Method for constructing pseudo male carp parent and breeding all-female carp based on cyp19a1aA gene editing
By editing the third exon of the cyp19a1aA gene using the CRISPR/Cas9 system, pseudo-male parent fish were screened and mated with wild-type female fish. This solved the problems of long breeding cycles and hormone risks in traditional fish asexual breeding, and enabled rapid breeding and efficient farming of all-female carp.
Patent Information
- Application Number
- CN202511166578.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-20
- Publication Date
- 2025-12-26
AI Technical Summary
Traditional aquaculture of fish relies on hormone induction or hybridization, which involves long cycles, high costs, and environmental risks, and makes it difficult to quickly create an all-female fish population.
The third exon of the cyp19a1aA gene was edited using the CRISPR/Cas9 system to screen for pseudo-male parent fish. These were then mated with wild-type female fish to obtain an all-female carp population. Through gene editing, pseudo-male parent fish that are genetically female but physiologically male were directly obtained in the F0 generation.
It enables the rapid creation of all-female fish populations, shortens the breeding cycle, avoids the use of hormones, and improves breeding efficiency and economic benefits.
Smart Images

Figure CN121204162A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic engineering and fish breeding, and particularly relates to a method for constructing pseudo-male fish parents and cultivating all-female carps based on gene editing. cyp19a1aA The present application relates to the technical field of genetic engineering and fish breeding, and particularly relates to a method for constructing pseudo-male fish parents and cultivating all-female carps based on gene editing. BACKGROUND
[0002] Fish gender determination modes are diverse, including gender genetic determination, environmental hormone content determination, and environmental temperature determination. Traditional fish unisex breeding relies on hormone induction or hybrid selection, which has problems such as long cycle, high cost, and environmental risk.
[0003] At present, patent document CN118956957A discloses a method for creating all-male germplasm of economic fish for breeding and application. The invention of the patent technical solution is to cultivate all-male germplasm of economic fish, and it is necessary to reach F2 generation to obtain a homozygous mutant individual in which the sex glands are all differentiated into testes. cyp19a1a SUMMARY
[0004] Therefore, it is necessary to provide a method for constructing pseudo-male fish parents and cultivating all-female carps based on gene editing, which can directly screen pseudo-male fish parents with genetic females but physiological males in the F0 generation of gene mutation, and can realize rapid creation of all-female fish populations, greatly shortening the breeding cycle. cyp19a1aA cyp19a1aA The present application adopts the following technical solutions: The present application provides a method for constructing pseudo-male fish parents based on gene editing, wherein the pseudo-male fish is a male fish with normal testicular tissue structure and spermatogenesis, but its gender genetic determination is XX, and the method is to edit the third exon of the gene in the F0 generation of XX gender genetic determination individuals to screen pseudo-male fish parents.
[0005] The present application provides a method for constructing pseudo-male fish parents based on gene editing, wherein the pseudo-male fish is a male fish with normal testicular tissue structure and spermatogenesis, but its gender genetic determination is XX, and the method is to edit the third exon of the gene in the F0 generation of XX gender genetic determination individuals to screen pseudo-male fish parents. cyp19a1aA cyp19a1aA In some embodiments, the CRISPR / Cas9 system is used to edit the gene. Preferably, the gRNA sequence is as shown in SEQ ID NO: 2.
[0006] In some embodiments, the primer pair sequence for screening and identifying the gene mutation of the pseudo-male fish parent is as shown in SEQ ID NO: 5 and SEQ ID NO: 6. cyp19a1aA In some embodiments, the pseudo-male fish parent is a pseudo-male carp.
[0007] In some embodiments, the pseudo-male fish parent is a pseudo-male yellow river carp.
[0008] In some embodiments, the pseudo-male fish parent is a pseudo-male yellow river carp.
[0009] In some embodiments, the pseudo-male fish parent is a pseudo-male yellow river carp.
[0010] The application provides a method for cultivating all-female carps, comprising the following steps: constructing pseudo-male carp parents; artificially inducing parturition and fertilizing the pseudo-male carp parents and wild-type female carps to obtain all-female offspring carps.
[0011] The application specifically provides a method for cultivating all-female carps by using pseudo-male parents constructed by targeted cyp19a1aA gene mutation, comprising the following steps: constructing pseudo-male parents by using gene editing cyp19a1aA technology to mutate the third exon of the gene; screening the pseudo-male parents (genotype: XX) from the mutant F0 generation by using gender molecular markers; artificially inducing parturition and fertilizing wild-type female carps and the pseudo-male parents; and obtaining all-female offspring groups with the genotype XX after artificial breeding. cyp19a1aA
[0012] The application provides a method for cultivating all-female carps based on cyp19a1aA gene editing.
[0013] Compared with the prior art, the core technical advantages and beneficial effects of the application are as follows: The application provides a method for constructing pseudo-male parents, which uses a CRISPR / Cas9 gene editing system to mutate the third exon of the gene by targeting cyp19a1aA the third exon of the gene, so that the catalytic enzyme coding gene of the estrogen synthesis pathway is mutated, thereby blocking the synthesis of normal estrogen, and the undifferentiated gonad of the XX genotype lacking estrogen develops into a testis in the juvenile stage, so that the pseudo-male parents with the genotype XX are obtained.
[0014] Compared with the prior art of using F2 generation homozygous mutant pseudo-male parents to cultivate all-female carps, the breeding cycle of the method for cultivating all-female carps is greatly shortened, the method is fast and convenient to operate, has strong applicability, has wide adaptability and expansibility in aquaculture economic fish, and can effectively solve the technical problems of long cycle, hormone residue in the fish body, unstable gender development and the like caused by the long sexual maturation cycle of animals in traditional gender control breeding of fish. BRIEF DESCRIPTION OF DRAWINGS
[0015] cyp19a1aA FIG. 1 is a flowchart of the method for constructing pseudo-male parents and cultivating all-female carps according to the application.
[0016] Figure 1 FIG. 2 is an agarose gel electrophoresis map of amplified gDNA (for synthesizing gRNA for knocking out the third exon of the gene); wherein the first column of lanes is a DNA marker, and the second column of lanes is the amplified gDNA product. Figure 2
[0017] cyp19a1aA FIG. 3 is a schematic diagram of the method for constructing pseudo-male parents and cultivating all-female carps according to the application.Figure 3 Agarose gel electrophoresis diagram of gRNA; wherein, the first column of lanes is DNA marker, and the second column of lanes is the transcribed gRNA product.
[0018] cyp19a1aA Wild-type Cyprinus carpio and Figure 4 F0 generation mutant Cyprinus carpio of the gene.
[0019] cyp19a1aA Wild-type Cyprinus carpio and Figure 5 Appearance, dissection and gonadal tissue section diagram of F0 generation mutant Cyprinus carpio of the gene.
[0020] cyp19a1aA Agarose gel electrophoresis diagram of male-specific gene molecular markers of control group wild-type male and female offspring and the male fish of the application; wherein, the first to ninth columns of lanes in A diagram are male-specific gene molecular markers of control group wild-type male offspring, the tenth to eighteenth columns of lanes are male-specific gene molecular markers of control group wild-type female offspring, and the last column of lanes is DNA marker; the first to eighteenth columns of lanes in B diagram are male-specific gene molecular markers of the male fish, and the last column of lanes is DNA marker.
[0021] Figure 6 Hematoxylin-eosin staining (HE staining) diagram of gonadal tissue sections of control group wild-type male and female offspring and the male fish of the application; wherein, A diagram is the gonadal HE staining diagram of control group wild-type male offspring, B diagram is the gonadal HE staining diagram of control group wild-type female offspring, and C diagram is the gonadal HE staining diagram of the male fish. DETAILED DESCRIPTION
[0022] As Figure 7 shown, the technical concept of the application is to provide a method for constructing pseudo-male fish parents and cultivating all-female Cyprinus carpio based on Figure 1 The method for constructing pseudo-male fish parents is specifically to edit the third exon of the cyp19a1aA key gene, block the estrogen synthesis pathway of the farmed fish through the mutation of the site, and obtain the pseudo-male fish parents with 40% of the physiological males in the F0 generation XX sex genetic determination individuals. cyp19a1aA Then, the pseudo-male fish parents are artificially induced and inseminated with wild-type female fish to quickly obtain an all-female group, thereby realizing the gender control breeding of farmed Cyprinus carpio.
[0023] The technical solution is fast and convenient to operate, short in cycle, avoids the use of hormones, has strong applicability, can quickly realize the rapid creation of monosex groups of farmed fish, improves the yield of farmed fish, has strong popularization, and has important industrial significance.
[0024] cyp19a1aA Gene information: 109072133, NCBI, located on chromosome A18, sequence information can be obtained through the database.
[0025] The application will be further described in detail below with specific examples, so that those skilled in the art can more clearly understand the application. The following examples are used to illustrate the application, but not to limit the scope of the application. Based on the specific examples in the application, all other examples obtained by those skilled in the art without creative labor are within the scope of protection of the application. In the examples of the application, all raw material components are commercially available products well known to those skilled in the art unless otherwise specified; in the examples of the application, the technical means used are conventional means well known to those skilled in the art unless otherwise specified.
[0026] The following experimental examples use yellow river carp as the test object.
[0027] Example 1 This example provides a method for constructing pseudo-male yellow river carp parents, comprising the following steps: S1, determine the gene editing target point.
[0028] Design a targeted cyp19a1aA editing scheme based on the CRISPR / Cas9 system. The specific implementation path is: Input the sequence of each exon of yellow river carp into the online design website CHOPCHOP (https: / / chopchop.cbu.uib.no / ) and select the target point with the highest predicted knockout efficiency according to the target point design principles of JINEK and CHYLINSKI et al. (Source: Jinek, M., Chylinski, K., Fonfara, I, et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity Science, 2013. 337(6096), 816-821). cyp19a1aA
[0029] The third exon (exon3) is determined, and the sequence is: 5'-AAATACGGAGACATTGTGC-3' (SEQ ID NO: 1).
[0030] Compared with the incomplete protein function damage caused by the gene editing site bias, the gene editing of the third exon (a total of 9 exons) is also more conducive to completely inactivating its function, so the above sequence is determined as the gene editing target site.
[0031] S2, design and synthesize gRNA.
[0032] The above gene editing target sequence should be fused with the DNA sequence of gRNA scaffold, and the two are respectively used to recruit and combine Cas9 protein to the DNA cutting site after recognizing the gene editing site. The full length of gRNA sequence is: AAAUACGGAGACAUUGUGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU (SEQ ID NO: 2).
[0033] To synthesize the above gRNA product, first, the corresponding primer is designed according to the gene editing target site, and the amplification fragment containing the gene mutation target site is synthesized, which is denoted as gDNA.
[0034] The forward primer sequence for gDNA amplification is: 5-TAATACGACTCACTATAGGGAAATACGGAGACATTGTGCGTTTTAGAGCTAGAAATAGC-3' (SEQ ID NO: 3); Among them, the underlined sequence is the gene editing target sequence, the sequence before the underlined sequence is the T7 promoter sequence, and the sequence after the underlined sequence is the gRNA scaffold front primer sequence.
[0035] The reverse primer sequence for gDNA amplification is: 5'-AGCACCGACTCGGTGCCACTT-3' (SEQ ID NO: 4) (gRNA scaffold end primer sequence).
[0036] Using pMD19-T-gRNA plasmid (source: Chang N, Sun C, Gao L, et al. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res. 2013; 23(4): 465-472. doi: 10.1038 / cr.2013.45) as a template, the above primer sequence is used, and TransStart® Taq DNA Polymerase (Cat No: AP141-01) is used to amplify the in vitro transcription template gDNA for synthesizing gRNA.
[0037] The gDNA (used for synthesizing knockoutcyp19a1aA The procedure for (gRNA) is shown in Table 1 below: Table 1. Amplification program for gDNA The obtained gDNA was analyzed by agarose gel electrophoresis at 120V. The results are shown below. cyp19a1aA .
[0038] Depend on Figure 2 It can be seen that PCR amplification has effectively obtained amplification products of the expected size.
[0039] The DNA was then purified using a standard agarose gel DNA recovery kit (catalog number: DP209) from Tiangen Biotech. gRNA was synthesized via transcription using the Thermo TranscriptAid T7 High Yield Transcription Kit (catalog number: K0441). The synthesized gRNA was then analyzed using agarose gel electrophoresis at 120V. The results are shown in the figure below. Figure 2 .
[0040] Depend on Figure 3 It can be seen that transcription has effectively yielded transcription products of the expected size.
[0041] After purification according to the instructions of Thermo's TranscriptAid T7 High Yield Transcription Kit (catalog number: K0441), the product concentration was determined, diluted to 1000 ng / μL, and stored at -80℃ for later use.
[0042] S3, prepare a microinjection mixture containing gRNA-Cas9 protein and microinject it into Yellow River carp fertilized eggs.
[0043] The preparation system for microinjection mixtures containing gRNA-Cas9 protein is shown in Table 2 below: Table 2 Microinjection mixtures containing gRNA-Cas9 protein The above-mentioned microinjection mixture containing gRNA-Cas9 protein was thoroughly mixed in a 0.2 mL nuclease-free EP tube. The nuclease-free EP tube containing the mixture was then temporarily stored on ice. Figure 3 The gene-editing injection mixture awaits transfer to a microinjection needle for microinjection.
[0044] Wild type female and male parents of Cyprinus carpio haematopterus were induced and inseminated according to the general method of production (Shi Guojing. Artificial propagation and culture techniques of carp [J]. Farmer's Friend, 2017, (14): 283) to obtain fertilized eggs and offspring groups. Microinjection mixture containing gRNA-Cas9 protein was injected into 1-cell Cyprinus carpio haematopterus fertilized eggs using a microinjection instrument, and the injection volume was 1.0 nL.
[0045] It is worth noting that in this step, cyp19a1aA In the injection mixture for gene editing, the gRNA concentration can be controlled at 100-200 ng / µL; the Cas9 protein concentration can be controlled at 100-300 ng / µL; and the microinjection volume can be controlled at 0.5-2.0 nL.
[0046] S4, cultivate to obtain F0 generation, screen cyp19a1aA Gene mutants.
[0047] The injected fish eggs are raised to sexual maturity using conventional breeding methods to obtain F0 generation.
[0048] Design cyp19a1aA Primer pair sequence for gene mutation identification: Forward primer: 5'-GCATGTCACATCCTCATTGTCT-3' (SEQ ID NO: 5), Reverse primer: 5'-GTATGCACTCTCAATTGCACT-3' (SEQ ID NO: 6).
[0049] TransStart® Taq DNA Polymerase (Catalog No.: AP141-01) was used to amplify the target fragment, and the PCR amplification program for genotype identification is shown in Table 3 below: Table 3 cyp19a1aA PCR amplification program for gene mutation identification The PCR amplified fragments were subjected to Sanger sequencing, and the sequencing results were opened using Chromas software. Individuals with multiple reading peaks at the target position were selected as F0 generation gene mutation individuals, and the sequencing results are shown in cyp19a1aA .
[0050] The wild type Cyprinus carpio haematopterus Figure 4 exon 3 of the gene as a control, indicating that the individual cyp19a1aA gene was successfully knocked out.
[0051] S5, further male-specific gene molecular markers were used to screen F0 generation gene mutation individuals for XX sex genetic determination cyp19a1aAMutant F0 generation male parent of Cyprinus carpio haematopterus.
[0052] The sequence of the gender marker amplification primer pair used is: Forward primer: 5'-TGAACCCTAAATATGTGTCT-3' (SEQ ID NO: 7); Reverse primer: 5'-AAACCAAACCATTTATGCTA-3' (SEQ ID NO: 8).
[0053] The male gender marker was amplified using TransStart® Taq DNA Polymerase (Cat. No. AP141-01) for gender genotype identification, and the PCR amplification procedure was the same as Table 3. The male gender marker product obtained by amplification was detected by agarose gel electrophoresis at a voltage of 120 V to screen individuals that did not amplify the male gender marker product (i.e., genetic sex XX), and the wild type and mutant XX individuals were observed by dissecting and staining the gonadal tissue sections. cyp19a1aA Genetic F0 generation mutant; XX individual differences.
[0054] By cyp19a1aA It can be seen that among the 10 genotypes of Figure 5 Among the mutant XX Cyprinus carpio haematopterus, 40% had obvious testicular structure and male germ cells, confirming that they had developed into male fish.
[0055] Example 2 The present embodiment provides a method for breeding offspring all-female Cyprinus carpio, comprising the following steps: S1, the pseudo-male Cyprinus carpio parent obtained by screening and identification in Example 1 and the wild type female Cyprinus carpio are artificially induced and inseminated according to the general production method.
[0056] When artificially induced, HCG 1600-2000 IU / kg is injected at the base of the pectoral fin, the needle is inserted at an angle of 45 degrees to the body axis, and when the water temperature is 16-18℃, the effect time (estrus time) is generally 12-15 hours; when artificially inseminated, the fish is caught when the effect time is approaching, the fish is wrapped tightly with a fish clamp, the water is wiped dry with a towel, the eggs and sperm are squeezed into the basin, and a goose feather is used to continuously and evenly stir, while adding a little physiological saline to allow the sperm and eggs to be fully fertilized.
[0057] Referring to the general method (Shi Guojing. Artificial propagation and breeding technology of Cyprinus carpio [J]. Farmer's Friend, 2017, (14): 283), the offspring population is obtained.
[0058] S2, the obtained offspring population is raised to 5 days old, and the genome is extracted for gender marker detection.
[0059] The male sex markers were amplified using TransStart® Taq DNA Polymerase (catalog number: AP141-01) to identify sex genotype. The PCR amplification procedure is shown in Table 4. Table 4 PCR amplification procedures for sex marker identification The amplified male sex marker products were analyzed by agarose gel electrophoresis at 120V. The results are shown in [reference needed]. cyp19a1aA .
[0060] pass Figure 6 It can be seen that all offspring samples were negative for male sex markers, confirming that this population is 100% all-female. In this example, offspring samples from wild-type male carp and wild-type female carp were used as a control group. The proportion of positive male sex markers in the control group was 50%, confirming that the control group was a mixed-sex population.
[0061] S3, the offspring population was raised to 4 months of age, and gonadal tissue was collected for HE staining.
[0062] pass Figure 6 It can be seen that the gonads of the offspring samples all differentiated into ovaries, proving that this population is a 100% all-female carp population. In this example, offspring samples of wild-type male carp and wild-type female carp were used as control groups. The testis differentiation rate of the control group was 50%, confirming that the control group was a mixed-sex population.
[0063] As can be seen from the above experimental examples, the present invention essentially provides a targeted solution. Figure 7 cyp19a1aA The third exon (exon3) method for constructing pseudo-male parent fish and cultivating all-female carp can be applied in the field of sex control breeding of economic fish in aquaculture, shortening the breeding cycle, avoiding the use of exogenous hormones, thereby obtaining an all-female carp population with growth advantages, and ultimately improving the economic benefits of aquaculture.
[0064] It should be noted that the above embodiments are only for further elaboration and explanation of the technical solution of the present invention, and are not intended to further limit the technical solution of the present invention. The method of the present invention is only a preferred embodiment and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A method of producing a pseudo-male parent fish based on cyp19a1aA a method of genetically editing a pseudo-male parent fish, characterized by, The method is editing fish cyp19a1aA gene third exon, in cyp19a1aA The F0 generation XX sex genetically determined individuals are screened to obtain pseudo-male fish parents.
2. The method according to claim 1, wherein the method is based on cyp19a1aA A method of constructing a pseudo-male fish parent by gene editing, the method comprising: Editing of genes using CRISPR / Cas9 system cyp19a1aA genes.
3. The method of claim 2, wherein the method is based on cyp19a1aA A method of constructing a pseudo-male fish parent, characterized by, Editing of the gene using the CRISPR / Cas9 system cyp19a1aA The gRNA sequence for the gene is set forth in SEQ ID NO:
2.
4. Based on claim 3 cyp19a1aA The method for constructing pseudo-male fish parents through gene editing is characterized by, The primer pair sequence for screening and identifying the mutation of the pseudo-male parent gene is shown as SEQ ID NO: 5 and SEQ ID NO:
6.
5. The method according to any one of claims 1 to 4, based on cyp19a1aA A method of constructing a pseudo-male fish parent, characterized by, The pseudo-male parent is a pseudo-male common carp.
6. Based on claim 5 cyp19a1aA The method for constructing pseudo-male fish parents through gene editing is characterized by, The pseudo-male parent is a pseudo-male yellow river carp.
7. A method of breeding all-female carps, characterized by, The method comprises the following steps: The pseudo-male common carp parent is obtained by the method according to claim 5 or 6; The pseudo-male common carp parent is artificially induced and inseminated with a wild-type female common carp to obtain a full-female common carp offspring.
8. The use of the method for constructing a pseudo-male parent according to any one of claims 1 to 6 or the method for breeding a full-female common carp according to claim 7 in the field of sex control breeding of aquaculture economic fish.
Citation Information
Patent Citations
Method for realizing XX / XY sex genetic determinant fish sex control breeding and application
CN113789352A
Breeding method for obtaining XX / XY sex-determined pseudo male fish parents on large scale and application thereof
CN113817779A
Method for constructing female tilapia mossambica with oviposition behavior deficiency by using gene editing technology
CN116904523A
Creation method and application of all-male germplasm of cultured economic fishes
CN118956957A
Method for constructing gene-free edited all-male fish based on kdm6bb gene knock-down technology
CN119791068A