Application and method of GmZTLa gene in regulation and control of recent rhythm of soybean
By regulating the GmZTLa gene using CRISPR/Cas9 technology, the daily rhythm of soybean can be prolonged or shortened, solving the problem of limited soybean planting areas, enabling the breeding of multi-latitude adaptable soybean varieties, and broadening the planting adaptability range.
Patent Information
- Application Number
- CN202511726904.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-24
- Publication Date
- 2025-12-26
AI Technical Summary
Existing technologies are unable to effectively regulate the daily rhythm of soybeans, resulting in limited soybean planting areas and an inability to adapt to a wide range of latitudes, which restricts the expansion of soybean planting and the release of the potential of superior varieties.
By utilizing the GmZTLa gene, the circadian rhythm of soybean can be regulated by knocking out or overexpressing the GmZTLa gene using CRISPR/Cas9 technology, thereby constructing a system that can extend or shorten the circadian rhythm of soybean and achieve multidimensional adaptation.
By knocking out or overexpressing the GmZTLa gene, the daily rhythm cycle of soybeans was significantly delayed or shortened, resulting in the development of soybean varieties adapted to multi-latitude regions. This solved the problem of limited soybean planting areas and broadened the scope of planting adaptation.
Smart Images

Figure CN121204136A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and relates to the regulation of soybean circadian rhythm. BACKGROUND
[0002] Soybean is a typical short-day plant, and its transition from vegetative growth to reproductive growth is strictly regulated by day length. This characteristic limits the suitable planting area of a single variety to a narrow latitudinal range. The phenomenon of "oranges in the south of the Huai River and oranges in the north of the Huai River" is particularly prominent in soybean production. For example, introducing a variety adapted to the long-day environment of northeast China to a short-day region in the south will result in insufficient biomass accumulation and yield reduction due to premature flowering. Conversely, a variety from the south may not flower and set seeds in time when introduced to the north. This geographical and ecological barrier caused by photoperiod sensitivity is a core biological bottleneck that restricts the expansion of soybean planting areas and limits the release of potential of excellent varieties in China.
[0003] To break through this bottleneck, cultivating a wide-adapted variety has become an urgent need for the national food security strategy. The key scientific problem behind this is the core mechanism of plant perception and response to photoperiod signals, i.e., the plant biological clock system. Plant biological clock, an endogenous, approximately 24-hour circadian rhythm regulation system, is the "central processor" of plants to predict day and night alternation and optimize physiological and ecological strategies. Its molecular architecture can be viewed as a highly efficient three-level network: input pathway: "receiver" and "corrector" of environmental signals. This part is mainly composed of light receptors (such as ZTL, cryptochromes that perceive blue light, and phytochromes that perceive red light) and temperature sensing elements. They continuously monitor the intensity of external light, spectral composition, and temperature fluctuations, and convert these real-time signals into biochemical language to "time and calibrate" the core oscillator every day, ensuring that the internal rhythm is synchronized with the external environment. Core oscillator: "pacemaker" of rhythm. It is a genetic network composed of multiple interwoven transcription-translation negative feedback loops. The mRNA and protein levels of core components (such as TOC1, GI, PRR family, etc. in Arabidopsis) show rhythmic oscillation with the disappearance and appearance of each other and the phase offset, thereby spontaneously generating and maintaining a periodic rhythm of about 24 hours. It is the source of power of the biological clock system, generating stable timing signals. Output pathway: "executor" of physiological response. The rhythmic signals generated by the core oscillator are finally driven to drive thousands of downstream rhythmic output genes through a layer of signal transduction. These genes are widely involved in processes such as photosynthesis, metabolic pathways, hormone regulation, and key developmental transitions (such as flowering induction), enabling plants to "prepare for the rainy day", starting photosynthetic machinery before dawn, and adjusting metabolic reserves before dusk, thereby maximizing energy utilization efficiency.
[0004] In this sophisticated system, photoperiod-induced flowering is one of the core output phenotypes of the biological clock. Plants measure day length through their biological clock: under specific photoperiods (such as short days), the rhythmic phase generated by the core oscillator forms a specific "overlap window" with the light / dark signal, at which point the expression of the florigen FT gene is activated, thereby initiating the flowering program. Therefore, the importance of precise regulation of soybean daily rhythms is self-evident. For example, application CN110527685A discloses a promoter for regulating soybean daily rhythmicity expression, using engineered bacteria to regulate soybean daily rhythms. However, how to utilize genes related to soybean daily rhythms for regulation and broaden the methods for regulating daily rhythms is the focus of this application. Summary of the Invention
[0005] To address the aforementioned technical problems, this invention proposes an application and method for the GmZTLa gene in regulating soybean daytime rhythms.
[0006] The technical solution of this invention is implemented as follows: One of the purposes of the invention is to provide GmZTL a The application of genes in regulating soybean daytime rhythms, the GmZTL a The gene contains two homologous copies with phytozome numbers Glyma.15G162300 and Glyma.09G056100, respectively; the nucleotide sequences of the two homologous copies are shown in SEQ ID NO.5 and SEQ ID NO.6.
[0007] The GmZTL a The nucleotide sequences of the open reading frames of the two homologous copies of the gene are shown in SEQ ID NO.7 and SEQ ID NO.8.
[0008] The aforementioned regulation includes both extending and shortening the soybean day-ahead rhythm.
[0009] Furthermore, the aforementioned prolongation of soybean day-ahead rhythm is achieved through knockout, silencing, or mutation. GmZTL a The realization of gene function.
[0010] Furthermore, the aforementioned shortening of soybean day-ahead rhythm is achieved through overexpression GmZTL a The function of the gene is realized.
[0011] The second objective of the invention is to provide a soybean GmZTL a The CRISPR / Cas9 knockout vector for the gene, and the method for constructing the CRISPR / Cas9 knockout vector is as follows: (1) According to GmZTL a Gene found GmZTL a2 Target 1 and GmZTL a2 Target 2, according toGmZTL a2 Target 1 design sequence as shown in SEQ ID NO. 1 linker primer 1 and sequence as shown in SEQ ID NO. 2 linker primer 2, according to GmZTL a2 Target 2 design sequence as shown in SEQ ID NO. 3 linker primer 3 and sequence as shown in SEQ ID NO. 4 linker primer 4; (2) linker primer 1-4 by PCR annealing double-stranded nucleotide, double-stranded nucleotide by enzyme cutting and CRISPR vector, get CRISPR / Cas9 knockout vector.
[0012] The above GmZTL a The gene includes two phytozome numbers respectively Glyma.15G162300 and Glyma.09G056100 homologous copies.
[0013] The third purpose of the application is to provide a soybean GmZTL a The application of the CRISPR / Cas9 knockout vector of the gene in creating a soybean variety with a long circadian cycle.
[0014] The fourth purpose of the application is to provide a method for breeding a soybean with a long circadian cycle, comprising the following steps: constructing a CRISPR / Cas9 knockout vector of a soybean GmZTL a The gene, and transforming the CRISPR / Cas9 knockout vector of the gene into a soybean plant to be improved, so that a soybean plant with a long circadian cycle is obtained.
[0015] The fifth purpose of the application is to provide a method for breeding a soybean with a short circadian cycle, comprising the following steps: constructing a soybean GmZTL a The gene, and then transforming the overexpression vector of the gene into a soybean plant to be improved, so that a soybean plant with a short circadian cycle is obtained.
[0016] Further, the soybean GmZTL a The gene comprises two phytozome numbers respectively Glyma.15G162300 and Glyma.09G056100 homologous copies.
[0017] The application has the following beneficial effects: 1、The application relates to a soybean GmZTL a1 (Glyma.15G162300) and GmZTL a2 (Glyma.09G056100) two genes in maintaining the role of circadian rhythm. According to the research of the application, the phenotype of the delay of the period of the circadian rhythm appears when the two GmZTL a genes in the soybean are knocked out. The CRISPR / Cas9 knockout technology constructed in the application can obtain pure and gmztl a1 / a2The mutant soybean plants, compared to the control soybeans, significantly delayed the daily rhythm of soybeans, and can be used to breed soybeans adapted to growth in multi-latitude regions. It has enormous application potential.
[0018] 2. This invention demonstrates, by monitoring the leaf movement of soybean trifoliate leaves under continuous light conditions and using BRASS to calculate the period of soybean leaf movement, that... GmZTL a Genes involved in maintaining soybean daytime rhythms and inhibiting... GmZTL a The expression of this gene leads to a longer daily rhythm cycle in soybeans, which plays a key role in regulating the daily rhythm of soybeans and can serve as a valuable gene resource for breeding multi-dimensional adaptive soybean germplasm. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 The results show the target selection and sequencing results; where A represents the CRISPR / CAS9 knockout method. GmZTL a Target selection, B is GmZTL a Sequencing results of two homologous copy genes.
[0021] Figure 2 The diagram shows the flowering and fruiting of soybeans; where A is a phenotypic graph of soybean flowering and B is a statistical graph of soybean flowering time. Detailed Implementation
[0022] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0023] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.
[0024] Example 1: GmZTL a Acquisition of genes Arabidopsis AtZTL is a core regulator of circadian clock, which maintains the stability of circadian rhythm in a blue light-dependent manner. Its F-box domain mediates the formation of SCFZTL ubiquitin ligase complex, and specifically degrades the core components of circadian clock TOC1 and PRR5 at night. At the same time, the expression of AtZTL itself is regulated by the circadian clock, showing circadian fluctuation, forming a negative feedback loop with TOC1 and others, and accurately maintaining the 24-hour rhythm of Arabidopsis.
[0025] Example 2: GmZTL a Editing of genes This example uses CRISPR / Cas9 technology to target knockout GmZTL a two homologous genes GmZTL a1 (Glyma.15G162300) and GmZTL a2 (Glyma.09G056100), and the results are shown in A of Figure 1 9 base deletions occurred at the Target2 site, causing a frameshift mutation in the CDS region and leading to premature termination of translation; GmZTL a1 3 base insertions occurred at the Target 1 site, causing a frameshift mutation in the CDS region and leading to premature termination of translation Mutant single plants were obtained by genetic transformation, and after self-crossing and segregation, homozygous mutants were finally obtained; and the circadian rhythm of leaf movement was monitored. The specific process is as follows: GmZTL a2 1. Vector construction and transgenic plant identification First, find the appropriate CRISPR / Cas9 editing target point through the website CRISPR-P 2.0 (crispr.hzau.edu.cn / CRISPR2 / ): Target primer, see SEQ ID NO. 1 and SEQ ID NO. 2; GmZTL a1 Target primer 1 (SEQ ID NO. 1): GmZTL a1 ATATATGGTCTCGATTGACGACGATGATGACGCCGTGTT; Target primer 2 (SEQ ID NO. 2): GmZTL a1 TGACGACGATGATGACGCCGTGTTTTAGAGCTAGAAATAGC; Target primer, see SEQ ID NO. 3 and SEQ ID NO. 4. GmZTL a2
[0026] Target primer 1 (SEQ ID NO. 3): GmZTL a2 ATATATGGTCTCGATTGACGACGATGATGACGCCGTGTT; AACTTCTCCAAAGGTCTTCATTCAATCTCTTAGTCGACTCTAC; GmZTL a2 Target 1 primer 2 (SEQ ID NO. 4): ATTATTGGTCTCGAAACTTCTCCAAAGGTCTTCATTC.
[0027] The annealing system is: 1 μL of each of SEQ ID No. 1 / SEQ ID No. 2 primer and SEQ ID No. 3 / SEQ ID No. 4 primer, with a concentration of 100 μM, and then 8 μL of ddH2O is supplemented.
[0028] First step: 95℃, 2 min; second step: 95℃, 30 s; 55℃, 30 s, 10 cycles; third step: 14℃, ∞. Double-stranded Oligo is connected to the LguI enzyme-digested CRISPR vector.
[0029] The constructed vector is transformed into the receptor soybean cotyledon node by Agrobacterium GV3101, and T0 generation CRISPR / Cas9 edited transgenic soybeans are obtained, and pure double mutant plants are identified by one generation sequencing. The results are shown in Figure 1 Fig. B GmZTL a1 9 base deletions occur at the Target 2 site, causing CDS region frame shift mutations, and leading to premature termination of translation; GmZTL a2 3 base insertions occur at the Target 1 site, causing CDS region frame shift mutations.
[0030] 2, Flowering time statistics of soybean Soybean materials are grown under the conditions of 12L / 12D 25℃ 100 μmol m -2 s -1 for 14 days, and then transferred to 25℃ continuous light conditions to monitor the trajectory of leaf movement, pink balls are attached to the trilobed leaves, and a photograph is taken every 30 minutes, Image-Pro plus 6.0 software is used to extract the data, BRASS software is used to calculate the circadian rhythm cycle, and statistics are made.
[0031] The results are shown in Figure 2 It can be seen from Figure 2 that the leaf movement rhythm cycle of the GmZTLa deletion mutant gmztla1 a2-60-6 and gmztla1 a2-60-14 is about 29 hours, which is significantly longer than that of the wild type background WS82, and is prolonged by about 4 hours.
[0032] The above merely provides the preferred embodiment of the present application, and is not used to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the protection scope of the present application.
Claims
1. The application of the GmZTLa gene in regulating soybean circadian rhythm, characterized by: The GmZTLa gene contains two homologous copies with phytozome numbers Glyma.15G162300 and Glyma.09G056100, respectively.
2. The application of the GmZTLa gene in regulating soybean circadian rhythm according to claim 1, characterized in that: The regulation includes prolonging the soybean day-ahead rhythm and shortening the soybean day-ahead rhythm.
3. The application of the GmZTLa gene in regulating soybean circadian rhythm according to claim 2, characterized in that: The extended soybean daytime rhythm is achieved by knocking out, silencing, or mutating the function of the GmZTLa gene.
4. The application of the GmZTLa gene in regulating soybean circadian rhythm according to claim 2, characterized in that: The shortening of soybean daytime rhythm is achieved by overexpressing the function of the GmZTLa gene.
5. A CRISPR / Cas9 knockout vector for the soybean GmZTLa gene, characterized in that, The method for constructing the CRISPR / Cas9 knockout vector is as follows: (1) Based on the GmZTLa gene, target sites 1 and 2 of GmZTLa2 were found. Based on target site 1 of GmZTLa2, adapter primer 1 with the sequence shown in SEQ ID NO.1 and adapter primer 2 with the sequence shown in SEQ ID NO.2 were designed. Based on target site 2 of GmZTLa2, adapter primer 3 with the sequence shown in SEQ ID NO.3 and adapter primer 4 with the sequence shown in SEQ ID NO.4 were designed. (2) The adapter primers 1-4 were annealed by PCR to obtain double-stranded nucleotides. The double-stranded nucleotides were digested with enzymes and ligated into the CRISPR vector to obtain the CRISPR / Cas9 knockout vector.
6. The CRISPR / Cas9 knockout vector for the soybean GmZTLa gene according to claim 5, characterized in that: The GmZTLa gene comprises two homologous copies with phytozome numbers Glyma.15G162300 and Glyma.09G056100, respectively.
7. The application of the CRISPR / Cas9 knockout vector as described in claim 5 or 6 in creating soybean varieties with longer daily circadian rhythms.
8. A method for cultivating soybeans with a longer daily rhythm cycle, characterized in that, The steps are as follows: the CRISPR / Cas9 knockout vector in claim 5 or 6 is transformed into the soybean plant to be improved, thereby obtaining soybean plants with longer daily rhythm cycles.
9. A method for cultivating soybeans with a shorter daily rhythm cycle, characterized in that, The steps are as follows: construct an overexpression vector for the soybean GmZTLa gene, and then transform it into soybean plants to be improved, thereby obtaining soybean plants with shortened daily rhythm cycles.
10. The method for cultivating soybeans with shortened daily rhythm cycles according to claim 9, characterized in that: The soybean GmZTLa gene contains two homologous copies with phytozome numbers Glyma.15G162300 and Glyma.09G056100, respectively.
Citation Information
Patent Citations
Soybean circadian rhythm expression promoter GmLCLb2 and application thereof
CN110527685A