Morganella morganii YC12-C3 and application thereof

By co-culturing Morganella morganii YC12-C3 with DON under specific conditions, the problem of the difficulty in degrading DON toxin in Coix seed was solved, achieving a highly efficient biological detoxification effect and providing a new safety guarantee for Coix seed medicinal materials.

CN121203884APending Publication Date: 2025-12-26GUIYANG COLLEGE OF TRADITIONAL CHINESE MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511533116.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-24
Publication Date
2025-12-26

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively degrade deoxynivalenol (DON) toxin, which is widely present in coix seed, thus affecting food and drug safety. Traditional methods have limitations.

Method used

Morganella morganii YC12-C3 was co-cultured with DON in a specific culture medium, and the culture conditions (LB liquid medium, culture time 24 h, temperature 28℃, pH 7, inoculum size 1%) were optimized to achieve efficient degradation of DON.

Benefits of technology

Morganella morganii YC12-C3 achieved a DON degradation rate of up to 93.23% under optimal conditions, providing an effective solution for the biological detoxification of DON in Coix seed.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 84EECVC9ELV6IWKHPQU8QTXPKEY3AWE9DP7TZV4V
    Figure 84EECVC9ELV6IWKHPQU8QTXPKEY3AWE9DP7TZV4V
  • Figure CCHCHIWHTJTBVKDRAGANFI3NXORZBUYNJNWKIBBH
    Figure CCHCHIWHTJTBVKDRAGANFI3NXORZBUYNJNWKIBBH
  • Figure FEJH208JQUM5SLMNBBX64QBRQ3MDBPNRRLJBL7SR
    Figure FEJH208JQUM5SLMNBBX64QBRQ3MDBPNRRLJBL7SR
Patent Text Reader

Abstract

The invention relates to the technical field of microbial detoxification of traditional Chinese medicinal materials, in particular to Morganella morganii YC12-C3 and application thereof. The Morganella morganii YC12-C3 is preserved in the China Center for Type Culture Collection on December 2, 2024, and the preservation number of the Morganella morganii YC12-C3 is CCTCC (China Center for Type Culture Collection) NO: M 20242689. The application specifically comprises the following steps: co-culturing the Morganella morganii YC12-C3 and deoxynivalenol (DON) in a culture medium, and degrading the DON. The detoxification rate of the Morganella morganii YC12-C3 on DON toxin in coix seeds reaches 68.89%, new strain resources and application technology reference are provided for biological detoxification of DON in medical and edible dual-purpose coix seeds, and the Morganella morganii YC12-C3 has important significance for guaranteeing the food and medicine safety of coix seeds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial detoxification technology of traditional Chinese medicine, specifically involving a strain of Morganella morganii YC12-C3 and its application. Background Technology

[0002] Mycotoxins are secondary toxic metabolites produced by fungi. Deoxynivalenol (DON) is one of the most widespread and influential mycotoxins in the world. It is commonly found in grains such as wheat and corn and is a secondary metabolite produced by fungi such as Fusarium graminearum and Fusarium flavum. It has strong toxic effects on humans and animals and poses a serious threat to human and animal health.

[0003] Job's tears, the dried, mature seed kernel of *Coix lacryma-jobi* L. var. *mayuen* (Roman.) Stapf, an annual plant belonging to the genus *Coix* of the Poaceae family, is a common traditional Chinese medicine used both as food and medicine, with a huge usage and wide application in my country. The mature seed kernels of Job's tears are rich in starch and oils, making them highly susceptible to contamination by fungal toxins during processing and storage. Deoxynivalenol (DEN) is one of the most seriously contaminated fungal toxins in commercially available Job's tears, severely impacting its food and medicinal safety. Therefore, there is an urgent need to find green and efficient degradation technologies.

[0004] Traditional detoxification methods for DON contamination in medicinal herbs and grains include physical and chemical methods, but both have limitations. Biodegradation methods, on the other hand, offer advantages such as environmental friendliness and high efficiency, showing promising application prospects. Reducing mycotoxin contamination through microbial detoxification has become a research hotspot in the field of mycotoxin detoxification. For example, the literature "Identification and Degradation Effect of a Bacillus subtilis Strain Degrading Vomitoxin"... [1] A strain of Bacillus subtilis isolated from contaminated corn, named NHIBC006D, was disclosed. Through fermentation culture and vomitoxin addition experiments, it was found that this strain secretes an extracellular protein that can effectively degrade vomitoxin, with a maximum degradation rate of 73.5%. Simultaneously, the fermentation broth of this strain achieved a degradation rate of approximately 80% for vomitoxin in corn steep liquor, providing a possibility for the biodegradation of vomitoxin in fermented foods and feed. Currently, no research has been reported on the degradation of DON toxin in Job's tears using microbial detoxification methods.

[0005] Based on the above problems, this invention provides a strain of Morganella morganii YC12-C3 and its application in removing DON toxin from Coix seed, aiming to control DON toxin contamination in the Chinese medicinal herb Coix seed, ensure the food and medicinal safety of Coix seed, and provide a reference for the development of efficient DON detoxification technology and detoxification preparations. Summary of the Invention

[0006] The purpose of this invention is to provide a strain of Morganella morganii YC12-C3 and its application in the degradation of deoxynivalenol toxins from Fusarium oxysporum.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The Morganella morganii YC12-C3 described in this invention was deposited at the China Center for Type Culture Collection on December 2, 2024, with accession number CCTCCNO:M20242689.

[0008] The application of Morganella morganii YC12-C3 described in this invention in the degradation of deoxynivalenol toxins by Fusarium oxysporum.

[0009] Preferably, the application of Morganella morganii YC12-C3 in the degradation of deoxynivalenol toxins of the present invention is specifically as follows: Morganella morganii YC12-C3 and deoxynivalenol toxins are co-cultured in a culture medium to degrade deoxynivalenol toxins.

[0010] In a further preferred embodiment, in the application of Morganella morganii YC12-C3 of the present invention in the degradation of deoxynivalenol toxins by Fusarium oxysporum, the culture medium is any one of LB, YPG, GYT, NA, or SOC liquid culture medium.

[0011] In a further preferred embodiment of the present invention, the application of Morganella morganii YC12-C3 in the degradation of deoxynivalenol toxins by Fusarium oxysporum is carried out in LB liquid medium.

[0012] Preferably, in the application of Morganella morganii YC12-C3 of the present invention in the degradation of deoxynivalenol toxins, the co-culture conditions are as follows: culture time of 0-72 h, culture temperature of 15-45 °C, initial pH of culture medium of 4-10, and inoculum size of 0.5-10%.

[0013] In a further preferred embodiment, the co-culture conditions for the application of Morganella morganii YC12-C3 of the present invention in the degradation of deoxynivalenol toxins are as follows: culture time of 12-36 h, culture temperature of 15-37 °C, initial pH of culture medium of 5-9, and inoculum size of 0.5-5%.

[0014] In a further preferred embodiment, the co-culture conditions for the application of Morganella morganii YC12-C3 in the degradation of deoxynivalenol toxins are as follows: culture time of 24 h, culture temperature of 28 °C, initial pH of culture medium of 7, and inoculum size of 1%.

[0015] The inoculum amount mentioned in this invention is the bacterial culture (OD) value. 600 The value is 1.0) as a percentage of the volume of the culture medium.

[0016] Preferably, the application of Morganella morganii YC12-C3 of the present invention in the degradation of deoxynivalenol toxins in grains or medicinal materials.

[0017] More preferably, the application of Morganella morganii YC12-C3 of the present invention in the degradation of deoxynivalenol toxins in coix seed.

[0018] The beneficial effects of this invention are: 1. This invention screened out a strain of *Morganella morganii* YC12-C3 capable of efficiently degrading deoxynivalenol (DON). When co-cultured with DON toxin in a culture medium, it was able to degrade DON. By investigating the effects of different culture conditions on the strain's degradation ability, the optimal culture conditions were determined to be: LB liquid medium, initial pH of 7, culture time of 24 h, culture temperature of 28 °C, and inoculum size of 1%. Under these optimal culture conditions, *Morganella morganii* YC12-C3 degraded 2.0 μg·mL⁻¹ of DON. -1 The degradation rate of DON reached as high as 93.23%, indicating that this bacterium can efficiently degrade DON, enriching the DON-degrading bacterial resource library. Furthermore, this invention, through analysis of the degradation of DON by different active components of the strain and structural analysis of the degradation products, preliminarily elucidates the DON detoxification mechanism.

[0019] 2. The Morganella morganii YC12-C3 detoxification strain provided by this invention, under the optimal culture conditions of this study, achieved a degradation rate of up to 68.89% for deoxynivalenol in Coix seed powder containing DON toxin. This indicates that the bacterium has a good removal effect on DON in Coix seed, providing a new strain resource and application technology reference for the biological detoxification of DON in Coix seed, which is used for both medicinal and edible purposes, and laying the foundation for the development of DON-degrading bacterial preparations.

[0020] Microbial Preservation Information: Strain name: Morganella morganii YC12-C3; Preservation institution: China Center for Type Culture Collection (CCTCC); Address for deposit: No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, Postcode: 430072; Deposit date: December 2, 2024; Accession number: CCTCCNO:M20242689. Attached Figure Description

[0021] Figure 1 Screening of DON-degrading bacterial strains in the intestines of crucian carp (Figure: A represents the DON degradation rate of bacterial solutions in groups YC1~YC12; B represents the DON degradation rate of bacterial solutions in groups YC12-A~YC12-H; C represents the DON degradation rate of bacterial solutions in groups YC12-C1~YC12-C12; D represents the HPLC chromatograms of different treatment groups). Figure 2 Identification of DON-degrading strains (in the figure: A is the morphological identification of strain YC12-C3; B is the Gram staining result of strain YC12-C3; C is the phylogenetic tree of strain YC12-C3). Figure 3 The effects of different culture conditions on the degradation ability of DON in the lysate of Morganella morganii YC12-C3 cells were investigated (in the figure: A shows the effect of different culture media on the degradation ability of the strain; B shows the effect of different culture times on the degradation ability of the strain; C shows the effect of different inoculum sizes on the degradation ability of the strain; D shows the effect of different initial pH values ​​of different culture media on the degradation ability of the strain; and F shows the growth curve of the YC12-C3 strain). Figure 4 Mass spectrometry analysis of degradation products of strain YC12-C3 after treatment with DON and speculation on detoxification mechanism (Figure: A is the mass spectrometry detection spectrum of different treatment groups; B is the mass spectrometry detection spectrum of degradation products; C is a schematic diagram of degradation mechanism). Detailed Implementation

[0022] The technical solution of the present invention will be described in detail below with reference to specific embodiments. The following embodiments are for explanation and illustration only, and do not constitute a limitation on the technical solution of the present invention.

[0023] Example 1 Detoxified Morganella morganii YC12-C3 strain and DON toxin were co-cultured in LB liquid medium for 24 h at 28℃ with an initial pH of 7.0 and an inoculum size of 1.0% to degrade deoxynivalenol.

[0024] Example 2 Detoxified Morganella morganii YC12-C3 strain and DON toxin were co-cultured in SOC liquid medium for 24 h at 28℃ with an initial pH of 7.0 and an inoculum size of 1.0% to degrade deoxynivalenol.

[0025] Example 3 Detoxified Morganella morganii YC12-C3 strain and DON toxin were co-cultured in LB liquid medium for 12 h at 28℃ with an initial pH of 7.0 and an inoculum size of 1.0% to degrade deoxynivalenol.

[0026] Example 4 Detoxified Morganella morganii YC12-C3 strain and DON toxin were co-cultured in LB liquid medium for 36 h at 28℃ with an initial pH of 7.0 and an inoculum size of 1.0% to degrade deoxynivalenol.

[0027] Example 5 Detoxified Morganella morganii YC12-C3 strain and DON toxin were co-cultured in LB liquid medium for 24 h at 15℃ with an initial pH of 7.0 and an inoculum size of 1.0% to degrade deoxynivalenol.

[0028] Example 6 Detoxified Morganella morganii YC12-C3 strain and DON toxin were co-cultured in LB liquid medium for 24 h at 37℃ with an initial pH of 7.0 and an inoculum size of 1.0% to degrade deoxynivalenol.

[0029] Example 7 Detoxified Morganella morganii YC12-C3 strain and DON toxin were co-cultured in LB liquid medium for 24 h at 28℃ with an initial pH of 5.0 and an inoculum size of 1.0% to degrade deoxynivalenol.

[0030] Example 8 Detoxified Morganella morganii YC12-C3 strain and DON toxin were co-cultured in LB liquid medium for 24 h at 28℃ with an initial pH of 9.0 and an inoculum size of 1.0% to degrade deoxynivalenol.

[0031] Example 9 Detoxified Morganella morganii YC12-C3 strain and DON toxin were co-cultured in LB liquid medium for 24 h at 28℃ with an initial pH of 7.0 and an inoculum size of 0.5% to degrade deoxynivalenol.

[0032] Example 10 Detoxified Morganella morganii YC12-C3 strain and DON toxin were co-cultured in LB liquid medium for 24 h at 28℃ with an initial pH of 7.0 and an inoculum size of 5.0 to degrade deoxynivalenol.

[0033] Example 11 Detoxified Morganella morganii YC12-C3 strain was co-cultured with Coix seed powder containing DON toxin on LB medium for 24 h at a temperature of 28℃, an initial pH of 7.0, and an inoculum size of 1.0% to degrade deoxynivalenol toxin in Coix seed.

[0034] To further verify the reliability of the present invention and select the optimal solution, the inventors conducted a series of experiments, as follows: 1. Materials and Methods 1.1 Source of Materials The intestinal contents of artificially cultured crucian carp were used to construct a microbial bacterial library.

[0035] 1.2 Instruments and Reagents The main instruments and reagents are listed in Tables 1-2.

[0036] ; ; 1.3 Isolation and Screening of Degrading Bacteria 1.3.1 Preparation of DON reference standard and isolation of bacterial strain Take an appropriate amount of methanol and add it in three portions to a vial containing 5 mg of DON standard (5.0 mg / vial) until fully dissolved. Transfer the solution to a 50 mL volumetric flask and dilute to volume with methanol to obtain a concentration of 100 µg / mL. -1 The DON standard solution was sealed and stored at -20°C for later use.

[0037] Intestinal samples were collected from healthy crucian carp and washed with six different buffer solutions (stock homogenate, LB+ homogenate, LB+PBS, H2O+PBS, Met+LB, and Met+PBS) for 30 min with shaking, followed by 10 min of standing. The supernatant was serially diluted with sterile water and spread onto LB agar plates, incubated at 28°C upside down for 48 h. Single colonies of different morphologies were picked and streaked onto LB agar plates for purification. The purified single strains were inoculated into LB liquid medium and incubated at 28°C with shaking for 24 h. The purified bacterial solution was used for screening DON-degrading bacteria and stored at 4°C for later use.

[0038] 1.3.2 HPLC detection of DON Referring to the HPLC-SPD detection conditions for the mycotoxin DON in Part IV of the Chinese Pharmacopoeia, the DON content was determined using a Shimadzu LC-20AD high-performance liquid chromatograph. The chromatographic column was an Ultimate ODS-3 column (4.0 × 250 mm, 5 μm), the mobile phase was methanol:water = 20:80 (V / V), the UV detection wavelength was 220 nm, the column temperature was 30℃, the injection volume was 10 μL, and the flow rate was 1 mL·min. -1 .

[0039] 1.3.3 Screening of DON-degrading bacteria The strains isolated and purified from the intestines of crucian carp were divided into 12 groups (YC1~YC12, totaling 96 strains / group). 2 μL of bacterial suspension from each group was inoculated into a solution containing 2.0 μg·mL⁻¹ of... -1 The DON toxin was mixed by inversion in 1278 μL of liquid LB medium as the treatment group; LB liquid medium containing the same concentration of DON toxin but without bacterial inoculation and LB liquid medium with bacterial inoculation were used as the control group. After inoculation, all media were placed in an incubator at 28℃ and 180 r·min. -1 Incubate under shaking conditions for 72 h at 12000 r·min -1 Centrifuge for 10 min, collect the supernatant and extract with 600 μL of ethyl acetate at 12000 r·min. -1 After centrifugation for 10 min, 500 μL of the supernatant was filtered through a 0.22 μm microporous membrane. The residual DON content was detected by HPLC, and the mixed bacterial strains with the highest DON degradation rate were initially screened. These were then divided into groups A through H, totaling 8 mixed bacterial groups (12 strains / group). After co-culturing for 3 days, the DON content was measured, and the mixed bacterial group with the highest degradation efficiency was analyzed for degradation. The mixed bacterial group with the best degradation efficiency was further divided into groups 1 through 12 (1 strain / group) for secondary screening. After co-culturing for 3 days, the DON content was measured, and the degradation effect of single strains was analyzed. Finally, the single strain with the highest degradation rate was selected for subsequent experimental studies.

[0040] ; 1.4 Identification of DON-degrading bacteria 1.4.1 Morphological observation of DON-degrading strains The selected YC12-C3 degrading strain was activated for 24 h. 10 μL of the bacterial solution was diluted 106 times, and 10 μL of the diluted bacterial solution was evenly spread on LB solid culture plates. The plates were incubated upside down in a constant temperature incubator at 25℃ for 48 h. The colony growth morphology was observed and photographed.

[0041] 1.4.2 Gram staining of DON-degrading strains YC12-C3 degrading bacteria were inoculated into LB liquid culture medium and incubated at 180 r·min -1 The cells were cultured at 28°C with constant shaking for 12 hours, and Gram staining was performed according to the Microbiology Experimental Handbook edited by Shen Ping. [2] If the tested strain turns red, it is a Gram-negative bacterium; if it turns blue-purple, it is a Gram-positive bacterium.

[0042] 1.4.3 Molecular biological identification of DON-degrading strains (1) Extraction of DNA from the degrading strain: The bacterial culture of the degrading strain YC12-C3 was inoculated into a conical flask containing 100 mL of LB liquid medium and incubated at 28℃ and 180 r·min. -1 Incubate under shaking conditions for 12 h. Transfer 2 mL of bacterial culture to a 2 mL EP tube and incubate at 12000 r·min. -1 Centrifuge for 10 min, discard the supernatant, and repeat 5 times. Collect the bacterial cells from the 5 collections for DNA extraction, following the CTAB method. [3] DNA was extracted from the degrading strain.

[0043] (2) PCR amplification of the bacterial V3V4 region, primer sequences: 27F (AGAGTTTGATCCTGGCTCAG); 1492R (TACGGYTACCTTGTTACGACTT). PCR reaction system (25 μL): Easy Taq DNA Polymerase 0.5 μL, 10×Easy Taq buffer 2.5 μL, 2.0 mM dNTPs 2 μL, 10 μM 27F and 1492R 0.5 μL each, template DNA 0.5 μL, ddH2O added to make up the volume. PCR reaction conditions: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 60 s, 35 cycles; final extension at 72°C for 5 min. The amplified products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0044] (3) Phylogenetic analysis of degrading strains: The V3V4 sequences of the sequencing strains were obtained by online BLAST through NCBI (http: / / www.ncbi.nlm.nih.gov / ) and homology comparison analysis was performed. The first 15 or so gene sequences with high homology and different species in the same genus were downloaded and the phylogenetic tree was constructed and analyzed using MEGA 11 software with the Neighbour-Joining (NJ) method.

[0045] 1.5 Determination of DON-degrading active components in Morganella morganii YC12-C3 The degrading bacterial culture of strain YC12-C3 was inoculated into a 100 mL Erlenmeyer flask containing LB liquid medium and incubated at 28 °C and 180 rpm. -1 Cultured under shaking conditions for 2 days, then OD was adjusted. 600 The value was 1.0. Two mL of bacterial culture were taken and centrifuged, then processed as follows: 1) The supernatant was filtered through a 0.22 μm microporous membrane to obtain the extracellular fluid group; 2) The lower layer of bacteria was washed three times with PBS buffer, resuspended, and then disrupted using a cell disruptor for 20 min at 12000 r·min. -1 Centrifuge, aspirate the supernatant and filter through a 0.22 μm microporous membrane to obtain the intracellular solution group; 3) Wash the lower layer of bacterial cells three times with PBS buffer and resuspend to obtain the bacterial cell solution group. Co-culture the treated sample with DON toxin under the optimized degradation conditions, and detect the degradation ability of each component for DON by HPLC to preliminarily determine the components responsible for the degradation by the strain.

[0046] The extracellular fluid of *Morganella morganii* strain YC12-C3 was filtered through a 0.22 μm microporous membrane to obtain the bacterial extracellular fluid. The extracellular fluid was then treated as follows: 1) no treatment; 2) boiling water bath for 30 min; 3) proteinase K added, water bath at 58°C for 30 min; 4) proteinase K and SDS added, water bath at 58°C for 30 min; 5) SDS added, water bath at 58°C for 30 min. The bacteria were co-cultured with DON under the optimized degradation conditions, and the degradation capacity of each component for DON was determined by HPLC.

[0047] 1.6 Effects of different culture conditions on the degradation ability of the strain 1.6.1 Determination of the growth curve of Morganella morganii YC12-C3 Take the activated YC12-C3 degrading strain bacterial solution and adjust the OD of the bacterial solution. 600 The value was 1.0. 10 μL of bacterial culture was inoculated into an EP tube containing 1 mL of liquid LB medium and incubated at 28°C and 180 r·min. -1 Under the conditions of shaking culture, samples were taken at 0 h, 2 h, 4 h, 8 h, 12 h, 16 h, 20 h, 24 h, 48 h, 60 h, and 72 h to measure the absorbance OD. 600 Growth curves were plotted to determine the logarithmic growth phase of the YC12-C3 degrading bacteria.

[0048] 1.6.2 Optimize the degradation conditions of DON by the strain 1.6.2.1 Effects of different culture media on the degradation ability of the strain Take the activated YC12-C3 degrading strain bacterial solution and adjust the OD of the bacterial solution. 600The value was 1.0. The bacterial suspension was inoculated at a 1% inoculum volume into cells containing 2.0 μg / mL. -1 DON was used as a treatment group in LB, YPG, GYT, NA, and SOC media, with uninoculated media (containing 2.0 μg / mL) as the control group. -1 DON was used as a control group. The temperature was 28℃ and the maximum temperature was 180 r·min. -1 After shaking culture for 3 days, the DON content was determined by HPLC.

[0049] 1.6.2.2 Effect of different culture times on the degradation ability of the strain Take the activated YC12-C3 degrading strain bacterial solution and adjust the OD of the bacterial solution. 600 The value was 1.0. The bacterial suspension was inoculated at a 1% inoculum volume into cells containing 2.0 μg / mL. -1 DON's LB medium was used as the treatment group, with each uninoculated medium (containing 2.0 μg·mL⁻¹) as the control group. -1 DON was used as a control group. The temperature was 28℃ and the maximum temperature was 180 r·min. -1 The DON content was determined by HPLC after incubation for 0 h, 12 h, 24 h, 36 h, 48 h, 60 h, and 72 h.

[0050] 1.6.2.3 Effect of different inoculum amounts on the degradation ability of the strain Take the activated YC12-C3 degrading strain bacterial solution and adjust the OD of the bacterial solution. 600 The value was 1.0. Bacterial suspensions at volume ratios of 0.5%, 1.0%, 2.0%, 5.0%, and 10.0% were inoculated into a solution containing 2.0 μg / mL of [agent / solvent / etc.]. -1 In DON's LB medium, as the treatment group, uninoculated medium (containing 2.0 μg·mL⁻¹) was used. -1 DON was used as a control group. The temperature was 28℃ and the maximum temperature was 180 r·min. -1 After shaking culture for 3 days, the DON content was determined by HPLC.

[0051] 1.6.2.4 Effect of initial culture pH on the degradation ability of the strain Take the activated YC12-C3 degrading strain bacterial solution and adjust the OD of the bacterial solution. 600 The pH was 1.0. Bacterial suspensions were inoculated at a 1% inoculum rate into LB liquid medium (containing 2.0 μg / mL) at pH values ​​of 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0, respectively. -1 The treatment group was selected from DON (dosage-free culture medium containing 2.0 μg / mL of DON). -1 DON was used as the control group. 28℃, 180 r·min -1After shaking culture for 3 days, the DON content was determined by HPLC.

[0052] 1.6.2.5 Effect of different culture temperatures on the degradation ability of the strain Take the activated YC12-C3 degrading strain bacterial solution and adjust the OD of the bacterial solution. 600 The value was 1.0, and the bacterial suspension was inoculated into LB medium at the corresponding optimal pH (containing 2.0 μg·mL⁻¹) at the optimal inoculum size. -1 DON) was used as the treatment group, with uninoculated culture medium (containing 2.0 μg·mL⁻¹) -1 DON was used as the control group. The samples were placed in shaking incubators at temperatures of 15℃, 25℃, 28℃, 30℃, 37℃, and 45℃, respectively, at 180 r·min. -1 After shaking culture for 3 days, the DON content was determined by HPLC.

[0053] 1.7 The degradation products of DON were detected and analyzed by UPLC-MS / MS method. 1.7.1 Preparation of degradation products after the strain degrades DON The bacterial suspension of degrading bacteria YC12-C3 was inoculated into LB liquid medium and incubated at 28°C and 180 r·min. -1 Shaking culture for 24 hours, then adjusting OD 600 The value was 1.0. YC12-C3 degrading bacteria were inoculated into a solution containing 2.0 μg / mL. -1 The DON toxin was mixed by inversion in 1270.5 μL of liquid LB medium as the treatment group; it was cultured under shaking under the optimal degradation conditions screened above, with LB medium containing 2.0 μg / mL of uninoculated bacterial culture. -1 DON toxin was used as the DON control group, i.e., the CK group; the bacterial suspension of the strain was used as the negative control group; and a concentration of 2.0 μg / mL was used. -1 DON standard solution (dissolved in 50% methanol) was used as a positive control. Extraction was performed with ethyl acetate at 12000 r·min. -1 Centrifuge for 10 minutes, collect the supernatant and set aside.

[0054] 1.7.2 Mass Spectrometry Detection of DON Degradation Products Mass spectrometry sample preparation: The supernatant solution prepared in the above steps was evaporated to dryness using a nitrogen blower, and then completely dissolved and reconstituted with 1.5 mL of methanol. 600 μL of the standard solution was then filtered through a 0.22 μm microporous membrane into a high-volume vial with a memory tube (200 μL) as the mass spectrometry sample.

[0055] Liquid chromatography conditions: Column: C18 column (2.1 mm × 100 mm, 1.7 μm), column temperature: 30℃, flow rate: 0.3 mL·min-1 The mobile phase A1 was 0.1% formic acid aqueous solution, the mobile phase B1 was methanol, the injection volume was 5 μL, the elution program was 0~15 min, and the ratio of mobile phase A1 (%) to mobile phase B1 (%) was 75:15.

[0057] 1.7.3 Speculation on the Degradation Mechanism of DON Based on the UPLC-MS / MS results, the structure of DON degradation products, and existing literature on DON degradation mechanisms, the detoxification process of DON degradation by strain YC12-C3 is inferred.

[0058] 1.8 Investigation on the degradation ability of degrading bacteria on DON in Coix seed medicinal material 1.8.1 Pretreatment of strains to enhance DON detoxification ability in Coix seed Refer to Pan Liting [4] The method was further used to investigate the degradation ability of degrading bacteria on DON in coix seed, as follows: Weigh 50 g of sterilized coix seed powder and add 75 μL of DON standard (CDON is 100 μg·mL). -1 The mixture was thoroughly mixed, and the solvent was evaporated to obtain coix seed powder containing DON toxin (CDON concentration: 150 μg / kg). -1 Coix seed + LB group: 50 g of sterile, DON-free coix seed powder was mixed with 50 mL of sterile LB liquid culture medium; Coix seed + LB + DON group served as the control group: 50 g of coix seed powder containing DON (CDON content 150 μg·kg⁻¹) was taken. -1 Add 50 mL of sterile LB liquid medium and mix; Coix seed + LB + YC12-C3 strain control group: Take 50 mL of activated YC12-C3 degrading strain bacterial solution and mix evenly with 50 g of sterile DON-free coix seed powder; Coix seed + LB + YC12-C3 strain + DON treatment group: Take 50 g of coix seed powder containing DON toxin (CDON is 150 μg·kg) -1 Add 50 mL of activated YC12-C3 degrading bacterial culture. Each group was repeated three times, under the optimal degradation conditions described above, at 180 r·min. -1 Shake culture, then dry at 60℃ for later use.

[0059] 1.8.2 Detection of DON residue in Coix seed Using the modified QuEChERS method [5]The specific procedure for determining the residual amount of DON in Coix seed is as follows: Accurately weigh 2 g of samples from the treatment group and control group under the section "Pretreatment of the detoxification ability of strain 1.8.1 on DON in Coix seed", place them in a 50 mL centrifuge tube, add 5 mL of 0.2% formic acid solution, vortex for 10 s, and extract for 30 min; add 5 mL of acetonitrile, and sonicate for 20 min; add 2.0 g of magnesium sulfate and 1.0 g of sodium chloride to the mixture, vortex vigorously for 1 min at 5000 r·min. -1 Centrifuge for 5 min; transfer 2 mL of the acetonitrile layer to an Eppendorf microtube containing 0.3 g magnesium sulfate and 0.1 g ODS, and shake vigorously for 1 min; dry the supernatant with nitrogen evaporation apparatus, and reconstitute with 0.3 mL of methanol; vortex for 30 s at 5000 r·min. -1 Centrifuge for 10 min; finally, filter the supernatant through a 0.22 μm microporous membrane and seal it in a high-performance vial with an inner liner. Determine the residual amount of DON in Coix seed using HPLC.

[0060] 1.9 Experimental Data Analysis Excel 2016 was used for data summarization and classification. Origin 2022, MEGA 11, and GraphPad 9.4.0 were used for one-way ANOVA, significance identification, and chart creation. MassLynx 4.0 was used for data analysis, Origin 2022 was used for one-way ANOVA and chart creation, and ChemDraw 20.0 was used to draw the DON structure, degradation product structure, and degradation mechanism.

[0061] 2. Results and Discussion 2.1 Isolation and Screening of DON-Degrading Strains Using a single-strain pooling screening method, strain YC12-C3 was selected from 1152 bacterial strains. This strain showed good degradation effect on DON (see...). Figure 1 The data for A, B, and C is as follows: Significance analysis was performed using one-way ANOVA, with different lowercase letters indicating significant differences between different culture media (P < 0.05, n = 3). Figure A shows the degradation rate of DON by bacterial cultures in groups YC1-YC12, Figure B shows the degradation rate of DON by bacterial cultures in groups YC12-A-YC12-H, and Figure C shows the degradation rate of DON by bacterial cultures in groups YC12-C1-YC12-C12. Further comparison of the chromatographic peaks of the treatment and control groups revealed that after treatment with YC12-C3, the main DON peak significantly decreased, and a new degradation product peak appeared at 12.15 min (HPLC chromatograms of different treatment groups are shown in [reference needed]). Figure 1D). The results indicate that this bacterium may degrade DON by modifying its structure.

[0062] 2.2 Identification of DON-degrading bacteria 2.2.1 Morphological observation of DON-degrading strains After diluting the bacterial suspension, it was spread onto solid LB medium and incubated for 3 days. Colony morphology was then observed. The colonies of strain YC12-C3 were found to be yellowish-brown, nearly round, with a smooth, moist, and opaque surface, and a diameter of 3–5 mm. (For morphological identification of strain YC12-C3, see [link to morphological identification]). Figure 2 A).

[0063] 2.2.2 Gram staining of DON-degrading strains The bacteria were observed under a microscope after Gram staining. The results showed that strain YC12-C3 stained blue-purple, indicating it was a Gram-positive (G+) bacterium. The bacteria were arranged singly, rod-shaped, and 2–3 μm in diameter. Therefore, strain YC12-C3 was identified as a Gram-positive bacillus (see Gram staining details for strain YC12-C3). Figure 2 B).

[0064] 2.2.3 Molecular identification of DON-degrading strains Using the total DNA of the screened degrading bacterium YC12-C3 as a template, PCR amplification and electrophoresis showed that the fragment sizes were all around 1000 bp. Sequencing of the V3V4 rDNA and homology analysis using NCBI BLAST software and the NR database revealed that strain YC12-C3 shared the highest homology (97.36%) with *Morganella morganii* strain 237. Based on the sequence alignment results, the homology-aligned sequences were downloaded, collected, and analyzed. A phylogenetic tree was constructed using MEGA 11 software (see [link to phylogenetic tree]). Figure 2 C), strain YC12-C3 and M. morganii of Morganella morganii clustered together, and strain YC12-C3 was preliminarily identified as Morganella morganii.

[0065] 2.3 Effects of different culture conditions on the degradation ability of strain YC12-C3 2.3.1 Effects of different culture media on the degradation ability of the strain The degradation ability of the strains of DON varied in different types of culture media. The YC12-C3 strain showed the best degradation activity in LB and SOC media, with degradation rates of 83.2% and 71.4%, respectively. The lowest degradation rate (53.1%) was observed in NA media (see [link to article on the effect of different culture media on the degradation ability of the strains]). Figure 3A). The results showed that strain YC12-C3 exhibited the highest degradation rate of DON in LB medium.

[0066] 2.3.2 Effect of different culture times on the degradation ability of the strain The duration of bacterial culture directly affects the bacterial reproduction and the amount of metabolites secreted, thus influencing the degradation effect on DON. Results showed that strain YC12-C3 reached a plateau phase after 24 hours (growth curve of strain YC12-C3 is shown in [reference needed]). Figure 3 F), the degradation efficiency of DON reached its peak at 24 h, and then tended to stabilize. Therefore, the degradation ability of strain YC12-C3 reached its maximum when co-cultured with DON for 24 h (the effect of different culture times on the degradation ability of the strain is shown in [reference]). Figure 3 B) represents the optimal time for co-culturing the degrading strain with DON.

[0067] 2.3.3 Effect of different inoculum amounts on the degradation ability of the strain The inoculum size study revealed that the degradation rate of DON by strain YC12-C3 first increased and then decreased with increasing inoculum size (the effect of different inoculum sizes on the degradation ability of the strain is shown in [reference needed]). Figure 3 C). The DON degradation rate was highest when the inoculum concentration was 1.0%. When the inoculum concentration was between 2.0% and 10.0%, the DON degradation efficiency decreased significantly and gradually. This may be because if the inoculum concentration was too high, the strain rapidly consumed the culture medium during its rapid growth and decline phase, resulting in only a portion of the surviving bacteria being able to metabolize DON degradation components or adsorb DON. Therefore, it can be concluded that a higher inoculum concentration actually reduces the DON degradation rate. Thus, the YC12-C3 strain showed the best DON degradation effect with an inoculum concentration of 1.0%.

[0068] 2.3.4 Effect of different pH values ​​on the degradation ability of the strain The results showed that when the pH was between 4 and 7, the degradation rate of DON by strain YC12-C3 increased significantly with increasing pH. When the pH was between 7 and 10, the degradation rate of DON by the strain decreased significantly with increasing pH (the effect of different initial pH values ​​of the culture medium on the degradation ability of the strain is shown in [reference needed]). Figure 3 D). When the pH value is 7.0, strain YC12-C3 has the best degradation effect on DON, that is, the optimal pH value for DON degradation is 7.0.

[0069] 2.3.5 Effect of different culture temperatures on the degradation ability of the strain The results showed that when the temperature was between 15 and 28℃, the degradation rate of DON by the strain increased with increasing temperature; when the temperature was between 28 and 45℃, the degradation rate decreased significantly, but remained above 20%. This indicates that strain YC12-C3 still has good DON degradation ability under high temperature conditions. The optimal culture temperature for DON degradation by strain YC12-C3 is 28℃, with the highest degradation efficiency of 77.2% (the effect of different culture temperatures on the degradation ability of the strain is shown in...). Figure 3 E).

[0070] 2.3.6 Summary Through the above series of screening experiments, the optimal degradation conditions for strain YC12-C3 were determined to be: LB liquid medium, culture time of 24 h, culture temperature of 28℃, initial pH of the medium of 7, and inoculum size of 1%. Under these optimal culture conditions, the DON degradation ability of strain YC12-C3 was determined to be 2.0 μg·mL⁻¹. -1 The degradation rate of DON was 93.23%.

[0071] 2.4 UPLC-MS analysis of DON degradation products 2.4.1 LC-MS / MS (Q-TOF) Analysis of DON Standards DON in the positive control group was detected by LC-MS / MS (Q-TOF) in positive ion mode (ESI+). Peak comparison of the ion chromatograms revealed that the retention time of DON was 1.72 min. Mass spectrometry results showed [DON+H] (m / z=297.15) and [DON+Na] (m / z=319.13) (mass spectrometry chromatograms of different treatment groups are shown in [link to mass spectrometry data]). Figure 4 A). The results showed that the chromatographic peak at RT of 1.72 min was the target peak of DON, and that the chromatographic and mass spectrometric conditions were suitable for the liquid chromatography-mass spectrometry of the degradation products of the treatment group.

[0072] 2.4.2 Detection of degradation products and study on degradation mechanism of DON by strain YC12-C3 UPLC-Q-TOF-MS / MS was used to detect the degradation products of DON treated by strain YC12-C3. Peak comparison of the extracted ion chromatograms revealed a new peak at a retention time of 2.49 min after DON treatment by *Morganella morganii* YC12-C3, presumably representing the degradation product of DON by strain YC12-C3. Mass spectrometry analysis showed that the m / z of this degradation product was 250.32. Based on the molecular weight difference between the fragment ions and vomitoxin, which is approximately 46 Da (mass spectrometry chromatogram of the degradation product is shown in [link to mass spectrometry analysis]),... Figure 4(B) It is speculated that the YC12-C3 metabolite can convert vomitoxin (DON) into 3-deoxy-6-desmethanol-vomitoxin through deoxygenation of the C3 hydroxyl group and demethanolization of the C6 methanol moiety (degradation mechanism see [see [link to degradation mechanism]). Figure 4 C).

[0073] 2.5 Analysis of the degradation capacity of degrading bacterial components for DON toxin 2.5.1 Degradation analysis of DON by different active components of strain YC12-C3 Degradation experiments of different active components of DON metabolized by strain YC12-C3 revealed that the supernatant (extracellular fluid) of strain YC12-C3 exhibited the best DON removal capacity, with a degradation rate of 45.58%. Further treatment of the supernatant (extracellular fluid) with SDS, proteinase K, proteinase K+SDS, and boiling water further reduced the degradation rate by 53.90%, 55.23%, 50.60%, and 57.68%, respectively. This suggests that YC12-C3 primarily degrades DON through the secretion of extracellular enzymes.

[0074] 2.5.2 Analysis of the ability of degrading bacteria YC12-C3 to remove DON toxin from Coix seed. The results showed that strain YC12-C3 could reduce the DON content in coix seed from 150.0 μg·kg⁻¹. -1 Degraded to 46.67 μg·kg -1 The degradation rate reached 68.89%. This study shows that the DON-degrading bacterium YC12-C3 has a good degradation effect in the coix seed matrix.

[0075] Although the present invention has been described in detail above with general descriptions, specific embodiments, and experiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

[0076] References: [1] Tan Jian, Yang Shuo, Su Huibo, et al. Identification and degradation effect of a strain of Bacillus subtilis that degrades vomitoxin [J]. Modern Chemical Industry, 2018, 47(3): 548-551. [2] Shen Ping, Fan Xiurong, Li Guangwu. Microbiology Experiments [M]. 1999. Beijing: Higher Education Press. [3] Jiang Yan, Liu Yan, Wang Xiaoping. Isolation, identification and degradation characteristics of chlorimuron-methyl degrading bacteria [J]. Chinese Agricultural Science Bulletin, 2012, 28(12): 88-92. [4] Pan Liting, Xu Shengjia, Hu Xiaodan, et al. Isolation, identification and degradation characteristics of zearalenone-degrading bacteria in zeaxanthin [J]. Chinese Cereals and Oils Association, 2018, 33(06): 113-119+126. [5] Wang Shaomin, Du Chunxiao, Liu Xianxian, et al. Simultaneous determination of 26 fungal toxins in Panax notoginseng by QuEChERS-ultra-high performance liquid chromatography-tandem mass spectrometry [J]. World Journal of Traditional Chinese Medicine, 2019, 14(04): 798-804.

Claims

1. A strain of Morganella morganii YC12-C3, which was deposited at the China Center for Type Culture Collection on December 2, 2024, with accession number CCTCC NO: M 20242689.

2. The application of Morganella morganii YC12-C3 as described in claim 1 in the degradation of deoxynivalenol toxins by Fusarium oxysporum.

3. The application according to claim 2, characterized in that, The specific application involves co-culturing Morganella morganii YC12-C3 with deoxynivalenol toxin in a culture medium to degrade the deoxynivalenol toxin.

4. The application according to claim 3, characterized in that, The culture medium is any one of LB, YPG, GYT, NA, or SOC liquid culture medium.

5. The application according to claim 4, characterized in that, The culture medium is LB liquid medium.

6. The application according to claim 3, characterized in that, The co-culture conditions are as follows: culture time of 0-72 h, culture temperature of 15-45℃, initial pH of culture medium of 4-10, and inoculum size of 0.5-10%.

7. The application according to claim 6, characterized in that, The co-culture conditions are as follows: culture time of 12-36 h, culture temperature of 15-37 °C, initial pH of culture medium of 5-9, and inoculum size of 0.5-5%.

8. The application according to claim 7, characterized in that, The co-culture conditions were as follows: culture time of 24 h, culture temperature of 28 °C, initial pH of culture medium of 7, and inoculum size of 1%.

9. The application according to claim 2, characterized in that, The application of Morganella morganii YC12-C3 in the degradation of deoxynivalenol toxins in grains or medicinal materials.

10. The application according to claim 9, characterized in that, The application of Morganella morganii YC12-C3 in the degradation of deoxynivalenol toxins in Coix seed.