:

[0016] S1, mixing an AL-DNAzyme solution with a zinc nitrate hexahydrate solution to obtain a zinc nitrate-DNA solution;

[0017] S2, adding the zinc nitrate-DNA solution obtained in step S1 into a 2-methylimidazole solution, stirring and reacting, centrifuging to collect the product, washing and freeze-drying to obtain AL-DNAzyme@ZIF-8 nanoparticles.

[0018] Preferably, in S1, the concentration of the AL-DNAzyme solution is 30-80 μM, the concentration of the zinc nitrate hexahydrate is 0.01-0.05 mM, and the volume ratio of the AL-DNAzyme solution to the zinc nitrate hexahydrate is 1:2.

[0019] Preferably, in S2, the concentration of the 2-methylimidazole solution is 2.8-3.5 mM, and the volume ratio of the 2-methylimidazole solution to the zinc nitrate-DNA solution is 1:1.

[0020] Preferably, in S2, the stirring temperature is room temperature, the stirring time is 15-30 min, the centrifugation temperature is 4℃, the centrifugation speed is 5000-10000 rpm / min, and the centrifugation time is 10-30 min.

[0021] Preferably, in S2, the freeze-drying temperature is -50℃, and the freeze-drying time is 10 h.

[0022] The application also provides the use of the nanotherapeutic agent in the preparation of an antitumor drug.

[0023] Preferably, the nanotherapeutic agent exerts an antitumor effect in the following manner: APE1 highly expressed in tumor cells cuts the AP site of the AL-DNAzyme, releasing active DNAzyme; the ZIF-8 nanoparticles release a high concentration of Zn 2+As a cofactor, the activated DNAzyme specifically recognizes and silences GLUT-1 mRNA in tumor cells, down-regulates the expression of GLUT-1 to cut off the glucose source of tumor cells, and realizes the starvation treatment of tumor cells.

[0024] The application also provides an anti-tumor drug, which comprises the nano-therapeutic agent and a pharmaceutically acceptable carrier thereof.

[0025] Preferably, the pharmaceutically acceptable carrier is one or more of a solvent, a dispersant, a suspension aid, a surfactant, an isotonic agent, a thickening agent, a preservative, a solid binder or a lubricant.

[0026] Compared with the prior art, the application has the following advantages and technical effects:

[0027] The application discloses a double-gated tumor gene silencing nano-therapeutic agent and a preparation method and application thereof. 2+ The double-gated mechanism significantly reduces non-specific effects on normal cells, solves the problems of poor targeting and strong side effects in traditional gene therapy, and experimental data shows that the toxicity to normal cells is negligible, and the killing efficiency of tumor cells is significantly improved.

[0028] The technical solutions of the application are described in further detail below with reference to the drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 A schematic diagram of the APE1 enzyme-assisted activation of AL-DNAzyme@ZIF-8 gene silencing;

[0030] Figure 2 Characterization results of AL-DNAzyme@ZIF-8 prepared in Example 2, wherein, Figure 2 (A) in the figure is a particle size diagram of ZIF-8 and AL-DNAzyme@ZIF-8, Figure 2 (B) in the figure is a Zeta potential diagram of ZIF-8 and AL-DNAzyme@ZIF-8, Figure 2 (C) in the figure is a TEM image of AL-DNAzyme@ZIF-8, Figure 2 (D) in the figure is an element mapping result of AL-DNAzyme@ZIF-8;

[0031] Figure 3 Zn 2+ The results of the release under acidic conditions, wherein, Figure 3 (A) in the figure is the release of Zn 2+ DNAzyme cleavage reaction after incubation with exogenous Zn Figure 3 (B) in the figure is the determination of Zn 2+ standard curve by ICP-MS, Figure 3 (C) in the figure is the result of inductively coupled plasma mass spectrometry analysis of the release of Zn 2+ from nanoparticles under different pH conditions;

[0032] Figure 4 The results of the release of AL-DNAzyme from AL-DNAzyme@ZIF-8, wherein, Figure 4 (A) in the figure is the standard curve of free Cy5-AL-DNAzyme under different pH values, Figure 4 (B) in the figure is the time-dependent release of Cy5-AL-DNAzyme from Cy5-AL-DNAzyme@ZIF-8 under different pH values;

[0033] Figure 5 The results of the effects of AL-DNAzyme@ZIF-8 and DNAzyme@ZIF-8 on the activity of normal cells and tumor cells under different concentrations, wherein, Figure 5 (A) in the figure is the effect of AL-DNAzyme@ZIF-8 and DNAzyme@ZIF-8 on the activity of HEK293T (normal cells) under different concentrations, Figure 5 (B) in the figure is the effect of AL-DNAzyme@ZIF-8 and DNAzyme@ZIF-8 on the activity of MCF-7 (tumor cells) under different concentrations;

[0034] Figure 6 The results of the effects of AL-DNAzyme@ZIF-8 and DNAzyme@ZIF-8 on the activity of cells after incubation in HEK293T (normal cells) and MCF-7 (tumor cells), wherein, Figure 6 (A) in the figure is the confocal image of HEK293T after incubation with AL-DNAzyme@ZIF-8 and DNAzyme@ZIF-8, respectively, Figure 6 (B) in the figure is a statistical histogram of the proportion of live cells and dead cells after corresponding treatment of HEK293T cells, Figure 6 (C) in the figure is the confocal image of MCF-7 after incubation with AL-DNAzyme@ZIF-8 and DNAzyme@ZIF-8, respectively, Figure 6(D) in the figure is a statistical bar chart showing the percentage of live cells to dead cells after the corresponding treatment. Detailed Implementation

[0035] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0036] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0037] Source of experimental materials:

[0038] In this invention, unless otherwise specified, all other test materials and instruments are conventional test materials in the field and can be purchased through commercial channels.

[0039] The mechanism of APE1 enzyme-assisted activation of AL-DNAzyme@ZIF-8 gene silencing is as follows: Figure 1 As shown.

[0040] Example 1

[0041] A dual-gated tumor gene silencing nanotherapy agent comprises ZIF-8 nanoparticles and AL-DNAzyme loaded on the ZIF-8 nanoparticles; the AL-DNAzyme is a functionalized nucleic acid with AP sites modified on the catalytic arm of the DNAzyme.

[0042] The AP site can be recognized and cleaved by APE1, which is highly expressed in tumor cells; the ZIF-8 nanoparticles can release Zn in response to the acidic environment of lysosomes. 2+ Zn 2+ As a cofactor after AL-DNAzyme activation, it enables the activated AL-DNAzyme to specifically cleave GLUT-1 mRNA in tumor cells to achieve gene silencing.

[0043] The nucleotide sequence of DNAzyme is AGCGAGGCTCCGAGCCGGTCGAAATGAGGTGCA, as shown in SEQ ID NO:1.

[0044] The nucleotide sequence of the AL-DNAzyme is AGCGAGGCTCCGAGCCGGTCGAAATGAGGTGCATTTTTTTTTGCACCTC / idSp / TTTCGA, where idSp is an AP site modification, as shown in SEQ ID NO:2.

[0045] The 5' end of the AL-DNAzyme is modified with a Cy5 fluorophore, and the sequence is Cy5-AGCGAGGCTCCGAGCCGGTCGAAATGAGGTGCATTTTTTTTTGCACCTC / idSp / TTTCGA, wherein idSp is an AP site modification.

[0046] The sequence of the GLUT-1 mRNA that can be cleaved by the AL-DNAzyme is TGCACCTCAT / rA / / rG / GCCTCGCT, wherein rA and rG are ribonucleotides, as shown in SEQ ID NO: 3.

[0047] The sequence of the L-cDNAzyme without an AP response site is AGCGAGGCTCCGAGCCGGTCGAAATGAGGTGCATTTTTTTTTGCACCTCATTTCGA, as shown in SEQ ID NO: 4.

[0048] Example 2

[0049] A preparation method of a double-gated tumor gene silencing nanotherapeutic agent, comprising the following steps:

[0050] S1, mixing an AL-DNAzyme solution 50 μM with a zinc nitrate hexahydrate solution 0.05 mM to obtain a zinc nitrate-DNA solution; the volume ratio of the AL-DNAzyme solution to the zinc nitrate hexahydrate solution is 1:2;

[0051] S2, adding the zinc nitrate-DNA solution obtained in step S1 to a 2-methylimidazole solution 2.8 mM, the volume ratio of the 2-methylimidazole solution to the zinc nitrate-DNA solution is 1:1, stirring at room temperature for 20 min, collecting the precipitate after centrifugation at 8000 rpm / min for 10 min at 4°C, washing the precipitate with an ethanol aqueous solution three times, placing it in a freeze dryer to cool to-50°C for 10 h, and weighing to obtain AL-DNAzyme@ZIF-8 nanoparticles.

[0052] The AL-DNAzyme@ZIF-8 prepared in Example 2 was tested for performance by the following tests.

[0053] 1. Structural characterization

[0054] The AL-DNAzyme@ZIF-8 prepared in Example 2 was characterized by DLS and scanning electron microscopy, and the results are shown in Figure 2 .

[0055] As can be seen from Figure 2 , the AL-DNAzyme@ZIF-8 nanoparticles were successfully prepared.

[0056] 2. Release of Zn under acidic conditions2+ Experiments, the specific test scheme as follows:

[0057] 8% non-denaturing polyacrylamide gel configuration: (1) the vertical gel electrophoresis mold is built, and make sure that its device will not leak in the subsequent gel preparation process. (2) take 25 mL beaker, wash, add 5.27 mL ultrapure water, 2 mL 5xTBE, 2.66 mL 30% acrylamide solution, 70 μL ammonium persulfate and 7 μL tetramethyl ethylenediamine, mix well, quickly add to the already assembled vertical gel electrophoresis mold, insert 1 mm thick 11 hole comb. Put it in a place with high temperature for 30 minutes, and observe whether the remaining gel in the beaker is solidified. When the gel is completely solidified, pull out the comb, wash twice with 1xTBE buffer to remove the unreacted polyacrylamide and broken gel in the sample well, at the same time fill the well with 1xTBE buffer, then sample.

[0058] Sample processing: first verified the Zn 2+ dependent DNAzyme cleavage activity of the substrate, DNAzyme (final concentration of 1 μM) and substrate chain (final concentration of 2 μM) were mixed in equal volume, then different concentrations of Zn 2+ solution (0-400 μM) was added, and the mixture was incubated at 37℃ for 4h.

[0059] Analysis of the effect of DNAzyme@ZIF-8 on the release of Zn 2+ DNAzyme cleavage efficiency, different concentrations of DNAzyme@ZIF-8 (100 μg / mL, 200 μg / mL) were dissolved in different pH PBS (pH 7.4, pH 6.5, pH 5.0) and incubated at 37℃ for 6h. The incubated DNAzyme@ZIF-8 was incubated with GLUT1 substrate chain with a final concentration of 500 nM at 37℃ for 5h.

[0060] Sample loading and electrophoresis: After incubation, thoroughly mix the DNA sample (8 μL) with 2 μL of 6× loading buffer on a disposable polyethylene (PE) glove. Inject the sample into the wells of the gel filled with buffer using a microsyringe. Then, place the loaded vertical gel electrophoresis mold into the electrophoresis tank, add an appropriate amount of 1×TBE electrophoresis buffer until it covers the wells, cover the electrophoresis tank, and pay attention to the electrode order. Set the voltage to 90V and the time to 90min, and observe the band positions appropriately during the gel run. After electrophoresis, remove the vertical gel electrophoresis mold, separate the gel from the glass plate without grooves, and place it in the prepared Gel Red staining solution (3 μL Gel Red, 3 mL 0.1M NaCl, 27 mL ultrapure water). Shake at 110 rpm for 30 min in the dark, and image using a Bio-Rad ChemiDoc XRS gel imaging system.

[0061] Study of Zn using ICP-MS 2+ The release of Zn was determined using the following experimental protocol: AL-DNAzyme@ZIF-8 powder was divided into three portions and dispersed in HEPES buffer solutions of different pH values ​​(pH 7.4, pH 6.5, and pH 5.0), and gently shaken at 37°C for 12 h. Subsequently, the buffer solutions at the three different pH values ​​were simultaneously centrifuged (11000 rpm / min, 10 min), and the Zn concentration in the supernatant of the nanoparticles at different pH values ​​was determined using ICP-MS (Thermo Fisher iCAP RQ Analyst). 2+ The concentration was determined, and all experiments were repeated three times. The results were as follows: Figure 3 As shown.

[0062] Depend on Figure 3 It can be seen that this AL-DNAzyme@ZIF-8 can release Zn under acidic conditions. 2+ To provide corresponding cofactors for subsequent gene silencing therapy.

[0063] 3. Experiment on APE1 enzyme-specific activation and release of DNAzyme:

[0064] A standard curve for Cy5-AL-DNAzyme was established. Cy5-AL-DNAzyme solutions of varying concentrations (10 nM, 20 nM, 40 nM, 60 nM, 80 nM, and 100 nM) were prepared under different pH conditions (pH 7.4, pH 6.5, and pH 5.0). The fluorescence intensity of different concentrations of Cy5-AL-DNAzyme at 664 nm was measured using a multi-mode microplate reader. A linear regression equation was established by plotting the concentration gradient on the x-axis and the measured fluorescence values ​​on the y-axis to obtain the standard curve.

[0065] AL-DNAzyme@ZIF-8 nanocarriers were prepared. The concentration of AL-DNAzyme released from AL-DNAzyme@ZIF-8 at different pH values ​​was detected by fluorescence detection. AL-DNAzyme@ZIF-8 (200 μg / mL) was dispersed in PBS at pH 7.4, pH 6.5, and pH 5.0. The solutions were centrifuged (11000 rpm / min, 10 min) at specified time points (0, 0.2 h, 0.5 h, 1 h, 2 h, 4 h, 6 h, 8 h, 10 h, 12 h), and the supernatant was collected. The fluorescence intensity was measured using a multi-functional microplate reader with an excitation wavelength of 640 nm and an emission wavelength of 664 nm. All experiments were repeated three times. The results are shown below. Figure 4 .

[0066] Depend on Figure 4 It is known that AL-DNAzyme@ZIF-8 has a good response to acidic environment and can specifically release AL-DNAzyme.

[0067] 4. Experiments on selective gene silencing therapy for tumor cells

[0068] MTT assay for cell viability: First, 2-methylimidazole solutions of different concentrations (10 μg / mL, 20 μg / mL, 30 μg / mL, 40 μg / mL) and 500 nM zinc nitrate-DNA solution were mixed by shaking and incubated to synthesize a nanoparticle complex (AL-DNAzyme@ZIF-8). HEK293T normal cells, L-cDNAzyme@ZIF-8 (DNAzyme without AP response sites), and pure DNAzyme@ZIF-8 (AP sites cleaved) were used as controls. Subsequently, MCF-7 cells and HEK293T cells were cultured at 1×10⁻⁶ cells / mL. 4 Cells were seeded in 96-well plates and cultured in 100 μL of fresh complete culture medium for 24 h. An equal volume of PBS buffer was added to the wells surrounding the cells to maintain a humid environment. After adhesion, 10 μL of different concentrations of the nanoparticle complex were added to each well, and the plates were incubated in a 5% CO2 incubator at 37°C. After 24 h of incubation, the plates were incubated in 100 μL of fresh LDMEM / 1640 culture medium containing 20 μL LTT reagent at 37°C for 4 h. Following incubation, the 96-well plates were placed in a full-wavelength scanning multi-functional microplate reader (Thermo / Varioskan LUX), and after shaking for 10 min, the absorbance at 490 nm was measured in each well. Each concentration was measured in triplicate. Cell viability (%) was calculated using the following formula, with the control group having a cell viability of 100%.

[0069] Cell survival rate = [sample absorbance (490 nm) - blank absorbance (490 nm)] / [reference absorbance (490 nm) - blank absorbance (490 nm)] x 100%; the results are as follows Figure 5 .

[0070] It can be seen from Figure 5 that the AL-DNAzyme@ZIF-8 has strong tumor cell killing effect and low toxicity to normal cells.

[0071] 5. Live and dead cell staining experiment

[0072] MCF-7 cells and HEK293T cells were inoculated in confocal dishes (1x10 5 cells per dish), and 1 mL of medium was added for incubation, and the cells were grown to about 90% for use. Then, the cells were treated with medium containing AL-DNAzyme@ZIF-8 (APE1 enzyme site-locked DNAzyme) at a final concentration of 30 μg / mL, and cells without nanoparticles and L-cDNAzyme@ZIF-8 (DNAzyme without AP response site) and pure DNAzyme@ZIF-8 at the same concentration were used as control groups, and incubated at 37°C for 24 h. The above medium was removed, and washed twice with PBS, and then medium containing Calcein AM (live cell stain) / PI (dead cell stain) was added to the confocal dish for incubation for 30 min. Finally, after washing twice with PBS, the fluorescence images of the cells were captured using an Olympus FV3000 confocal scanning system with a 20x objective lens, and the results are as follows Figure 6 .

[0073] It can be seen from Figure 6 that the AL-DNAzyme@ZIF-8 can mediate the AL-DNAzyme to silence the cancer cells through Zn 2+ mediated AL-DNAzyme, achieving the effect of low cytotoxicity to normal cells and strong killing effect to cancer cells, which indicates that it has strong tumor cell targeting recognition ability and strong tumor cell killing effect.

[0074] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application and not to limit them, although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can still be modified or replaced by equivalents, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.

Claims

1. A dual-gated tumor gene silencing nanotherapy agent, characterized in that, The nanotherapeutic agent comprises ZIF-8 nanoparticles and AL-DNAzyme loaded on the ZIF-8 nanoparticles; the AL-DNAzyme is a functionalized nucleic acid with AP sites modified on the catalytic arm of the DNAzyme.

2. The nanotherapy agent according to claim 1, characterized in that, The AP site can be recognized and cleaved by APE1, which is highly expressed in tumor cells; the ZIF-8 nanoparticles can release Zn in response to the acidic environment of lysosomes. 2+ The Zn 2+ As a cofactor after the AL-DNAzyme is activated, the activated AL-DNAzyme specifically cleaves GLUT-1 mRNA in tumor cells to achieve gene silencing.

3. The nanotherapy agent according to claim 1, characterized in that, The nucleotide sequence of the DNAzyme is shown in SEQ ID NO:1; the nucleotide sequence of the AL-DNAzyme is shown in SEQ ID NO:

2.

4. The nanotherapy agent according to claim 1, characterized in that, The 5' end of the AL-DNAzyme is modified with a Cy5 fluorophore.

5. The nanotherapy agent according to claim 1, characterized in that, The AL-DNAzyme-cleavable GLUT-1 mRNA sequence is shown in SEQ ID NO:

3.

6. A method for preparing a nanotherapeutic agent as described in any one of claims 1-5, characterized in that, Includes the following steps: S1. Mix the AL-DNAzyme solution with zinc nitrate hexahydrate solution to obtain zinc nitrate-DNA solution; S2. Add the zinc nitrate-DNA solution obtained in step S1 to the 2-methylimidazole solution, stir the reaction, centrifuge to collect the product, wash and freeze-dry to obtain AL-DNAzyme@ZIF-8 nanoparticles.

7. The use of a nanotherapeutic agent as described in any one of claims 1-6 in the preparation of an antitumor drug.

8. The application according to claim 7, characterized in that, The nanotherapeutic agent exerts its anti-tumor effect through the following mechanisms: APE1, highly expressed within tumor cells, cleaves the AP site of AL-DNAzyme, releasing active DNAzyme; ZIF-8 nanoparticles release high concentrations of Zn in an acidic lysosomal environment. 2+ As a cofactor, the activated DNAzyme specifically recognizes and silences GLUT-1 mRNA in tumor cells, downregulating GLUT-1 expression to cut off the glucose source of tumor cells and achieve starvation therapy for tumor cells.

9. An antitumor drug, characterized in that, The drug comprises the nanotherapeutic agent of claim 1 and its pharmaceutically acceptable carrier.

10. The drug according to claim 9, characterized in that, The pharmaceutically acceptable carrier is one or more of the following: solvent, dispersant, suspending agent, surfactant, isotonic agent, thickener, preservative, solid binder or lubricant.

Images