Application of medicine for interfering HMGXB3 target spot in preparation of medicine for treating breast cancer metastasis

By using drugs that interfere with the HMGXB3 target, specifically targeting the HMGXB3 protein with Brincidofovir and blocking its function, the treatment challenge of breast cancer metastasis has been solved, achieving the effects of inhibiting breast cancer metastasis and improving the quality of life of patients.

CN121243386APending Publication Date: 2026-01-02SICHUAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511298344.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-11
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

There is a lack of effective treatments for breast cancer metastasis in the current technology, especially since the target of Brincidofovir in mammalian cells has not been elucidated and there is no evidence of breast cancer treatment.

Method used

Drugs that interfere with the HMGXB3 target, including HMGXB3 protein inhibitors, drugs that inhibit HMGXB3 gene expression, and drugs that knock out or knock down the HMGXB3 gene, are used. Brincidofovir specifically targets the HMGXB3 protein and inhibits breast cancer metastasis by blocking its function.

Benefits of technology

By blocking the function of the HMGXB3 protein, the metastasis of breast cancer can be inhibited, improving the quality of life of patients and increasing long-term survival rates.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121243386A_ABST
    Figure CN121243386A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of medicine application, and particularly relates to application of a medicine interfering HMGXB3 target spot in preparation of a medicine for treating breast cancer metastasis. Research finds that Brincidofovir specifically targets HMGXB3 protein, distant metastasis of breast cancer is inhibited in an HMGXB3 protein dependent mode, and the purpose of treating breast cancer metastasis is achieved. The Brincidofovir is applied to breast cancer patients with high HMGXB3 gene expression, and the HMGXB3 protein function can be blocked, so that the breast cancer metastasis process is inhibited, the life quality of the patients is improved, and the long-term survival rate is increased.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical applications, specifically relating to the use of drugs that interfere with the HMGXB3 target in the preparation of drugs for treating metastatic breast cancer. Background Technology

[0002] Breast cancer is a malignant tumor that occurs in the glandular epithelial tissue of the breast. It is the most common malignant tumor among women worldwide and also ranks among the leading causes of death. According to statistics from the International Agency for Research on Cancer in 2023, breast cancer accounts for 15.4% of all cancer deaths in women globally. Although comprehensive treatment methods (including surgery, radiotherapy, chemotherapy, targeted therapy, and immunotherapy) have brought the 5-year survival rate of early-stage breast cancer patients to 90%, metastatic breast cancer remains the leading cause of death among breast cancer patients, accounting for more than 90% of deaths. Therefore, how to effectively control the metastasis of breast cancer and improve the long-term survival rate of patients with metastatic breast cancer remains an urgent problem to be solved in clinical practice.

[0003] Brincidofovir, a long fatty side-chain derivative of cidofovir, is the first FDA-approved oral anti-smallpox drug suitable for all ages (2021). It primarily targets viral DNA polymerase, exerting its effect by competitively inhibiting viral DNA synthesis. Preclinical and clinical studies have demonstrated its broad-spectrum antiviral activity against DNA viruses (including adenoviruses, herpesviruses, and poxviruses), with no bone marrow suppression effect and low risk of nephrotoxicity. Current applications focus on salvage treatment of cytomegalovirus and adenovirus infections in immunocompromised patients. It has also shown effectiveness against pseudorabies virus and African swine fever virus in animal models.

[0004] Currently, there are more than 20 clinical trials related to brincidofovir, all of which are related to viral therapy. Although brincidofovir has broad-spectrum anti-DNA viral activity, its target in mammalian cells has not been elucidated, and there is no evidence of its use in breast cancer treatment. Therefore, there are no reports of its use in inhibiting breast cancer metastasis. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides the use of drugs that interfere with the HMGXB3 target in the preparation of drugs for treating breast cancer metastasis. These drugs include HMGXB3 protein inhibitors, drugs that inhibit HMGXB3 gene expression, drugs that knock out or down the HMGXB3 gene, and drugs that degrade HMGXB3.

[0006] Furthermore, the drugs that inhibit HMGXB3 gene expression include short hairpin RNA, circular RNA, antisense nucleic acid, small interfering nucleic acid, nucleic acid aptamer, small activating nucleic acid, micronucleic acid, mRNA drugs, and ribozymes; the drugs that knock out or knock down the HMGXB3 gene are CRISPR / Cas9 gene editing systems.

[0007] Furthermore, the HMGXB3 protein inhibitor includes brincidofovir.

[0008] Furthermore, the drug is a drug that inhibits local metastasis, regional metastasis, and / or distant metastasis of breast cancer.

[0009] Furthermore, the drug is a drug that inhibits distant metastasis of breast cancer.

[0010] Furthermore, the drug is a drug that inhibits the metastasis of breast cancer to the lungs.

[0011] Furthermore, the drug is a formulation prepared with an HMGXB3 protein inhibitor as the active ingredient and pharmaceutically acceptable excipients.

[0012] Furthermore, the formulation includes oral formulations or injectable formulations.

[0013] Furthermore, the oral formulations include solutions, tablets, pills, granules, and powders.

[0014] Furthermore, the injectable preparation includes powder for injection and solution for injection.

[0015] The "local metastasis of breast cancer" described in this invention refers to cancer cells directly invading the tissues surrounding the breast, such as the chest wall and skin around the breast, from the primary site of the breast. The "regional metastasis of breast cancer" described in this invention refers to the spread of cancer cells to regional lymph nodes, such as axillary lymph nodes and subclavian lymph nodes, through the lymphatic system. The "distant metastasis of breast cancer" described in this invention refers to the spread of cancer cells from the primary site of the breast to other distant organs of the body, such as the lungs, liver, bones, and brain, through the blood or lymphatic system.

[0016] This invention relates to the use of the HMGXB3 protein inhibitor in the preparation of drugs for treating breast cancer metastasis. Research has shown that Brincidofovir specifically targets the HMGXB3 protein, inhibiting distant metastasis of breast cancer in an HMGXB3-dependent manner, thereby achieving the goal of treating breast cancer metastasis. Applying Brincidofovir to breast cancer patients with high HMGXB3 gene expression can block HMGXB3 protein function, thereby inhibiting the progression of breast cancer metastasis, improving patients' quality of life, and increasing long-term survival rates.

[0017] Obviously, based on the above description of the present invention, and in accordance with common technical knowledge and conventional methods in the field, various other modifications, substitutions, or alterations can be made without departing from the basic technical concept of the present invention.

[0018] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0019] Figure 1 pCDH-CMV-Stag-HA-HMGXB3 mass spectrum; Figure 2 Mass spectrum of plko-sh-mHmgxb3#1 (mouse); Figure 3 Mass spectrum of plko-sh-mHmgxb3#2 (mouse); Figure 4 Mass spectrum of plko-sh-hHmgxb3#1 (human); Figure 5 Mass spectrum of plko-sh-hHmgxb3#2 (human); Figure 6 In vitro experiments demonstrated that Brincidofovir inhibits breast cancer metastasis in an HMGXB3 protein-dependent manner; (A) Construction of HMGXB3 gene knockout breast cancer cell lines (4T1, MDA-MB-231) and qPCR detection of mRNA expression levels in breast cancer cells; (B) Transwell assay to evaluate the effect of Brincidofovir treatment for 24 h on the metastatic ability of normal breast cancer cells; (C, D) Transwell assay to evaluate the effect of Brincidofovir treatment for 48 h on the metastatic ability of HMGXB3 gene knockdown breast cancer cells; *p<0.05, **P<0.01, ***P<0.001, ****P<0.0001; sh#1, sh#2, and sh-CTRL refer to HMGXB3 gene knockdown cell lines constructed using two different shRNAs and control cell lines using a blank shRNA vector, respectively; Bri refers to Brincidofovir.

[0020] Figure 7Brincidofovir specifically targets HMGXB3. (A) Construction of HA-HMGXB3 overexpressing (HA-Tag-tagged) breast cancer cell lines and Western Blot verification of overexpression; (B) Screening of streptoprotein pronase concentration in Drug Affinity Response Target Stability Assay (DARTS); setting a streptoprotein pronase concentration gradient and evaluating the degradation of HA-HMGXB3 protein in cells using Western Blot experiments; (C) DARTS demonstrating the specific affinity of Brincidofovir for HMGXB3 protein. Setting a Brincidofovir concentration gradient and evaluating the protective effect of Brincidofovir on HA-HMGXB3 protein under streptoprotein enzymatic hydrolysis using Western Blot experiments; (D) Cell thermal stability assay (CETSA) demonstrating the targeting of Brincidofovir to HMGXB3 protein. Western blotting was used to detect protein denaturation in cells after heat shock at a specified temperature for 3 minutes, with or without Brincidofovir treatment; (E) CETSA curve plotting: CETSA curves were constructed by plotting the intensity of the immunoblot bands shown in Figure D against temperature.

[0021] Figure 8 In vivo experiments demonstrated that Brincidofovir inhibits breast cancer metastasis in an HMGXB3-dependent manner. An in vivo xenograft model (CDX model) was constructed using the HMGXB3-knockdown 4T1 cell line and divided into four groups (sh-CTRL with PBS, sh-CTRL with PBS, shHmgxb3 with PBS, and shHmgxb3 with PBS). The figures show representative lung images and the number of metastatic lesions after 4 weeks of administration. *p<0.05, **P<0.01, ***P<0.001, ****P<0.0001; shHmgxb3 and sh-CTRL refer to the cell line with Hmgxb3 gene knockdown and the control cell line using a blank shRNA vector, respectively; Bri refers to Brincidofovir. Detailed Implementation

[0022] The raw materials, equipment, and reagents used in the specific embodiments of this invention are all known products, obtained by purchasing commercially available products. The nucleotide sequence information involved is as follows: Nucleotide sequence of the HMGXB3 gene fragment (SEQ ID No. 1): The nucleotide sequence of mHmgxb3#1 is SEQ ID No. 2: CCGGCCTGCCTTGCTGGCTTATTTACTCGAGTAAATAAGCCAGCAAGGCAGGTTTTTG; The nucleotide sequence of mHmgxb3#2 is SEQ ID No. 3: CCGGGCAGACCTCTTGGTCGAATTACTCGAGTAATTCGACCAAGAGGTCTGCTTTTTG The nucleotide sequence of hHmgxb3#1 is SEQ ID No. 4: CCGGCAAACCTCTTGGTCGAATTATCTCGAGATAATTCGACCAAGAGGTTTGTTTTTG The nucleotide sequence of hHmgxb3#2 is SEQ ID No. 5: CCGGACTCAACAGCTCTCGACTTATCTCGAGATAAGTCGAGAGCTGTTGAGTTTTTTG Example 1: Study on the effect of brincidofovir on breast cancer metastasis I. Methods 1. In vitro test 1.1 Cell Culture The 4T1 (mouse breast cancer cell line) and MDA-MB-231 (human breast cancer cell line) cell lines were obtained from the American Type Culture Collection (ATCC). The MDA-MB-231 cell line was cultured in DMEM high-glucose medium; the 4T1 cell line was cultured in RPMI 1640 medium. The medium was supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin, and cultured in an incubator at 37°C and 5% CO2.

[0023] 1.2 Construction of HMGXB3 overexpression and knockdown breast cancer cell lines For overexpression cell lines, the HMGXB3 overexpression vector containing the HA-Tag tag (pCDH-CMV-Stag-HA-HMGXB3) was used. Figure 1 ), and perform lentivirus packaging.

[0024] For the knockdown cell lines, lentiviral packaging was performed using shRNA vectors: plko-sh-CTRL, plko-sh-mHmgxb3#1 (mouse), plko-sh-mHmgxb3#2 (mouse), plko-sh-hHmgxb3#1 (human), and plko-sh-hHmgxb3#2 (human). plko-sh-CTRL was a blank shRNA vector, and plko-sh-mHmgxb3#1 (mouse) was an shRNA expression vector linked to shRNA-mHmgxb3#1 (SEQ ID No. 2). Figure 2 ), plko-sh-mHmgxb3#2 (mouse) is an shRNA expression vector linked to shRNA-mHmgxb3#2 (SEQ ID No. 3). Figure 3 ); plko-sh-hHmgxb3#1 (human) is an shRNA expression vector linked to shRNA-hHmgxb3#1 (SEQ ID No. 4). Figure 4 ), plko-sh-hHmgxb3#2 (human) is an shRNA expression vector linked to shRNA-hHmgxb3#2 (SEQ ID No. 5). Figure 5 ); After lentivirus packaging, the viral supernatant was added to target cells for infection. Stable transfected cells were selected 72 hours after infection using 4 μg / mL puromycin. Knockdown and overexpression were verified using qPCR.

[0025] 1.3 qPCR experiment The standard qPCR assay was performed. Total RNA was extracted using TRIzol, and the purity and concentration of the RNA samples were determined using a NanoDrop 2000 instrument (Thermo Fisher Scientific). Genomic DNA was removed from the total RNA samples, and cDNA was synthesized via reverse transcription. Using the cDNA as a template, a quantitative reverse transcription polymerase chain reaction (qPCR) assay was performed to detect the mRNA expression level of HMGXB3. The primer sequences used are as follows: F (SEQ ID No.6): 5'- CCCAGGTTTCCGAAAGATCCT - 3' R (SEQ ID No.7): 5' - TAGGGGACATCTGGTTCTGAG - 3' 1.4 Western Blot Experiment The procedure was performed according to standard Western blotting methods. Specifically, cells overexpressing HA-HMGXB3 were collected into centrifuge tubes, and protein lysates were prepared using the RIPA method. Proteins were then separated by polyacrylamide gel electrophoresis and transferred to a PVDF membrane. The membrane was blocked with PBST solution containing 5% BSA for 1 hour to prevent non-specific antibody binding. Subsequently, the membrane was incubated overnight at 4°C with anti-HA tag (1:3000, CST, #3724). After washing three times with PBST, the membrane was incubated with anti-rabbit secondary antibody at 37°C for 1 hour. Finally, an enhanced chemiluminescence assay kit was used to visualize the proteins.

[0026] 1.5 Transwell Experiment Migration experiments were conducted in uncoated Transwell chambers with 8 μm pore sizes. Specifically, before the Transwell experiments, the experimental groups were pretreated with specified concentrations of Brincidofovir (100 nM, 300 nM, 1 μM) for 6 h. The upper chamber was then inoculated with 5 × 10⁵ cells suspended in 200 μL of serum-free culture medium. 4 HMGXB3 overexpressing and knockdown breast cancer cells were seeded in 700 μL of medium containing 20% ​​FBS in the lower chamber, while the upper chamber was supplemented with specified concentrations of Brincidofovir (100 nM, 300 nM, 1 μM). After incubation for 24 h or 48 h, cells that had penetrated the subcellular surface were fixed and stained with 4% paraformaldehyde and crystal violet. Subsequently, three fields of view were randomly selected for microscopic photography, and cell counting was performed using ImageJ software.

[0027] 1.6 Drug Affinity Response Target Stability Study (DARTS) DARTS is an assay used to verify whether a drug directly binds to a target protein. HA-HMGXB3 overexpressing cells were lysed using M-PER lysis buffer containing protease and phosphatase inhibitors. TNC buffer (50 mM Tris-HCl pH 8.0, 50 mM NaCl, 10 mM CaCl2) was added, and protein concentration was determined using the BCA method. On one hand, the cells were digested with a specified concentration gradient of streptomycin pronase (10 ng / ml, 30 ng / ml, 100 ng / ml, 300 ng / ml, 1 μg / ml, 3 μg / ml, 10 μg / ml) at room temperature for 30 minutes, and the reaction was terminated by boiling in a water bath. The degree of HA-HMGXB3 protein degradation was analyzed by Western blotting to screen for suitable pronase concentrations for subsequent experiments. On the other hand, the cell lysate was incubated with different concentrations of Brincidofovir or ddH2O at room temperature for 1 hour, followed by digestion with pronase at room temperature for 30 minutes, and the reaction was terminated by boiling in a water bath. The protective effect of brincidofovir on HA-HMGXB3 protein was analyzed by Western blotting.

[0028] 1.7 Cell thermal stability assay (CETSA) The direct binding between brincidofovir and HMGXB3 in HA-HMGXB3-overexpressing cells was determined using the CETSA method. Cells were pretreated with 100 μM brincidofovir for 4 h, then cooled on ice, washed with PBS containing a mixture of protease inhibitors, and then subjected to heat shock at specified temperatures (40.0℃, 41.4℃, 44.6℃, 49.2℃, 55.0℃, 59.8℃) for 3 min to denature the proteins, followed by cooling at room temperature for 3 min. Finally, all samples underwent three freeze-thaw cycles on dry ice and a thermal cycler to lyse the cells, followed by centrifugation at 20,000 g for 20 min at 4℃ to clarify the supernatant and precipitate cell debris and aggregated proteins. The supernatant was boiled and then subjected to Western blotting analysis to assess HMGXB3 protein denaturation. The bands were quantitatively analyzed using ImageJ software, and CETSA curves were plotted.

[0029] 2. In vivo testing All animal procedures in this experiment were approved by the Animal Ethics Committee of Sichuan University and strictly adhered to the "Guidelines for the Care and Use of Laboratory Animals" issued by the U.S. Public Health Service and the standards of the Association for Assessment and Accreditation of Laboratory Animals (AAALAC). SPF-grade female BALB / c mice (6 weeks old) were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. Four groups were established: sh-CTRL to PBS group, sh-CTRL to drug group, shHmgxb3 to PBS group, and shHmgxb3 to drug group. The sh-CTRL to PBS group and the sh-CTRL to drug group used mice injected with 4T1 cells treated with a blank shRNA vector. The shHmgxb3 to PBS group and the shHmgxb3 to drug group used mice injected with 4T1 cells whose HMGXB3 was knocked down using plko-sh-mHmgxb3#2. Cells in the logarithmic growth phase were washed with PBS and then... 7 Cells / mL density resuspended; 100 μL of cell suspension (containing 1 × 10⁻⁶ cells / mL) was injected orally into the fourth pair of mammary fat pads of each mouse. 6 (8 cells), with 8 biological replicates per group; samples were collected 1 week after inoculation. The treatment group was given Brincidofovir by gavage, while the control group was given an equal amount of PBS by gavage; Brincidofovir was administered 2 days / time, with an initial dose of 20 mg / kg / time, followed by 5 mg / kg / time; after 4 weeks of administration, highly metastatic organs (lungs) were obtained, fixed and stained with Bouin's fixative, and the surface metastatic nodules were counted under a stereomicroscope.

[0030] II. Results 1. Results of in vitro cell experiments First, a breast cancer cell line with HMGXB3 gene knockdown was constructed, and the knockdown efficiency was verified using qPCR experiments. Figure 6 A). The effect of brincidofovir on the metastatic ability of normal breast cancer cell lines was then assessed using Transwell assays. The results showed that brincidofovir significantly inhibited the migration of normal breast cancer cells in a concentration-dependent manner. Figure 6 B), but its effect disappeared in HMGXB3 knockdown cells (B). Figure 6 C, D).

[0031] Then, two experiments, DARTS and CETSA, were used to demonstrate whether the drug directly binds to the target protein. ① A cell line overexpressing MDA-MB-231 with HMGXB3 and HA-Tag was constructed and validated using Western blotting. Figure 7 A). ② Screening for a pronase concentration of 300 ng / ml suitable for DARTS experiments ( Figure 7B). Furthermore, in DARTS experiments, it was verified that brincidofovir concentration-dependently protected the enzymatic digestion of HMGXB3 protein. Figure 7 C). Furthermore, CETSA experiments confirmed that the direct binding between Brincidofovir and HMGXB3 enhances the thermostability of the HMGXB3 protein. Figure 7 D, E).

[0032] 2. Results of in vivo animal experiments Using an in vivo xenograft model (CDX model) of the 4T1 cell line and administering Brincidofovir, fixation staining and metastatic lesion counting of the lung, a highly metastatic organ of breast cancer, revealed that Brincidofovir treatment significantly reduced lung metastases in normal 4T1 cells (sh-CTRL), while the number of metastases in the HMGXB3 knockdown group (shHmgxb3) showed no significant change. Figure 8 This indicates that Brincidofovir can inhibit breast cancer metastasis in an HMGXB3 gene-dependent manner.

[0033] In summary, Brincidofovir, as the first proven HMGXB3 protein inhibitor, inhibits breast cancer metastasis in an HMGXB3-dependent manner by blocking HMGXB3, and has clear clinical applicability in the preparation of drugs for the treatment of breast cancer metastasis.

Claims

1. The use of a drug that interferes with the HMGXB3 target in the preparation of a drug for treating metastatic breast cancer, characterized in that: The drugs that interfere with the HMGXB3 target include HMGXB3 protein inhibitors, drugs that inhibit HMGXB3 gene expression, drugs that knock out or knock down the HMGXB3 gene, and drugs that degrade HMGXB3.

2. The use according to claim 1, characterized in that: The drugs that inhibit HMGXB3 gene expression include short hairpin RNA, circular RNA, antisense nucleic acid, small interfering nucleic acid, nucleic acid aptamers, small activating nucleic acid, micronucleic acid, mRNA drugs, and ribozymes; the drugs that knock out or knock down the HMGXB3 gene are CRISPR / Cas9 gene editing systems.

3. The use according to claim 1, characterized in that: The HMGXB3 protein inhibitors include brincidofovir.

4. The use according to claim 1, characterized in that: The drug is used to inhibit local metastasis, regional metastasis, and / or distant metastasis of breast cancer.

5. The use according to claim 3, characterized in that: The drug in question is used to inhibit distant metastasis of breast cancer.

6. The use according to claim 5, characterized in that: The drug in question is a medication that inhibits the metastasis of breast cancer to the lungs.

7. The use according to claim 1, characterized in that: The drug is a formulation prepared with an HMGXB3 protein inhibitor as the active ingredient and pharmaceutically acceptable excipients.

8. The use according to claim 7, characterized in that: The formulation includes oral formulations or injectable formulations.

9. The use according to claim 8, characterized in that: The oral preparations include solutions, tablets, pills, granules, and powders.

10. The use according to claim 9, characterized in that: The injectable preparations include powder for injection and solution for injection.