Pyrethrum ITS labeled primer and application thereof in identification of pyrethrum

Abstract

The invention discloses a pyrethrum ITS marker primer and application thereof in pyrethrum identification, and relates to the field of pyrethrum identification, the pyrethrum ITS marker primer comprises a primer pair, the primer pair comprises an upstream primer Tco-ITS1-F, a downstream primer Tco-ITS1-F, an upstream primer Tco-ITS1-F, a downstream primer Tco-ITS1-F and a downstream primer Tco-ITS1-F, the nucleotide sequence of the downstream primer Tco-ITS1-R is as shown in SEQ ID NO: 2; the SEQ ID NO: 1 is CGTCGAGTGGATTAAGCACT, and the SEQ ID NO: 2 is SEQ ID NO: 3. The SEQ ID NO: 2 is CCTTGCGACTAGCACAGAAC, and the SEQ ID NO: 2 is shown in the specification. According to the technical scheme, the core pain points that traditional morphological identification of pyrethrum is high in subjectivity, poor in reproducibility and prone to being affected by the environment are solved.

Description

TECHNICAL FIELD

[0001] The present application mainly relates to the technical field of Chrysanthemum cinerariafium identification, and particularly to an ITS marker primer for Chrysanthemum cinerariafium and application thereof in identification of Chrysanthemum cinerariafium. BACKGROUND

[0002] Chrysanthemum cinerariafium is the core raw material for extracting natural chrysanthemum cinerariafium ester, which is widely used in organic agriculture, household insect killing and storage protection fields. The global annual demand continues to grow, and Yunnan, Sichuan and other places in China have formed large-scale planting. However, Chrysanthemum cinerariafium dry flowers, leaves and deep processing powders are easily confused with Chrysanthemum morifolium, Hemerocallis citrina, Chrysanthemum coronarium, Chrysanthemum xanthina and other related Asteraceae plants in the circulation link, which leads to insufficient content of effective components, decreased efficacy, and seriously affects brand credibility and industrial benefits.

[0003] At present, the industry mainly relies on morphological characteristics or HPLC chemical fingerprints for identification. The morphological method is greatly influenced by individual development stage, drying process and observer experience, and the determination results of different personnel for the same batch of samples are significantly different; although HPLC can quantitatively determine chrysanthemum cinerariafium ester, the equipment is expensive, the pretreatment is complex, and the detection period is long, which cannot meet the rapid screening demand in the acquisition site. In addition, the related species often contain similar secondary metabolites, and the chemical method is also prone to false positives. The lack of a simple, specific and standardized molecular identification method has become a technical bottleneck restricting the healthy development of the Chrysanthemum cinerariafium industry.

[0004] The present application aims at the above-mentioned defects, and provides a specific marker primer based on the ITS sequence of Chrysanthemum cinerariafium and a rapid PCR detection system thereof, so as to solve the technical problem that Chrysanthemum cinerariafium cannot be quickly and accurately distinguished from related Asteraceae adulterants on site. SUMMARY

[0005] Based on this, the purpose of the present application is to provide an ITS marker primer for Chrysanthemum cinerariafium and application thereof in identification of Chrysanthemum cinerariafium, so as to solve the technical problems proposed in the background.

[0006] To achieve the above-mentioned purpose, the present application provides the following technical scheme: an ITS marker primer for Chrysanthemum cinerariafium, comprising a primer pair, wherein the primer pair comprises: an upstream primer Tco-ITS1-F, the nucleotide sequence of which is shown in SEQ ID NO: 1; and a downstream primer Tco-ITS1-R, the nucleotide sequence of which is shown in SEQ ID NO: 2.

[0007] According to one embodiment of the present application, the SEQ ID NO: 1 is: CGTCGAGTGGATTAAGCACT; and the SEQ ID NO: 2 is: CCTTGCGACTAGCACAGAAC.

[0008] According to one embodiment of the present application, the primer pair is used for specifically amplifying the ITS fragment with a length of about 482 bp in the pyrethrum genome by PCR, and the nucleotide sequence of the fragment is shown as SEQ ID NO: 3.

[0009] According to the technical scheme of the pyrethrum ITS marker primer above, the present application further provides application of the pyrethrum ITS marker primer in identifying pyrethrum, which comprises the following steps: step one, extracting total DNA of a sample to be tested; step two, using the DNA as a template and performing PCR amplification by using the primer pair; and step three, if a single target band with a length of about 482 bp appears in the amplification product, then it is determined that the sample to be tested is pyrethrum; and if no such band appears, then it is determined that the sample to be tested is not pyrethrum.

[0010] According to one embodiment of the present application, the sample to be tested is a leaf, a flower or a powder of a chrysanthemum plant.

[0011] According to one embodiment of the present application, the reaction system of the PCR amplification is as follows: 2x Accurate Taq Master Mix 25 μL, 10 μM forward primer 1 μL, 10 μM reverse primer 1 μL, DNA template 1 μL and sterile water 22 μL.

[0012] According to one embodiment of the present application, the PCR amplification procedure is as follows: pre-denaturation at 94℃ for 2 min; denaturation at 98℃ for 10 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min, for a total of 34 cycles; and final extension at 72℃ for 2 min.

[0013] According to the technical scheme of the pyrethrum ITS marker primer above, the present application further provides a PCR detection kit for identifying pyrethrum, wherein the kit comprises a primer pair and conventional reagents required for PCR reaction.

[0014] According to one embodiment of the present application, the kit further comprises pyrethrum positive control DNA.

[0015] According to one embodiment of the present application, the kit further comprises one or more of buffers, dNTPs and Taq enzyme required for PCR reaction.

[0016] In summary, the present application mainly has the following beneficial effects: The technical scheme in the present application solves the core pain points of strong subjectivity, poor reproducibility and easy environmental influence in the traditional morphological identification of pyrethrum; Firstly, the primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 2 is 3' end GC lock, no hairpin, no mismatch, Tm value 55-65 DEG C, GC content 45-55 %, which ensures the amplification efficiency and stability; repeated verification of 100 field samples, sharp band, no tailing, batch CV < 5 %, which lays a repeatable and standardized molecular basis for subsequent detection; Secondly, the primer pair only presents single specific amplification to about 482bp ITS fragment of Pyrethrum, and has no cross with close relatives such as Chirita fortunei, Pyrethrum roseum and Pyrethrum roseum, which directly solves the industry problem of 'close chrysanthemum adulteration difficult to distinguish', and provides an objective and unique molecular identity card for market supervision.

[0017] The technical solution in the application completely replaces the ambiguous morphological experience with a high-specificity, high-stability and low-cost molecular tool, which not only blocks the adulteration loophole, but also improves the overall efficiency and reputation of the industry chain, and has the dual advantages of scientific rigor and industrial landing. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 is a DNA quality detection band diagram of the application; Figure 2 is an electrophoresis effect diagram of a first Pyrethrum specific primer Tco-ITS1 of the application; Figure 3 is an electrophoresis effect diagram of a second Pyrethrum specific primer Tco-ITS1 of the application. DETAILED DESCRIPTION

[0019] The technical solutions in the embodiments of the application will be described clearly and completely below with reference to the drawings of the embodiments of the application. The embodiments described below with reference to the drawings are exemplary and are only used to explain the application, and cannot be understood as a limitation of the application.

[0020] The embodiments of the application will be described below according to the overall structure of the application. In a preferred embodiment of the application, the preparation of Pyrethrum ITS marker primer:

[0021] The conventional solid-phase phosphoramidite triester method is used to synthesize the following on an ABI 3900 DNA synthesizer: The upstream primer Tco-ITS1-F is 5'-CGTCGAGTGGATTAAGCACT-3', and the downstream primer Tco-ITS1-R is 5'-CCTTGCGACTAGCACAGAAC-3'. After synthesis, the OPC column is purified, the HPLC purity is greater than or equal to 95 %, and the product is stored at -20 DEG C for standby. Referring to the drawings in detail, Figures 1-3 In another preferred embodiment of the application, the Pyrethrum specific ITS fragment is obtained.

[0022] 1. Sample collection 100 Chrysanthemum cinerariaefolium plants without disease and insect pests were selected from the Chrysanthemum cinerariaefolium planting base in Midu County, Dali, Yunnan Province. The tender leaves were collected and mixed after being numbered by individual plant as a biological replicate sample.

[0023] 2. DNA extraction The total DNA was extracted by using OMEGA E.Z.N.A. HR Plant DNA Kit (D2485-01), and the DNA concentration was 25-45 ng / μL, OD260 / OD280 was between 1.83-1.96, and 1% agarose gel electrophoresis showed that the main band was clear without degradation.

[0024] 3. PCR amplification Reaction system (50 μL): 2 x Accurate Taq Master Mix 25 μL, 10 μM Tco-ITS1-F 1 μL, 10 μM Tco-ITS1-R 1 μL, DNA template 1 μL (about 30 ng), and sterile water 22 μL.

[0025] PCR program: 94℃ 2min; 98℃ 10s, 55℃ 30s, 72℃ 1min, 34 cycles; 72℃ 2min.

[0026] 4. Product recovery and sequencing 5 μL of PCR product was taken for 1% agarose gel electrophoresis, and a single 482 bp band was visible. After gel recovery, it was sent to Sanger sequencing by Qikang Biological Co., Ltd., and the obtained sequence was completely consistent with SEQ ID NO: 3.

[0027] 5. Specificity verification The DNA of Asteraceae plants such as Chrysanthemum indicum, Nymphoides peltatum, Chrysanthemum coronarium, Chrysanthemum morifolium, and Chrysanthemum indicum was used as a template to perform PCR under the same conditions, and no about 482 bp band was detected, proving that the primer pair of SEQ ID NO: 1 and SEQ ID NO: 2 has high specificity for Chrysanthemum cinerariaefolium; Appendix Figure 3 Chrysanthemum cinerariaefolium No. T, Chrysanthemum indicum No. A, Nymphoides peltatum No. B, Chrysanthemum coronarium No. C, Chrysanthemum morifolium No. D, and Chrysanthemum indicum No. E.

[0028] As shown in the accompanying Figure 2As shown: the band edge is sharp, no tailing, indicating that the DNA integrity is good, no degradation, single target band without mixed band, the band position and brightness are consistent in repeated experiments, indicating that the results are repeatable, single band without multimer or degradation product, narrow and sharp band without horizontal diffusion or tailing. The above primers meet the two core excellent primer characteristics of stability and amplification efficiency. In another preferred embodiment of the present application, the application of the identification method is:

[0029] 1. Sample type: Respectively: fresh Chrysanthemum cinerariaefolium leaves, commercially available dry flowers labeled as Chrysanthemum cinerariaefolium, and Chrysanthemum cinerariaefolium powder.

[0030] 2. DNA extraction: modified CTAB method for leaves and dry flowers; 50 mg of powder was directly taken and OMEGA E.Z.N.A. HR Plant DNA Kit (D2485-01) was used to extract total DNA.

[0031] 3. PCR detection Reaction system (50 μL): 2×Accurate Taq Master Mix 25 μL, 10 μM Tco-ITS1-F 1 μL, 10 μM Tco-ITS1-R 1 μL, DNA template 1 μL (about 30 ng), and sterile water 22 μL.

[0032] PCR program: 94℃ 2min; 98℃ 10s, 55℃ 30s, 72℃ 1min, 34 cycles; 72℃ 2min.

[0033] Results: Fresh Chrysanthemum cinerariaefolium leaves and commercially available dry flowers labeled as Chrysanthemum cinerariaefolium samples all appeared about 482 bp single target band, which were determined as Chrysanthemum cinerariaefolium; Chrysanthemum cinerariaefolium powder sample had no band, which was determined as non-Chrysanthemum cinerariaefolium, and was verified by morphology and HPLC to be a fake sample.

[0034] 4. Reproducibility The same batch of samples was detected for 3 times, and the batch-to-batch CV was less than 5%. In another preferred embodiment of the present application, the preparation of the PCR detection kit is:

[0035] 1. Ingredients: primer pair: Tco-ITS1-F / Tco-ITS1-R, each 100 μL (10 μM), 2×Accurate Taq Master Mix 1.25 mL, Chrysanthemum cinerariaefolium positive control DNA (100 ng / μL) 50 μL, and ultrapure water 1.5 mL.

[0036] 2. Packaging: the above components are placed in a foam box at -20℃ for transportation, and are stored at room temperature for no more than 7 days; long-term storage at -20℃.

[0037] 3. Perform the method steps for identification. If the positive control shows a band of about 482 bp and the sample under test shows no band, the kit is valid and the sample is identified as not pyrethrum.

[0038] SEQ ID NO: 3 is: CTCTCGATGCTTTGTCGATGTGCATTTACTTGTGTTCTTTTGGACACGGTGAATGCGTCATTGGCGCAATAACAACCCCCGGCACAATGTGTGCCAAGGAAAACTAAACTTAAGAAGGCTTGTTTCGTGTTGCCCCGTTCGCGGTGTGCTCATGGGACGTGGCTTCTTTATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCAACAAATCTTTGTTGGGGGCGGATATTGGTCTCCCGTGCTCATGGTGTGGTTGGCCAAAACAGGAGTACCTTCGATGGACGCACGAACTAGTGGTGGTCGTAAAAACCCTCGTTCTTTGTTCTGTGCT.

[0039] Although the embodiments of the present application have been shown and described, the specific embodiments are merely illustrative of the present application, and are not intended to limit the present application, and the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner, and those skilled in the art can make modifications, replacements and variations of the embodiments without creative contribution after reading the present specification, but as long as they are within the scope of the claims of the present application, they are protected by the patent law.

Claims

1. An ITS marker primer of Chrysanthemum morifolium comprising a primer pair, wherein the primer pair is characterized by, The primer pair comprises: an upstream primer Tco-ITS1-F, the nucleotide sequence of which is shown as SEQ ID NO: 1; a downstream primer Tco-ITS1-R, the nucleotide sequence of which is shown as SEQ ID NO:

2.

2. The Chrysanthemum cinerariafolum ITS marker primer according to claim 1, wherein, the SEQ ID NO: 1 is CGTCGAGTGGATTAAGCACT; the SEQ ID NO: 2 is CCTTGCGACTAGCACAGAAC.

3. The ITS marker primer of Chrysanthemum morifolium according to claim 1, wherein The primer pair is used for specific amplification of an ITS fragment with a length of 482 bp in the Chrysanthemum cinerariafolum genome by PCR, and the nucleotide sequence of the fragment is shown as SEQ ID NO:

3.

4. The use of the Chrysanthemum morifolium ITS marker primer according to any one of claims 1-3 in identifying Chrysanthemum morifolium, characterized in that, The method comprises the following steps: Step 1: extracting total DNA from the sample to be tested; Step 2: using the primer pair to perform PCR amplification with the DNA as a template; Step 3: if a 482 bp single band appears in the amplification product, it is determined that the sample to be tested is Chrysanthemum cinerariafolum; if no such band appears, it is determined that the sample to be tested is not Chrysanthemum cinerariafolum.

5. The use of an ITS marker primer of Ageratum houstonianum in the identification of Ageratum houstonianum according to claim 4, characterized in that, The sample to be tested is a leaf, flower or powder of a plant in the Asteraceae family.

6. The use of an ITS marker primer of Chrysanthemum cinerariafium in identifying Chrysanthemum cinerariafium according to claim 4, characterized in that, The reaction system of the PCR amplification is: 2x Accurate Taq Master Mix 25 μL, 10 μM forward primer 1 μL, 10 μM reverse primer 1 μL, DNA template 1 μL and sterile water 22 μL.

7. The use of an ITS marker primer of Chrysanthemum cinerariafium in identifying Chrysanthemum cinerariafium according to claim 4, characterized in that, The PCR amplification procedure is: 94℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, a total of 34 cycles; and 72℃ final extension for 2 min.

8. A PCR detection kit for identifying Pyrethrum, which comprises a primer for ITS marker of Pyrethrum according to any one of claims 1 to 3. The kit comprises the primer pair and conventional reagents required for PCR reaction.

9. The PCR detection kit for identifying Tanacetum vulgare according to claim 8, characterized by, The kit further comprises: Chrysanthemum cinerariafolum positive control DNA.

10. The PCR detection kit for identifying Tanacetum vulgare according to claim 8, characterized by, The kit further comprises one or more of the following: buffer, dNTPs, Taq enzyme required for PCR reaction.

Images