Methods for treating hepazidine-mediated conditions

Abstract

The present invention relates to a method for treating a hypazidine mediated condition.

Description

[0001] This application is a divisional application of Chinese Patent Application No. 201680045105.6, "Methods for treating hepcidin-mediated disorders", filed on July 28, 2016.

[0002] 1. CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62 / 199,434, filed on July 31, 2015, and U.S. Provisional Application No. 62 / 268,788, filed on December 17, 2015, each of which is incorporated herein by reference in its entirety. 2. BACKGROUND The peptide hormone hepcidin plays a major role in systemic iron homeostasis. Hentze et al, Cell 142:24-38 (2010). Hepcidin expression is known to be influenced by the product of the TMPRSS6 gene, matriptase-2, a type II transmembrane serine protease. Common variants of the TMPRSS6 gene have been associated with iron status, Benyamin et al, Nature Genetics 41(11): 1173-1175 (2009), where the rs855791 SNP (2321G→A; A736V) has been shown to be associated with a naturally occurring variant in hepcidin expression and blood hemoglobin levels.

[0004] Hepcidin expression is also implicated in human iron disorders (Pietrangelo, J. Hepatology 54:173-181 (2011)) and anemia of chronic disease (ACD), also known as anemia of inflammation (AI). ACD is prevalent in patients with chronic infections, autoimmune diseases, cancer, and chronic kidney disease (CKD). Sun et al, Am. J. Hematol . 87(4):392-400 (2012).

[0005] There is a need in the art for methods of treating hepcidin-mediated disorders. 3. SUMMARY It has been shown that reduced IL-6 signaling provides clinical benefit in patients with hepcidin-mediated disorders, including anemia of chronic disease and hepcidin-mediated cytotoxicity, but only in those patients having at least one copy of the major allele of TMPRSS6 rs855791, with the greatest effect in patients having elevated IL-6 levels.

[0007] Accordingly, in a first aspect, methods of treating a hepcidin-mediated disorder are provided. The methods comprise administering to a patient having a hepcidin-mediated disorder a therapeutically effective amount of an IL-6 antagonist, the patient having been determined to have TMPRSS6 at least one copy of the major allele at rs855791. In a first series of embodiments, the patient has been previously determined to have TMPRSS6 at least one copy of the major allele at rs855791. In another series of embodiments, the method further comprises the earlier step of determining that the patient has TMPRSS6 at least one copy of the major allele at rs855791. Typically, the patient has an elevated pre-treatment serum IL-6 level. In some embodiments, the patient has an elevated pre-treatment serum CRP level.

[0008] In various embodiments, the hepcidin-mediated disorder is a chronic anemia.

[0009] In some anemia embodiments, the patient is male and has a pre-treatment hemoglobin (Hb) level of less than 14 g / dl; a pre-treatment Hb level of less than 13 g / dl; a pre-treatment Hb level of less than 12 g / dl; or a pre-treatment Hb level of less than 11 g / dl. In some anemia embodiments, the patient is female and has a pre-treatment Hb level of less than 12 g / dl; a pre-treatment Hb level of less than 11 g / dl; a pre-treatment Hb level of less than 10 g / dl; or a pre-treatment Hb level of less than 9 g / dl.

[0010] In some anemia embodiments, the patient is male and has a pre-treatment hematocrit of less than 40%, less than 35% or 30-34%. In some embodiments, the patient is female and has a pre-treatment hematocrit of less than 36%, less than 35%, less than 34%, less than 33%, less than 32% or less than 31%. In some embodiments, the pre-treatment hematocrit of the female patient is 26-29%.

[0011] In various anemia embodiments, the patient has received at least one pre-treatment administration of an erythropoiesis stimulating agent (ESA). In certain embodiments, the patient has received at least one pre-treatment administration of an ESA and has a normal Hb level or a normal hematocrit. In various embodiments, the patient has received at least one pre-treatment administration of an iron supplement. In certain embodiments, the patient has received at least one pre-treatment administration of an iron supplement and has a normal Hb level or a normal hematocrit. In various embodiments, the patient has received at least one pre-treatment transfusion of blood or red blood cell concentrate. In certain embodiments, the patient has received at least one pre-treatment transfusion of blood or red blood cell concentrate and has a normal Hb level or a normal hematocrit.

[0012] In various anemia embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to increase the patient's Hb level above the level prior to treatment. In various embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to increase the patient's hematocrit above the level prior to treatment. In some embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to decrease the patient's ESA dose below the level present immediately prior to treatment without decreasing the patient's Hb level. In certain embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to decrease the patient's ESA dose below the level present immediately prior to treatment without decreasing the patient's hematocrit.

[0013] In various embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to decrease the patient's ESA dose by at least 10% compared to the ESA dose prior to treatment, decrease the patient's ESA dose by at least 20% compared to the ESA dose prior to treatment, decrease the patient's ESA dose by at least 30% compared to the ESA dose prior to treatment, decrease the patient's ESA dose by at least 40% compared to the ESA dose prior to treatment, or decrease the patient's ESA dose by at least 50% compared to the ESA dose prior to treatment.

[0014] In some embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to reverse functional iron deficiency.

[0015] In a series of embodiments, the hepcidin-mediated disorder is a chronic disease that is chronic kidney disease (CKD) and the chronic disease anemia.

[0016] In some CKD embodiments, the patient has KDOQI stage 1 chronic kidney disease, KDOQI stage 2 chronic kidney disease, KDOQI stage 3 chronic kidney disease, KDOQI stage 4 chronic kidney disease, or KDOQI stage 5 chronic kidney disease. In particular embodiments, the patient has KDOQI stage 5 chronic kidney disease.

[0017] In some CKD embodiments, the patient has cardiorenal syndrome (CRS). In particular embodiments, the patient has CRS type 4. In certain embodiments, the patient has received at least one dialysis treatment prior to treatment.

[0018] In some CKD embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce cardiovascular (CV) mortality compared to an age- and disease-matched historical control.

[0019] In various embodiments, the hepcidin-mediated disorder is a chronic disease that is chronic inflammatory disease and the chronic disease anemia.

[0020] In some embodiments, the chronic inflammatory disease is rheumatoid arthritis (RA). In certain embodiments, the patient has a pre-treatment DAS28 score greater than 5.1. In some embodiments, the patient has a pre-treatment DAS28 score of 3.2 to 5.1. In particular embodiments, the patient has a pre-treatment DAS28 score less than 2.6. In selected embodiments, the patient has a pre-treatment RA that is moderately active to severely active.

[0021] In some RA embodiments, the patient has received at least one pre-treatment administration of a methotrexate. In some embodiments, the patient has received at least one pre-treatment administration of a TNFα antagonist. In selected embodiments, the TNFα antagonist is selected from the group consisting of etanercept, adalimumab, infliximab, certolizumab, and golimumab.

[0022] In some RA embodiments, the patient has received at least one pre-treatment administration of an IL-6 antagonist. In certain embodiments, the pre-treatment IL-6 antagonist is tocilizumab or tofacitinib.

[0023] In a preferred series of embodiments, the IL-6 antagonist being treated is MEDI5117.

[0024] In various embodiments, the hypoxia-inducible factor-mediated disorder chronic disease is a chronic disease selected from the group consisting of anemia of chronic disease, juvenile idiopathic arthritis, ankylosing spondylitis, psoriasis, psoriatic arthritis, inflammatory bowel disease, Crohn's disease, and ulcerative colitis.

[0025] In some embodiments, the hypoxia-inducible factor-mediated disorder chronic disease is anemia of chronic disease, wherein the chronic disease is cancer. In certain embodiments, the cancer is selected from the group consisting of a solid tumor, small cell lung cancer, non-small cell lung cancer, a hematological cancer, multiple myeloma, leukemia, chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), lymphoma, Hodgkin's lymphoma, and hepatocellular adenoma.

[0026] In some embodiments, the hypoxia-inducible factor-mediated disorder chronic disease is anemia of chronic disease, wherein the chronic disease is a chronic infection.

[0027] In some embodiments, the hypoxia-inducible factor-mediated disorder chronic disease is anemia of chronic disease, wherein the chronic disease is congestive heart failure (CHF).

[0028] In some implementations, the condition mediated by hepazil is iron-refractory iron deficiency anemia (IRIDA).

[0029] In some implementations, the condition mediated by hepazidine is acute coronary syndrome. In a particular implementation, the patient has suffered a myocardial infarction (MI) within 60 days, 30 days, 48 ​​hours, or 24 hours prior to the first administration of the IL-6 antagonist.

[0030] In some implementations of acute coronary syndrome, a timed dose of an IL-6 antagonist is administered for a duration sufficient to improve myocardial contractility compared to pre-treatment levels. In some implementations of acute coronary syndrome, a timed dose of an IL-6 antagonist is administered for a duration sufficient to increase cardiac ejection fraction compared to pre-treatment levels. In some implementations of acute coronary syndrome, a timed dose of an IL-6 antagonist is administered for a duration sufficient to reduce cardiac fibrosis compared to pre-treatment levels.

[0031] In some implementations, the condition mediated by hepazidine is Castleman's disease.

[0032] In another aspect, a method for improving the treatment of heptacil-mediated disease is provided. The method involves discontinuing the administration of an IL-6 antagonist to a patient with heptacil-mediated disease, wherein the patient has been identified as homozygous for the TMPRSS6rs855791 minor allele.

[0033] In another aspect, a method is provided to improve the treatment of heptacil-mediated disease by interrupting ineffective therapies, thereby reducing side effects and costs without losing therapeutic efficacy. The method involves interrupting the administration of an IL-6 antagonist to a patient suffering from heptacil-mediated disease, wherein the patient has been identified as having a predisposition to heptacil-mediated disease. TMPRSS6 The rs855791 minor allele is homozygous. In a series of implementations, the patient's specific allele has been previously identified as being targeted... TMPRSS6 The rs855791 minor allele is homozygous. In another series of embodiments, the method further includes determining the patient's specific allele for... TMPRSS6 The rs855791 minor allele is a homozygous early step. In a typical embodiment, the patient has elevated pre-treatment serum IL-6 levels. In various embodiments, the patient has elevated pre-treatment serum CRP levels. In various embodiments, the patient suffers from hepatocillin-mediated disease selected from those described in section 5.4.1 herein. In some embodiments, the patient suffers from chronic disease anemia.

[0034] The data presented in Examples 2, 3, and 5 indicate that IL-6 antagonists provide therapeutic benefit in individuals with elevated pre-treatment IL-6 levels and with TMPRSS6 IL-6 antagonists provide therapeutic benefit in individuals with at least one copy of the major allele of rs855791, and even in individuals without anemia. Thus, in another aspect, methods for treating an IL-6 mediated inflammatory disorder in a patient without chronic inflammatory anemia are provided. The methods comprise administering to an individual, typically a human patient, having an IL-6 mediated inflammatory disorder, a therapeutically effective amount of an IL-6 antagonist, wherein the patient does not have anemia, and wherein the individual has been determined to have TMPRSS6 at least one copy of the major allele of rs855791. In a first series of embodiments, the individual has been previously determined to have TMPRSS6 at least one copy of the major allele of rs855791. In another series of embodiments, the methods further comprise the earlier step of determining that the individual has TMPRSS6 at least one copy of the major allele of rs855791. Typically, the methods positively exclude treating individuals homozygous for the minor allele of rs855791. Typically, the patient has an elevated pre-treatment serum IL-6 level. TMPRSS6 rs855791. Typically, the patient has an elevated pre-treatment serum IL-6 level.

[0035] In particular embodiments of any of the methods of treatment, the patient has an elevated pre-treatment serum IL-6 level. In certain embodiments, the patient has a pre-treatment serum IL-6 level greater than 2.5 pg / ml, greater than 5 pg / ml, greater than 7.5 pg / ml, greater than 10 pg / ml, or greater than 12.5 pg / ml.

[0036] In various embodiments, one dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce the level of free IL-6 in the serum of the patient below the pre-treatment level. In particular embodiments, one dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce the level of free IL-6 at least 10% compared to the pre-treatment level, at least 20% compared to the pre-treatment level, or at least 50% compared to the pre-treatment level.

[0037] In particular embodiments of any of the methods of treatment, the patient has an elevated pre-treatment C-reactive protein (CRP) level. In certain embodiments, the patient has a pre-treatment CRP level greater than 2 mg / ml, greater than 3 mg / ml, greater than 5 mg / ml, greater than 7.5 mg / ml, or even greater than 10 mg / ml.

[0038] In various embodiments, a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce the patient's CRP level below the pre-treatment level. In particular embodiments, a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce the patient's CRP level by at least 50% compared to the pre-treatment level.

[0039] In particular embodiments of any of the methods of treatment, the patient has been determined to have at least one copy of the TMPRSS6 rs855791 major allele using TaqMan® real-time PCR analysis.

[0040] In embodiments of any of the methods of treatment, the IL-6 antagonist is an anti-IL-6 antibody or antigen-binding fragment or derivative thereof.

[0041] In certain embodiments, the anti-IL-6 antibody or antigen-binding fragment or derivative has a Kd for binding to human IL-6 of less than 100 nM, less than 50 nM, less than 10 nM, or less than 1 nM. D In certain embodiments, the anti-IL-6 antibody or antigen-binding fragment or derivative has an elimination half-life of at least 7 days, at least 14 days, at least 21 days, or at least 30 days following intravenous administration.

[0042] In various antibody embodiments, the IL-6 antagonist is a full-length monoclonal anti-IL-6 antibody, such as an IgGl or IgG4 antibody.

[0043] In selected embodiments, the anti-IL-6 antibody or antigen-binding fragment or derivative is fully human. In some embodiments, the anti-IL-6 antibody or antigen-binding fragment or derivative is humanized.

[0044] In presently preferred embodiments, the anti-IL-6 antibody or antigen-binding fragment or derivative comprises all six variable region CDRs of MED5117. In some of these embodiments, the antibody comprises the VH and VL of MED5117. And in particular embodiments, the antibody is MED5117.

[0045] In various embodiments, the anti-IL-6 antibody or antigen-binding fragment or derivative comprises all six variable region CDRs of an antibody selected from the group consisting of siltuximab, gerilimzumab, sirukumab, clazakizumab, olokizumab, elsilimomab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb).

[0046] In some embodiments, the anti-IL-6 antibody or antigen-binding fragment or derivative comprises a heavy chain V region and a light chain V region from an antibody selected from the group consisting of siltuximab, gerilimzumab, sirukumab, clazakizumab, olokizumab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb). In particular embodiments, the anti-IL-6 antibody is an antibody selected from the group consisting of siltuximab, gerilimzumab, sirukumab, clazakizumab, olokizumab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb).

[0047] In some embodiments, the anti-IL-6 antibody or antigen-binding fragment or derivative is an antibody selected from the group consisting of: siltuximab, givinostat, sirukumab, clazakizumab, ontrizumab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb). In particular embodiments, the anti-IL-6 antibody is an antibody selected from the group consisting of: siltuximab, givinostat, sirukumab, clazakizumab, ontrizumab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb).

[0048] In various embodiments, the IL-6 antagonist is a single domain antibody, a VHH nanobody, a Fab, or a scFv.

[0049] In various embodiments, the IL-6 antagonist is an anti-IL-6R antibody or antigen-binding fragment or derivative thereof. In certain embodiments, the anti-IL-6R antibody, antigen-binding fragment or derivative is tocilizumab or vobarilizumab.

[0050] In various embodiments, the IL-6 antagonist is a JAK inhibitor. In specific embodiments, the JAK inhibitor is selected from the group consisting of: tofacitinib (Xeljanz), decernotinib, ruxolitinib, upadacitinib, baricitinib, filgotinib, lestaurtinib, pacritinib, peficitinib, INCB-039110, ABT-494, INCB-047986, and AC-410.

[0051] In various implementations, the IL-6 antagonist is a STAT3 inhibitor.

[0052] In some embodiments where the IL-6 antagonist is an antibody or antigen-binding fragment or derivative, the IL-6 antagonist is administered non-enterally. In certain embodiments, the IL-6 antagonist is administered subcutaneously.

[0053] In some embodiments where the IL-6 antagonist is a JAK inhibitor or a STAT3 inhibitor, the IL-6 antagonist is administered orally. 4. Description of the attached drawings Figure 1 A and 1B provide box plots illustrating the therapeutic need for increased erythropoietin (“EPO”) levels in patients with chronic kidney disease (CKD stage 5 dialysis individuals) exhibiting elevated serum IL-6 levels, and in TMPRSS6 The major allele at the known SNP rs855791 in the gene (G or C at nucleotide position 2321, encoding alanine at amino acid position 736) TMPRSS6 At least one copy of the polypeptide (736A); but for those with elevated IL-6 levels and targeting rs855791 TMPRSS6 The minor allele (T or A at nucleotide position 2321, encoding valine at position 736) TMPRSS6 Treatment is not required in patients with homozygous (736V) chronic kidney disease for the polypeptide. Data from patients with homozygous minor alleles (A / A) are presented in [the relevant section]. Figure 1 In A; data collected and presented from patients with at least one copy of the major allele (homozygous G / G and heterozygous G / A). Figure 1B. Based on tertiles of serum IL-6 levels: "Low" tertile (IL-6 < 5 pg / ml); "Mid" tertile (IL-6 = 5-15 pg / ml); "Highest" tertile (IL-6 > 15 pg / ml), further division of each of the two patient populations. Box plots with error bars overlaid above raw data. Each box plot represents a patient group based on both IL-6 levels and genotype. Details provided in Example 1.

[0055] Figure 2A and 2B Survival curves are provided that indicate that in response to elevated IL-6 levels in chronic kidney disease stage 5 dialysis individuals, TMPRSS6 The rs855791 major allele confers higher all-cause mortality. Figure 2A Data from patients homozygous for the minor allele (A / A) is shown. Figure 2B Data from patients with at least one copy of the major allele (homozygous G / G and heterozygous G / A) is shown. The Kaplan-Meier survival curves are shown for Figure 1 Each group was divided into tertiles of serum IL-6 levels based on IL-6 levels. Details provided in Example 1.

[0056] Figure 3 A graph showing that increasing amounts of EPO are required for therapy in chronic kidney disease patients (CKD stage 5 dialysis individuals) who have elevated serum levels of the acute phase reactant CRP and who have TMPRSS6 at least one copy of the rs855791 major allele; but are not required for therapy in chronic kidney disease patients who have elevated serum levels of the acute phase reactant CRP and who are homozygous for the rs855791 minor allele. Each genotype group was divided into serum CRP levels < 2 mg / L compared to > 2 mg / L. Details provided in Example 1.

[0057] Figure 4 A and 4B provide graphs that indicate that in patients after myocardial infarction ("MI"), in response to elevated IL-6 levels, TMPRSS6 rs85579 1 The major allele confers higher all-cause mortality. Figure 4 A depicts the cumulative probability of a death event over time (y-axis) compared to days after MI (x-axis) for the population homozygous for TMPRSS6 the rs855791 minor allele. Figure 4 B depicts the cumulative probability of a death event over time (y-axis) compared to days after MI (x-axis) for the population with TMPRSS6The cumulative probability of death over time in a population with at least one copy of the rs855791 major allele. As indicated, each group was divided into tertiles of serum IL-6 levels. IL-6 levels were measured one month after myocardial infarction. Mortality was measured one to 12 months after myocardial infarction. Details are provided in Example 2.

[0058] Figure 5 A and 5B provide graphs showing the elevated IL-6 levels in patients following MI. TMPRSS6 The major allele of rs855791 confers a higher risk of heart failure (“HF”). Figure 5 A description for targeting TMPRSS6 For a population where the minor allele of rs855791 is homozygous, the cumulative probability of HF over time (y-axis) is compared to the number of days after MI (x-axis). Figure 5 B depicts the cumulative probability of HF events over time for a population possessing at least one copy of the major allele of TMPRSS6 rs855791. As indicated, each group is divided into tertiles of serum IL-6 levels. IL-6 levels were measured one month after myocardial infarction. HF was measured one to 12 months after myocardial infarction. Details are provided in Example 2.

[0059] Figure 6A and 6B This presentation showcases the results of an analysis from human iPS cells, which have constitutively expressed... TMPRSS6 Transfection with the construct of the rs855791 minor or major allele, followed by differentiation into cardiomyocytes upon in vitro exposure to BMP2+IL-6 or BMP2 alone, indicates a response to IL-6. TMPRSS6 The major allele of rs855791 confers a higher risk of cell death (Trypan Blue positive). Figure 6A The results are shown in a normal oxygen environment. Figure 6B The results are presented after exposure to hypoxia and reoxygenation. The data suggest that reduced IL-6 exposure should be addressed by increasing [the level of] [therapeutic agents]. TMPRSS6 Patients with the rs855791 major allele showed increased cardiomyocyte survival, but not improved survival of patients with the rs855791 major allele. TMPRSS6 Cardiomyocyte survival in patients with the rs855791 minor allele. Details are provided in Example 3.

[0060] Figure 7 The accompanying diagram illustrates the experimental design for the cardiorenal syndrome study described in Example 4. In genotypes similar to those targeting... TMPRSS6The major allele of rs855791 induced CRS in rats that were homozygous for the human allele. This figure shows various events in the study along a timeline. In the study, myocardial infarction ("MI") was induced in the rats at week 0. At week 2, a single nephrectomy ("Nx") was performed in each animal. Following the nephrectomy until the end of the study, anti-IL-6 antibody (ab9770, Abeam Plc, UK) (Rx) or isotype control antibody ("IgG"; ab171516, Abeam Plc, UK) was administered once every 3 days starting at day 1 (D1) until the end of the study. Standard of care therapy (ACE inhibitor - perindopril) was administered daily from day 1 until the end of the study following the nephrectomy. At week 6, the rodents were sacrificed. In the "sham" control group of animals, no MI and Nx were performed. Various assessments of the rodents were performed at the time points indicated by arrows.

[0061] Figures 8A-8D Cardiac ejection fraction in rats treated with anti-IL-6 antibody ("IL-6 ab"), standard of care ACE inhibitor (perindopril or "Peri") compared to control ("isotype") treatment groups and sham operated animals in a model of cardiorenal syndrome outlined in Figure 7 and described in detail in Example 4. Figure 8A Plot to show the degree of baseline ejection fraction in all groups two weeks after myocardial infarction but prior to nephrectomy. Figure 8B Plot to show the degree of ejection fraction in all groups one week after nephrectomy, one week after treatment. Figure 8C Plot to show the degree of ejection fraction in all groups two weeks after nephrectomy, two weeks after treatment. Figure 8D Plot to show the degree of ejection fraction in all groups four weeks after nephrectomy, four weeks after treatment. Results are expressed as mean + / - SEM and indicate that anti-IL-6 therapy has therapeutic efficacy in a model of cardiorenal syndrome equivalent to standard of care therapy as measured by changes in cardiac ejection fraction.

[0062] Figure 9 A plot is depicted showing the degree of ejection fraction in all groups two weeks after myocardial infarction but prior to nephrectomy. Figure 7Myocardial contractility in rats treated with anti-IL-6 antibody ("IL-6 ab"), standard of care (perindopril or "Peri"), compared to control ("isotype") treated group, in the cardiorenal syndrome model described in detail in Example 4. Myocardial contractility was assessed at the end of the study by measuring dP / dt max (mmHb / msec), which is a measure of pressure within the heart. Measurements for all groups are shown four weeks after nephrectomy, after 4 weeks of treatment. Results are expressed as mean + / - SEM, and show that anti-IL-6 therapy has a therapeutic effect equivalent to standard of care therapy, as shown by the increased myocardial contractility in the group of rodents treated with anti-IL-6.

[0063] Figures 10A-10C Anti-IL-6 therapy has an anti-cardiorenal syndrome effect equivalent to standard of care therapy, as measured by the degree of fibrosis in heart tissue from groups of rodents treated with anti-IL-6 ("IL-6 Ab"), standard of care (perindopril or "Peri"), and control ("IgG"). Figure 10A Micrographs of histological sections of heart tissue stained with picrosirius-red. Two regions of tissue were analyzed: the "normal" region and the "fibrotic border" region. The "normal" region is indicated by the demarcated section of the tissue section. The inset in the micrograph shows a magnified view of the "normal" region, showing that a small portion of the "normal" region has fibrotic tissue. The "fibrotic border" region is the region of tissue in the "normal" region that is around the fibrotic tissue. Figure 10B Plot showing the percentage area of the "normal" region that is indicated as fibrotic tissue (i.e. stained / dark region) in tissue samples from all groups. Figure 10C Plot showing the percentage area of the "fibrotic border" region that is indicated as fibrotic tissue in tissue samples from all groups. Results are expressed as mean + / - SEM. Details are provided in Example 4.

[0064] Figure 11A and 11B Data from an in vivo model in which myocardial infarction was induced in mice that are genetically similar to humans who have TMPRSS6 The major allele of rs855791 was induced in mice that are genetically similar to humans who have Figure 11A Treatment with anti-IL-6 provided a statistically significant improvement in ejection fraction. Figure 11B Treatment with anti-IL-6 provided a statistically significant improvement in contractility, measured as left ventricular fractional shortening of the heart. The data show that anti-IL-6 therapy given immediately after myocardial infarction improves the contractility of the heart in a model that mimics humans who have TMPRSS6Left ventricular function was restored in rodents of human patients with the rs855791 major allele. Details are provided in Example 5.

[0065] For illustrative purposes only, the accompanying drawings depict various embodiments of the invention. Those skilled in the art will readily recognize from the following discussion that alternative embodiments of the structures and methods described herein can be employed without departing from the principles of the invention as described herein. 5. Detailed Implementation 5.1 Overview of Experimental Results The peptide hormone hyapazidine plays a major role in systemic iron homeostasis. Hentze et al., Cell 142:24-38 (2010). It is known that hepatosil expression is affected by... TMPRSS6 The gene's product, interstitial protease-2, has an effect; this interstitial protease-2 is a type II transmembrane serine protease. It has been shown... TMPRSS6 Common variants of the gene are associated with iron status, according to Benyamin et al. Nature Genetics 41(11):1173-1175 (2009), which showed that rs855791 SNP (2321G→A; A736V) was associated with naturally occurring variants in terms of heparidine expression and blood heme levels. Heparidine expression is also involved in human iron disorders (Pietrangelo, J. Hepatology 54:173-181 (2011) and anemia of chronic disease (ACD) (also known as inflammatory anemia (AI)). ACD is prevalent in patients with chronic infections, autoimmune diseases, cancer, and chronic kidney disease (CKD). Sun et al., Am. J. Hematol . 87(4):392-400 (2012).

[0067] To determine TMPRSS6 Whether the genotype at the rs855791 SNP predicts the degree of anemia in end-stage renal disease was investigated by combining newly identified SNP genotyping with data collected from previous clinical studies in patients with chronic kidney disease. Since hepatocillin expression is also regulated by IL-6, Casanovas et al. PLOS Computational Biol. 10(1):e1003421(2014), further analysis of data to determine whether serum IL-6 levels can predict the degree of anemia in end-stage renal disease.

[0068] As described in Example 1 and as Figure 1 As shown in the figure, in having TMPRSS6In patients with at least one copy of the major allele at the rs855791 SNP, the degree of basal anemia—measured as a clinically titrated dose of EPO—was correlated only with IL-6 levels. In these patients, higher serum IL-6 levels were associated with higher required doses of EPO. Figure 1 B). Conversely, the degree of anemia in patients with two copies of the minor allele was not correlated with serum IL-6 levels (B). Figure 1 A).

[0069] Similarly, in having TMPRSS6 In patients with at least one copy of the major allele at SNP rs855791, overall survival was associated with IL-6 levels only. TMPRSS6 In individuals with at least one copy of the rs855791 major allele, survival was inversely correlated with serum IL-6 levels, with patients at the highest IL-6 levels having statistically significantly worse survival rates than those at the lowest IL-6 levels. Figure 2B Conversely, overall survival in patients homozygous for the minor allele at rs855791 was not affected by IL-6 levels. Figure 2A ).

[0070] Not intending to be bound by theory, but having TMPRSS6 In patients with at least one copy of the major allele, increased serum IL-6 can promote increased hepatocelide expression, thereby increasing anemia. The increased risk of death is a consequence of dysregulation of iron metabolism, resulting anemia, and / or increased doses of erythropoiesis-stimulating agents (such as EPO, administered for treatment). These associations increase the likelihood that reduced IL-6 levels or IL-6 signaling can reduce anemia, decrease the required EPO dose, and increase survival in patients with chronic kidney disease, but only in those with... TMPRSS6 It has the greatest effect in patients with at least one copy of the major allele of rs855791, and in those with elevated serum IL-6 levels.

[0071] To determine in patients with acute rather than chronic diseases TMPRSS6 Whether the rs855791 genotype affects IL-6 sensitivity, in Example 2 we combined newly determined SNP genotyping to analyze data collected in previous clinical studies of patients hospitalized for acute coronary syndrome.

[0072] against TMPRSS6 Death in individuals homozygous for the minor allele (A) of the rs855791 SNP is not associated with IL-6 variants. Figure 4A). However, in response to elevated IL-6 levels in individuals following myocardial infarction, one or two copies of the major allele (G) confer higher mortality from various causes ( Figure 4 B). Therefore, TMPRSS6 Moderating the risk of IL-6-mediated death after myocardial infarction.

[0073] Also assess TMPRSS6 The effect of genotype on the risk of IL-6-mediated heart failure. Heart failure in individuals homozygous for the minor allele (A) was not associated with IL-6 variants. Figure 5 A). However, in response to elevated IL-6 levels in individuals following myocardial infarction, TMPRSS6 The G allele confers a higher rate of heart failure ( Figure 5 B). Therefore, TMPRSS6 Moderating the risk of IL-6-mediated heart failure after myocardial infarction.

[0074] Data from Example 2 shows TMPRSS6 The correlation between genotype, IL-6 levels, and adverse clinical outcomes is not limited to patients with chronic kidney disease. This is not intended to be a theoretical exercise, but rather to be applied in contexts where... TMPRSS6 In patients with at least one copy of the major allele, increased serum IL-6 promotes increased hepatocillin expression, followed by increased iron chelation in cardiomyocytes, and subsequently iron-mediated cytotoxicity. These associations increase the likelihood that reduced IL-6 levels or IL-6 signaling may reduce heart failure and death in patients with acute coronary syndrome, but only in patients with TMPRSS6 It has the greatest effect in patients with at least one copy of the major allele of rs855791, and in those with elevated serum IL-6 levels.

[0075] Although the strong correlations observed in Examples 1 and 2 indicate that in the presence of TMPRSS6 In patients with at least one copy of the rs855791 major allele, elevated IL-6 levels, and anemia or hepazidine-mediated cytotoxicity, decreased IL-6-mediated signaling should provide clinical benefit, but the observed correlation does not prove causation. Therefore, in Example 3, human induced pluripotent stem (iPS) cardiomyocytes were engineered to express only [the rs855791 major allele]. TMPRSS6 The major or minor allele of rs855791 was tested in vivo.

[0076] Hypaxidine expression is regulated through the BMP6 / SMAD and IL-6 / STAT signaling pathways, with both BMP and IL-6 acting via their respective receptors to promote increased hypaxidine expression. Casanovas et al. PLOS Comp. Biol.10(1):el003421 (2014). Primary allele and secondary allele iPS cardiomyocytes were treated with agonists of the signaling pathways - recombinant BMP2 and IL-6 - or agonists of BMP2 alone to model a clinical intervention that reduces IL-6 levels (or signaling). Control iPS cells were treated with no agonists. Cell death rates were measured under normal oxygen tension (normoxia) and also under conditions that mimic hypoxia followed by mimicked reoxygenation (reperfusion).

[0077] Figure 6A Results are shown when cells were treated under normal oxygen levels. iPS cardiomyocytes expressing only the TMPRSS6 rs855791 secondary allele ("736V secondary allele") were not significantly affected by the ablation of IL-6 signaling ("n.s."); cell death rates, measured as percentage of cells that were propidium iodide positive, were not significantly reduced when cells were treated with BMP2 compared to treatment with BMP2 + IL-6. In contrast, iPS cardiomyocytes expressing the TMPRSS6 rs855791 primary allele showed statistically significantly lower cell death when IL-6 signaling was ablated.

[0078] Figure 6B Results are shown when cells were subjected to hypoxia followed by reoxygenation. Hypoxia / reoxygenation was toxic to iPS cardiomyocytes compared to normoxic conditions, with about 40 percent of primary and secondary allele control cells killed compared to about 20% control cells killed under normoxic conditions (compared to Figure 6A In contrast to this increased background toxicity, secondary allele iPS cardiomyocytes were not significantly affected by the ablation of IL-6 signaling: cell death rates were not significantly reduced when cells were treated with BMP2 alone compared to treatment with BMP2 + IL-6. In contrast, iPS cardiomyocytes expressing the TMPRSS6 rs855791 primary allele showed statistically significantly lower cell death when IL-6 signaling was ablated.

[0079] These data reinforce the inference drawn from the post hoc analysis of the clinical trial data in Example 1 and Example 2: reduction of IL-6 signaling effectively reduces IL-6 mediated toxicity in cardiomyocytes expressing the TMPRSS6 rs855791 primary allele, but not in cardiomyocytes expressing only the secondary allele. Without intending to be bound by theory, IL-6 that promotes increased toxicity in primary allele iPS cardiomyocytes can result from IL-6 mediated increases in hepcidin expression, followed by increased iron chelation in the cells, followed by iron mediated cellular toxicity.

[0080] Patients with chronic kidney disease, such as those enrolled in the MIMICK study analyzed in Example 1, often suffer from impaired cardiac function, which is a major contributor to overall mortality. This secondary cardiac injury after initial chronic kidney disease is termed cardiac-renal syndrome type 4 (CRS4). To directly test whether anti-IL-6 therapy is effective as a treatment for CRS4 in humans who are genotypically similar to those for whom TMPRSS6 rs855791 major allele, as suggested by the data in Examples 1 and 3, we used a rat model of CRS4 in humans who are genotypically similar to those for whom TMPRSS6 rs855791 major allele homozygous humans.

[0081] After 4 weeks of treatment, the treatment groups - the group treated with anti-IL-6 antibody and the group treated with standard-of-care ACE inhibitor therapy, perindopril - showed statistically significant increases in the degree of ejection fraction compared to the isotype control group Figure 8D (p < 0.001). Similar degrees of ejection fraction in the anti-IL-6 and standard-of-care groups measured after 4 weeks of treatment showed that anti-IL-6 therapy had equivalent efficacy to ACE inhibitors. Figure 9 showed that anti-IL-6 therapy also had equivalent effectiveness to ACE inhibitors in preserving myocardial contractility. Figures 10A-10C showed that anti-IL-6 therapy was also effective in reducing cardiac fibrosis.

[0082] These data show that treatment with an anti-IL-6 agent effectively reduces cardiac injury and restores function in an in vivo model of cardio-renal syndrome in animals that are genotypically similar to those for whom TMPRSS6 rs855791 major allele homozygous humans.

[0083] Similarly, the data in Examples 2 and 3 show that reduced IL-6 levels or IL-6 signaling can reduce cardiac failure and death in patients with acute coronary syndrome, but only in those patients who have TMPRSS6 at least one copy of the rs855791 major allele, and have the greatest effect in those patients who have elevated serum IL-6 levels.

[0084] A study was conducted to determine the effect of anti-IL-6 therapy in mice that are genotypically similar to humans for whom TMPRSS6 rs855791 major allele homozygous humans after acute myocardial infarction.

[0085] Figure 11A and 11B showed data from an in vivo model in which treatment with an anti-IL-6 agent was effective in reducing cardiac injury and restoring function in animals that are genotypically similar to those for whom TMPRSS6rs855791 major allele homozygous humans. The control group did not receive therapy. The experimental group was treated with an anti-murine IL-6 antibody. Figure 11A Treatment with anti-IL-6 was shown to provide a statistically significant improvement in ejection fraction compared to control. Figure 11B Treatment with anti-IL-6 was shown to provide a statistically significant improvement in contractility, measured as cardiac fractional shortening, compared to control. These data suggest that anti-IL-6 therapy given immediately after myocardial infarction improves the functional recovery of the left ventricle in humans genotypically similar to those with TMPRSS6 rs855791 major allele homozygous humans. The control group did not receive therapy. The experimental group was treated with an anti-murine IL-6 antibody.

[0086] In summary, the experimental data suggest that a therapeutic intervention to reduce IL-6 signaling will provide clinical benefit in patients with a hepcidin-mediated disorder, such as anemia or hepcidin-mediated cytotoxicity, but only in those patients with TMPRSS6 rs855791 major allele homozygous humans. The control group did not receive therapy. The experimental group was treated with an anti-murine IL-6 antibody.

[0087] Thus, as described further below, in a first aspect, a method of treating a hepcidin-mediated disorder is provided. The method comprises administering to a patient having a hepcidin-mediated disorder a therapeutically effective amount of an IL-6 antagonist, the patient having been determined to have TMPRSS6 at least one copy of the major allele at the rs855791 SNP. In a second aspect, a method for improving treatment of a hepcidin-mediated disorder is provided, the method comprising discontinuing administration of an IL-6 antagonist to a patient having a hepcidin-mediated disorder, wherein the patient has been determined to have TMPRSS6 rs855791 minor allele homozygous. The treatment is improved by discontinuing a therapy that is less than optimal, thereby reducing side effects and reducing costs without loss of therapeutic efficacy. In another aspect, a method for treating an IL-6-mediated inflammatory disorder in a patient without chronic inflammatory anemia is provided, the method comprising administering to the patient a therapeutically effective amount of an IL-6 antagonist, the patient having an IL-6-mediated inflammatory disorder, not having anemia, and having been determined to have TMPRSS6 at least one copy of the major allele at the rs855791 SNP.

[0088] 5.2 Definitions Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art to which this application belongs. As used herein, the following terms have the meanings ascribed to them below.

[0089] "Hypacilidine" refers to a polypeptide whose amino acid sequence shares at least approximately 85% or more 85% identity with the amino acid sequence provided under NCBI accession number NP_066998 ("Hypacilidine proprotein") or its bioactive fragment. Exemplary hypacilidine bioactivities include binding to and reducing the content of transferrin in iron export channels, inhibiting iron transport, inhibiting intestinal iron absorption, and inhibiting the release of iron from macrophages and the liver. The amino acid sequence of an exemplary hypacilidine proprotein is provided below: Referring to the sequence above, hypacetin exists in various forms, including preprohormone (amino acids 25-84), prohormone (amino acids 25-84), and mature forms called hypacetin-25 (amino acids 60-84), hypacetin-22 (amino acids 63-84), and hypacetin-20 (amino acids 65-84).

[0090] "Hipazidine-mediated disease" refers to any disease in which hepazidine expresses a cause that contributes to the disease or any of its symptoms. The contribution of hepazidine to the cause is known, suspected, or inferred from an observation that is relative to the response to [other causes]. TMPRSS6 Patients with the disease in whom the minor allele of the rs855791 SNP is homozygous, and administration of IL-6 antagonists is recommended in patients with the following conditions: TMPRSS6 At least one copy of the major allele of the rs855791 SNP provides greater therapeutic benefit in patients with the disease. Heptacil-mediated disease is further described below in section 5.4.1.

[0091] "Transmembrane protease serine 6 ( TMPRSS6 "Polypeptide" refers to a polypeptide or fragment thereof that has at least about 85% or more amino acid identity with the amino acid sequence provided by NCBI accession number NP_001275929 and has serine protease activity. TMPRSS6 The polypeptide, also known as interstitial protease-2 (MT2), breaks down hepcidin-regulated proteins and inhibits bone morphogenetic protein signal transduction. An example with alanine (736A) at position 736 is provided below. TMPRSS6 amino acid sequence: The following provides an example of having valine (736V) at position 736. TMPRSS6 amino acid sequence:

[0092] “ TMPRSS6 "Nucleic acid molecule" refers to the coding TMPRSS6 Polynucleotides of polypeptides (interstitial protease-2; MT2). ​​Exemplary TMPRSS6 The nucleic acid molecule sequence is provided as NCBI Accession Number NM_001289000. Provided below is the sequence of the nucleic acid having a G at nucleotide position 2321 ("G allele"; "major allele") TMPRSS6 Nucleic acid sequence:

[0093] Provided below is the sequence of the nucleic acid having an A at nucleotide position 2321 TMPRSS6 Nucleic acid sequence:

[0094] "Variant" means a polynucleotide or polypeptide sequence that differs from a reference sequence due to one or more nucleotides or one or more amino acids. Exemplary variants are TMPRSS6 Variants are TMPRSS6 (A736V), caused by SNP rs855791 (G→A).

[0095] "Single nucleotide polymorphism" or "SNP" means a naturally occurring variant of a DNA sequence in which a single nucleotide in the genome differs between members of a biological species or between paired chromosomes in an individual. SNPs can be used as genetic markers for variant alleles. In one embodiment, TMPRSS6 The SNP is rs855791.

[0096] "rs855791" means a single nucleotide polymorphism (SNP) in the human TMPRSS6 gene, 2321G→A, that causes a substitution of alanine to valine (A736V) in the catalytic region of the metalloproteinase-2 (MT2) encoded by the TMPRSS6 gene. The allele with the highest frequency in the human population (major allele) is 2321G, encoding 736A. The allele with the lowest frequency in the human population (minor allele) is 2321A, encoding 736V.

[0097] "Heterozygous" means that a chromosomal locus has two different alleles. In one embodiment of the methods described herein, heterozygous refers to the genotype in which one allele has a nucleic acid sequence encoding a polypeptide having an alanine at amino acid position 736 and the other allele has a nucleic acid sequence encoding a polypeptide having a valine at amino acid position 736. TMPRSS6 polypeptide TMPRSS6 nucleic acid sequence (e.g., at TMPRSS6having G or C at nucleotide position 2321 of the nucleic acid molecule) (rs855791 major allele), and the other allele has a nucleotide that encodes a valine at amino acid position 736 TMPRSS6 Variations of polypeptides TMPRSS6 Nucleic acid sequences (e.g., at TMPRSS6 having A or T at nucleotide position 2321 of the nucleic acid molecule) (rs855791 minor allele).

[0098] "Heterozygous" means that the chromosomal locus has two different alleles. In certain embodiments of the methods described herein, heterozygous refers to the genotype in which one allele has a nucleotide that encodes a valine at amino acid position 736 and the other allele has a nucleotide that encodes a proline at amino acid position 736. TMPRSS6 Variations of polypeptides TMPRSS6 Nucleic acid sequences (e.g., at TMPRSS6 having G or C at nucleotide position 2321 of the nucleic acid molecule) (rs855791 homozygous major allele). In some embodiments, homozygous refers to the genotype in which both alleles have a nucleotide that encodes a valine at amino acid position 736. TMPRSS6 Variations of polypeptides TMPRSS6 Nucleic acid sequences (e.g., at TMPRSS6 having A or T at nucleotide position 2321 of the nucleic acid molecule) (rs855791 homozygous minor allele).

[0099] "determining that a patient has TMPRSS6 "at least one copy of the rs855791 major allele" includes, but is not limited to, conducting an analysis to determine that the patient has at least one copy of the TMPRSS6 rs855791 major allele; ordering an analysis to determine that the patient has at least one copy of the TMPRSS6 rs855791 major allele; specifying an analysis to determine that the patient has at least one copy of the TMPRSS6 rs855791 major allele; otherwise directing or controlling an analysis conducted to determine that the patient has at least one copy of the TMPRSS6 rs855791 major allele; and reviewing TMRSS6 genotypic analysis data or protein or nucleic acid sequence data to determine that the patient has at least one copy of the TMPRSS6 rs855791 major allele.

[0100] "Interleukin 6 (IL-6)" or "IL-6 polypeptide" means a polypeptide or fragment thereof having at least about 85% or greater than 85% amino acid identity to the amino acid sequence provided at NCBI Accession No. NP_000591 and having an IL-6 biological activity. IL-6 is a pleiotropic cytokine with multiple biological functions. Exemplary IL-6 biological activities include immune stimulation and proinflammatory activity. An exemplary IL-6 amino acid sequence is provided below:

[0101] “I L-6 nucleic acid” means a polynucleotide encoding an interleukin 6 (IL-6) polypeptide. An exemplary interleukin 6 (IL-6) nucleic acid sequence is provided as NCBI Accession No. NM_000600. An exemplary sequence of NCBI Accession No. NM_000600 is provided below.

[0102] “I L-6 receptor (IL-6R) complex” means a protein complex comprising an IL-6 receptor subunit alpha (IL-6Ra) and an interleukin 6 signal transducer glycoprotein 130, also known as interleukin 6 receptor subunit beta (IL-6Rβ).

[0103] “I L-6 receptor subunit alpha (IL-6Ra) polypeptide” means a polypeptide having at least about 85% or greater than 85% amino acid identity to the amino acid sequence provided as NCBI Accession No. NP_000556 or NP_852004 and having IL-6 receptor biological activity or a fragment thereof. Exemplary IL-6Ra biological activities include binding to IL-6, binding to glycoprotein 130 (gpl30), and modulating cell growth and differentiation. An exemplary IL-6R sequence is provided below:

[0104] “I L-6 receptor subunit beta (IL-6Rβ) polypeptide” means a polypeptide having at least about 85% or greater than 85% amino acid identity to the amino acid sequence provided as NCBI Accession No. NP_002175, NP_786943, or NP_001177910 and having IL-6 receptor biological activity or a fragment thereof. Exemplary IL-6Rβ biological activities include binding to IL-6Ra, IL-6 receptor signaling activity, and modulating cell growth, differentiation, hepcidin expression, etc. An exemplary IL-6Rβ sequence is provided below:

[0105] An "IL-6 antagonist" means an agent that is capable of reducing the biological activity of IL-6. IL-6 antagonists include agents that reduce the amount of IL-6 polypeptide in serum, agents that reduce the expression of IL-6 polypeptide or nucleic acid; agents that reduce the ability of IL-6 to bind to IL-6R; agents that reduce the expression of IL-6R; and agents that reduce signal transduction through the IL-6R receptor when bound by IL-6. In preferred embodiments, an IL-6 antagonist reduces IL-6 biological activity by at least about 10%, 20%, 30%, 50%, 70%, 80%, 90%, 95%, or even 100%. As further described in Section 5.9 below, IL-6 antagonists include IL-6 binding polypeptides, such as anti-IL-6 antibodies and antigen-binding fragments or derivatives thereof; IL-6R binding polypeptides, such as anti-IL-6R antibodies and antigen-binding fragments or derivatives thereof; and synthetic chemical molecules, such as JAK1 and JAK3 inhibitors.

[0106] An "IL-6 antibody" or "anti-IL-6 antibody" means an antibody that specifically binds IL-6. Anti-IL-6 antibodies include monoclonal and polyclonal antibodies, and antigen-binding fragments or derivatives thereof, that have specificity for IL-6. IL-6 antibodies are described in more detail in Section 5.9.1 below.

[0107] An "IL-6-mediated inflammatory disorder" means any disorder for which IL-6 is known or suspected to contribute to the etiology of the disease or any of its symptoms.

[0108] "Erythropoietin (EPO)" means a polypeptide or fragment thereof having at least about 85% or greater than 85% amino acid identity to the amino acid sequence provided at NCBI Accession No. NP_000790 and having an EPO biological activity. Exemplary EPO biological activities include binding to the erythropoietin receptor and proliferation and eventual differentiation of erythroid precursor cells and / or increasing erythropoiesis (red blood cell production). An exemplary EPO amino acid sequence is provided below:

[0109] "Erythropoiesis stimulating agent (ESA)" means an agent that stimulates erythropoiesis. ESAs include, but are not limited to, EPO; darbepoetin (Aranesp); epoetin beta (NeoRecormon); epoetin delta (Dynepo); epoetin omega (Epomax); epoetin zeta.

[0110] "Erythropoiesis-stimulating agent" means an agent that increases the growth or proliferation of red blood cells or progenitors thereof (e.g., hematopoietic stem cells) and / or decreases cell death of red blood cells or progenitors thereof. In various embodiments, erythropoiesis-stimulating agents include erythropoietin, HIF stabilizers, and iron supplementation.

[0111] "C-reactive protein (CRP) polypeptide" means a polypeptide or fragment thereof having at least about 85% or greater than 85% amino acid identity to the amino acid sequence provided as NCBI Accession No. NP_000558 and having complement-activating activity. CRP levels increase in response to inflammation. An exemplary CRP sequence is provided below:

[0112] "Agent" means any compound or composition suitable for administration in therapy, and expressly includes chemical compounds; proteins, including antibodies or antigen-binding fragments thereof; peptides; and nucleic acid molecules.

[0113] "Individual" means a human or non-human mammalian (including, but not limited to, bovine, equine, canine, ovine, feline, and rodent, including murine and Rattus species) individual. A "patient" is a human individual.

[0114] As used herein, the term "treatment" and its conjugations, refers to reducing or ameliorating a condition and / or its associated signs or symptoms, or slowing or stopping its progression. It is to be appreciated that, while not precluded, treatment of a condition or disease does not necessarily require complete eradication of the condition, disease, or symptoms associated therewith.

[0115] "Pre-treatment" means prior to the first administration of an IL-6 antagonist according to the methods described herein. Pre-treatment does not preclude and often includes prior administration of a treatment other than an IL-6 antagonist.

[0116] In the present invention, "comprise," "comprising," "have," "having," "include," "including," and "contain," "containing," or the like, are inclusive, and permit the presence of other components, in addition to the recited components.

[0117] "Biological sample" means any tissue, cell, bodily fluid, or other material derived from an organism (e.g., a human individual). In certain embodiments, the biological sample is serum or blood.

[0118] "Angiotensin-converting enzyme (ACE) inhibitor" means an agent that inhibits the biological function of angiotensin-converting enzyme to convert angiotensin I to angiotensin II. ACE inhibitors include, but are not limited to, quinapril, perindopril, ramipril, captopril, benazepril, trandolapril, fosinopril, lisinopril, moexipril, and enalapril. In various embodiments, the ACE inhibitor is perindopril.

[0119] 5.1 Other Illustrative Practices Unless otherwise specified, antibody constant region residue numbering is according to the EU index in Kabat.

[0120] Ranges provided herein are understood to be shorthand for all values within the range, including the recited endpoints. For example, a range of 1 to 50 is understood to include any value, combination, or sub-range between the lower and upper bound of the recited range, including the end points of 1 and 50. A range of 1 to 50 is understood to include, for example, any one of the following: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50.

[0121] The term "or" as used herein, unless otherwise indicated, is understood to be inclusive. The terms "a" and "the" as used herein, unless otherwise indicated, are understood to be singular or plural.

[0122] The term "about" as used herein, unless otherwise indicated, is understood to mean within normal tolerances in the art, for example within 2 standard deviations of the mean. About can be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from context, all numerical values provided herein are modified by the term about.

[0123] 5.2 Methods of treating hepcidin-mediated disorders In a first aspect, methods of treating a hepcidin-mediated disorder are provided.

[0124] The method comprises administering to an individual (typically a human patient) having a hepcidin-mediated disorder a therapeutically effective amount of an IL-6 antagonist, wherein the individual has been determined to have TMPRSS6 at least one copy of the major allele of rs855791. In a first series of embodiments, the individual has been previously determined to have TMPRSS6 at least one copy of the major allele of rs855791. In another series of embodiments, the method further comprises the earlier step of determining that the individual has TMPRSS6 at least one copy of the major allele of rs855791. Typically, the method positively excludes treatment of an individual who is homozygous for the minor allele of rs855791. Typically, the patient has an elevated pre-treatment serum IL-6 level. TMPRSS6

[0125] 5.2.1 Hepcidin-mediated disorders 5.2.1.1 Chronic disease / Chronic inflammatory anemia In various embodiments, the hepcidin-mediated disorder treated by the methods described herein is chronic disease anemia, also known as chronic inflammatory anemia.

[0126] In various embodiments, the patient is male and has a pre-treatment hemoglobin (Hb) level of less than 14 g / dl. In some embodiments, the pre-treatment Hb level of the male patient is 13.0-13.9 g / dl, 12.0-12.9 g / dl, 11.0-11.9 g / dl, 10.0-10.9 g / dl, or less than 10 g / dl. In various embodiments, the patient is female and has a pre-treatment Hb level of less than 12 g / dl. In some embodiments, the pre-treatment Hb level of the female patient is 11.0-11.9 g / dl, 10.0-10.9 g / dl, 9.0-9.9 g / dl, 8.0-8.9 g / dl, or less than 8 g / dl. In some of these embodiments, the patient has been previously treated with an ESA. In some embodiments, the patient has been treated with iron supplementation. In some embodiments, the patient has been treated with a transfusion of blood or red blood cell concentrate.

[0127] ​In various embodiments, the patient is male and has a hematocrit of less than 40% prior to treatment. In some embodiments, the male patient has a hematocrit of less than 39%, less than 38%, less than 37%, less than 36%, or less than 35% prior to treatment. In certain embodiments, the male patient has a hematocrit of 39%, 38%, 37%, 36%, 35%, 34%, 33%, 32%, 31%, or 30% prior to treatment. In various embodiments, the patient is female and has a hematocrit of less than 36% prior to treatment. In some embodiments, the female patient has a hematocrit of less than 35%, 34%, 33%, 32%, 31%, 30%, 29%, 28%, 27%, or 26% prior to treatment. In certain embodiments, the female patient has a hematocrit of 35%, 34%, 33%, 32%, 31%, 30%, 29%, 28%, 27%, or 26% prior to treatment. In some of these embodiments, the patient has been treated with an ESA. In some embodiments, the patient has been treated with iron supplementation. In some embodiments, the patient has been treated with a transfusion of whole blood or red blood cell concentrate.

[0128] In some embodiments, the patient has been treated with an ESA and has a normal pre-treatment Hb level and / or a normal pre-treatment hematocrit. In certain embodiments, the patient is male and has a hemoglobin (Hb) level of at least 14 g / dl prior to treatment and / or a hematocrit of at least 40% prior to treatment. In certain embodiments, the patient is female and has a Hb level of at least 12 g / dl prior to treatment and / or a hematocrit of at least 36%. In specific embodiments, the ESA is EPO. In specific embodiments, the ESA is darbepoetin alfa.

[0129] In some embodiments, the patient has been treated with iron supplementation and has a normal pre-treatment Hb level and / or a normal pre-treatment hematocrit. In certain embodiments, the patient is male and has a hemoglobin (Hb) level of at least 14 g / dl prior to treatment and / or a hematocrit of at least 40% prior to treatment. In certain embodiments, the patient is female and has a Hb level of at least 12 g / dl prior to treatment and / or a hematocrit of at least 36%.

[0130] In some embodiments, the patient has been treated with a transfusion of whole blood or red blood cell concentrate and has a normal pre-treatment Hb level and / or a normal pre-treatment hematocrit. In certain embodiments, the patient is male and has a hemoglobin (Hb) level of at least 14 g / dl prior to treatment and / or a hematocrit of at least 40% prior to treatment. In certain embodiments, the patient is female and has a Hb level of at least 12 g / dl prior to treatment and / or a hematocrit of at least 36%.

[0131] In some embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to increase the patient's Hb level above the pre-treatment level. In some embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to increase the patient's hematocrit above the pre-treatment level. In some embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to increase both the Hb level and the hematocrit above the pre-treatment level.

[0132] In some embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to decrease the patient's ESA dose below the pre-treatment level without decreasing the patient's Hb level. In some embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to decrease the patient's ESA dose below the pre-treatment level without decreasing the patient's hematocrit. In some embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to decrease the patient's ESA dose without decreasing the patient's Hb level and hematocrit.

[0133] In some embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to decrease the patient's ESA dose by at least 10% compared to the pre-treatment ESA dose. In certain embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to decrease the patient's ESA dose by at least 20%, 30%, 40%, or 50% compared to the pre-treatment ESA dose. In particular embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to decrease the patient's ESA dose by at least 60% or even at least 75% compared to the pre-treatment ESA dose.

[0134] In some embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to reverse functional iron deficiency.

[0135] 5.2.1.1.1 Chronic Kidney Disease In various embodiments, the chronic disease is chronic kidney disease (CKD).

[0136] In some embodiments, the patient has KDOQI Stage 1 chronic kidney disease. In certain embodiments, the patient has KDOQI Stage 2 chronic kidney disease, KDOQI Stage 3 chronic kidney disease, KDOQI Stage 4 chronic kidney disease, or KDOQI Stage 5 chronic kidney disease.

[0137] In some embodiments, the patient has cardiorenal syndrome (CRS). In certain embodiments, the patient has CRS Type 4.

[0138] In some embodiments, the patient has been treated with dialysis.

[0139] In some embodiments, one dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce cardiovascular (CV) mortality compared to an age- and disease-matched historical cohort.

[0140] 5.2.1.1.2 Chronic inflammatory disease In various embodiments, the chronic disease is a chronic inflammatory disease.

[0141] In some embodiments, the chronic inflammatory disease is rheumatoid arthritis (RA).

[0142] In particular embodiments, the patient has a pre-treatment DAS28 score greater than 5.1. In some embodiments, the patient has a pre-treatment DAS28 score of 3.2 to 5.1. In some embodiments, the patient has a pre-treatment DAS28 score less than 2.6. In various embodiments, the patient has pre-treatment RA that is highly active. In some embodiments, the patient has pre-treatment RA that is moderately active.

[0143] In certain embodiments, the patient has been treated with methotrexate. In some embodiments, the methotrexate is discontinued when treatment with the IL-6 antagonist is initiated. In some embodiments, treatment with methotrexate is continued when treatment with the IL-6 antagonist is initiated.

[0144] In certain embodiments, the patient has been treated with an anti-TNFa agent. In particular embodiments, the anti-TNFa agent is selected from the group consisting of etanercept, adalimumab, infliximab, certolizumab pegol, and golimumab. In particular embodiments, the anti-TNFa agent is discontinued when treatment with the IL-6 antagonist is initiated.

[0145] In certain embodiments, the patient has been treated with an IL-1 receptor antagonist. In particular embodiments, the IL-1 receptor antagonist is anakinra. In particular embodiments, the IL-1 receptor antagonist is discontinued when treatment with the IL-6 antagonist is initiated.

[0146] In certain embodiments, the patient has been treated with abatacept. In particular embodiments, the abatacept is discontinued when treatment with the IL-6 antagonist is initiated.

[0147] In certain embodiments, the patient has been treated with an IL-6 antagonist, and the method further comprises continuing treatment with the IL-6 antagonist to the patient newly determined to have TMPRSS6Those patients having at least one copy of the major allele of rs855791 are administered an IL-6 antagonist alone. In specific embodiments, the IL-6 antagonist is tocilizumab. In specific embodiments, the IL-6 antagonist is tofacitinib.

[0148] In various embodiments, the chronic inflammatory disease is selected from the group consisting of juvenile idiopathic arthritis, ankylosing spondylitis, psoriasis, psoriatic arthritis, inflammatory bowel disease, Crohn's disease, and ulcerative colitis.

[0149] 5.2.1.1.3 Cancer In various embodiments, the chronic disease is cancer.

[0150] In some embodiments, the cancer is selected from the group consisting of solid tumors, small cell lung cancer, non-small cell lung cancer, hematological cancer, multiple myeloma, leukemia, chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), lymphoma, and Hodgkin's lymphoma.

[0151] 5.2.1.1.4 Chronic Infection In various embodiments, the chronic disease is a chronic infection.

[0152] 5.2.1.1.5 Congestive Heart Failure In various embodiments, the chronic disease is congestive heart failure (CHF).

[0153] 5.2.1.2 Iron Refractory Iron Deficiency Anemia (IRIDA) In various embodiments, the hepcidin-mediated disorder is iron refractory iron deficiency anemia (IRIDA).

[0154] 5.2.1.3 Anemia Associated with Hepcidin-Producing Hepatocellular Adenomas In various embodiments, the hepcidin-mediated disorder is anemia associated with hepcidin-producing hepatocellular adenomas.

[0155] 5.2.1.4 Acute Coronary Syndrome The data presented in Examples 2, 3, and 5 below demonstrate that an IL-6 antagonist is effective in reducing the risk of heart failure and death, and in increasing cardiac function and reducing fibrosis, following acute myocardial infarction. Accordingly, in various embodiments, the hepcidin-mediated disorder is acute coronary syndrome.

[0156] In certain embodiments, the patient has suffered a myocardial infarction within 60 days prior to the first administration of the IL-6 antagonist. In particular embodiments, the patient has suffered a myocardial infarction within 30 days, 14 days, 7 days, 48 hours, or 24 hours prior to the first administration of the IL-6 antagonist.

[0157] In some embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to improve myocardial contractility relative to the degree prior to treatment. In certain embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to increase cardiac ejection fraction relative to the degree prior to treatment. In certain embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce cardiac fibrosis relative to the degree prior to treatment.

[0158] 5.2.1.5 Castleman's Disease In various embodiments, the hepcidin-mediated disorder is Castleman's Disease.

[0159] 5.3 Methods of improving treatment of hepcidin-mediated disorders In another aspect, methods of improving treatment of a hepcidin-mediated disorder by discontinuing a therapy that is less than optimal, thereby reducing side effects and reducing costs without loss of therapeutic efficacy are provided. The methods comprise discontinuing administration of an IL-6 antagonist to a patient having a hepcidin-mediated disorder, wherein the patient has been determined to be homozygous for the minor allele of TMPRSS6 rs855791. In one series of embodiments, the patient has been previously determined to be homozygous for the minor allele of TMPRSS6 rs855791. In another series of embodiments, the methods further comprise the earlier step of determining that the patient is homozygous for the minor allele of TMPRSS6 rs855791. In typical embodiments, the patient has an elevated pre-treatment serum IL-6 level. In various embodiments, the patient has an elevated pre-treatment serum CRP level.

[0160] In various embodiments, the patient has a hepcidin-mediated disorder selected from those described in Section 5.4.1 above. In certain embodiments, the patient has chronic disease anemia.

[0161] 5.4 Methods of treating IL-6-mediated inflammatory disorders The data presented in Examples 2, 3 and 5 indicate that IL-6 antagonists provide therapeutic benefit in individuals who have elevated pre-treatment IL-6 levels and who have TMPRSS6 at least one copy of the major allele, even in the absence of anemia. Thus, in another aspect, methods are provided to treat IL-6-mediated inflammatory disorders in patients who do not have chronic inflammatory anemia.

[0162] The methods comprise administering to an individual, typically a human patient, having an IL-6-mediated inflammatory disorder, a therapeutically effective amount of an IL-6 antagonist, wherein the patient does not have anemia, and wherein the individual has been determined to haveTMPRSS6 at least one copy of the major allele of rs855791. In a first series of embodiments, the individual has been previously determined to have TMPRSS6 at least one copy of the major allele of rs855791. In another series of embodiments, the method further comprises the earlier step of determining that the individual has TMPRSS6 at least one copy of the major allele of rs855791. Typically, the method positively excludes treatment of individuals who are homozygous for the minor allele of rs855791. Typically, the patient has an elevated pre-treatment serum IL-6 level. TMPRSS6 at least one copy of the major allele of rs855791. Typically, the patient has an elevated pre-treatment serum IL-6 level.

[0163] In some embodiments, the IL-6 mediated disorder is rheumatoid arthritis (RA).

[0164] In particular embodiments, the patient has a pre-treatment DAS28 score greater than 5.1. In some embodiments, the patient has a pre-treatment DAS28 score of 3.2 to 5.1. In some embodiments, the patient has a pre-treatment DAS28 score less than 2.6. In various embodiments, the patient has a pre-treatment RA that is highly active. In some embodiments, the patient has a pre-treatment RA that is moderately active.

[0165] In certain embodiments, the patient has been treated with methotrexate. In some embodiments, the methotrexate is discontinued when treatment with the IL-6 antagonist is initiated. In some embodiments, the methotrexate is continued when treatment with the IL-6 antagonist is initiated.

[0166] In certain embodiments, the patient has been treated with an anti-TNFa agent. In particular embodiments, the anti-TNFa agent is selected from the group consisting of etanercept, adalimumab, infliximab, certolizumab pegol, and golimumab. In particular embodiments, the anti-TNFa agent is discontinued when treatment with the IL-6 antagonist is initiated.

[0167] In certain embodiments, the patient has been treated with an IL-1 receptor antagonist. In particular embodiments, the IL-1 receptor antagonist is anakinra. In particular embodiments, the IL-1 receptor antagonist is discontinued when treatment with the IL-6 antagonist is initiated.

[0168] In certain embodiments, the patient has been treated with abatacept. In particular embodiments, the abatacept is discontinued when treatment with the IL-6 antagonist is initiated.

[0169] In various embodiments, the IL-6 mediated disorder is selected from the group consisting of juvenile idiopathic arthritis, ankylosing spondylitis, psoriasis, psoriatic arthritis, inflammatory bowel disease, Crohn's disease, and ulcerative colitis.

[0170] 5.5 Pre-treatment serum IL-6 and CRP levels In typical embodiments of the methods described herein, the patient has an elevated pre-treatment serum IL-6 level.

[0171] In some embodiments, the patient has a pre-treatment serum IL-6 level greater than 2.5 pg / ml. In various embodiments, the patient has a pre-treatment serum IL-6 level greater than 5 pg / ml, greater than 7.5 pg / ml, greater than 10 pg / ml, greater than 12.5 pg / ml, or greater than 15 pg / ml.

[0172] In some embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce the patient's serum IL-6 level below the pre-treatment level. In certain embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce the patient's serum IL-6 level by at least 10%, 20%, 30%, 40%, or 50% compared to the pre-treatment level.

[0173] In various embodiments, the patient has an elevated pre-treatment C-reactive protein (CRP) level. In some embodiments, the patient has a pre-treatment CRP level greater than 2 mg / ml, 2.5 mg / ml, 3 mg / ml, 3.5 mg / ml, 4 mg / ml, 4.5 mg / ml, or 5 mg / ml. In some embodiments, the patient has a pre-treatment CRP level greater than 7.5 mg / ml, 10 mg / ml, 12.5 mg / ml, or 15 mg / ml.

[0174] In some embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce the patient's CRP level below the pre-treatment level. In certain embodiments, a dose of IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce the patient's CRP level by at least 10%, 20%, 30%, 40%, or 50% compared to the pre-treatment level.

[0175] 5.6 TMPRSS6 rs855791 genotyping The methods described herein comprise administering to an individual who has been determined to have TMPRSS6 at least one copy of the major allele of rs855791 a therapeutically effective amount of an IL-6 antagonist. Preferably, both alleles corresponding to the relevant gene are identified, thus allowing identification and differentiation of patients who are homozygous for TMPRSS6 the major allele of rs855791, who are homozygous for the major and minor TMPRSS6 alleles of rs855791, and who are heterozygous for TMPRSS6homozygous for the minor allele.

[0176] The absence (major allele) or presence (minor allele) of SNP rs855791 (2321G→A) in the gene was determined using standard techniques. TMPRSS6

[0177] Typically, PCR is used to amplify a biological sample obtained from a patient.

[0178] In some embodiments, the absence or presence of polymorphism is detected using real-time PCR (RT-PCR) simultaneously with amplification. In certain embodiments, the RT-PCR analysis employs 5' nuclease (TaqMan® probes), molecular beacons, and / or FRET hybridization probes. Reviewed in Espy et al., Clin. Microbiol. Rev. 2006 Jan; 19(1): 165-256, which is incorporated herein by reference in its entirety. In typical embodiments, a commercially available assay is used. In selected embodiments, the commercially available assay is selected from the group consisting of TaqMan™ SNP Genotyping Assays (ThermoFisher); PCR SNP Genotyping Assays (Qiagen); Novallele Genotyping Assays (Canon); and SNP Type™ Assays (formerly SNPtype) (Fluidigm). Clin. Microbiol. Rev

[0179] In some embodiments, the absence or presence of polymorphism is detected using hybridization with probes specific for SNP rs855791, restriction endonuclease digestion, nucleic acid sequencing, primer extension, microarray or gene chip analysis, mass spectrometry analysis, and / or DNAse protection analysis after amplification. In some embodiments, the allelic variant is read by sequencing. In certain embodiments, Sanger sequencing is used. In certain embodiments, one of various next generation sequencing technologies is used, including, for example, sequencing technologies selected from the group consisting of microarray sequencing, Solexa sequencing (Illumina), Ion Torrent (Life Technologies), SOliD (Applied Biosystems), pyrosequencing, single molecule real time sequencing (Pacific Bio), nanopore sequencing, and tunneling current sequencing.

[0180] 5.7 IL-6 Antagonists IL-6 antagonists for use in the methods described herein are capable of reducing the biological activity of IL-6.

[0181] 5.7.1 Anti-IL-6 Antibodies ​​In various embodiments, the IL-6 antagonist is an anti-IL-6 antibody or antigen binding fragment or derivative thereof.

[0182] In some embodiments, the IL-6 antagonist is a full-length anti-IL-6 monoclonal antibody. In particular embodiments, the full-length monoclonal antibody is an IgG antibody. In certain embodiments, the full-length monoclonal antibody is an IgGl, IgG2, IgG3, or IgG4 antibody. In some embodiments, the IL-6 antagonist is a polyclonal composition comprising a plurality of species of full-length anti-IL-6 antibodies, each of the plurality of species having a unique CDR. In some embodiments, the IL-6 antagonist is an antibody fragment selected from a Fab, Fab', and F(ab')2 fragment. In some embodiments, the IL-6 antagonist is a scFv, disulfide-linked Fv (dsFv), or a single-domain antibody such as a VHH single-domain nanobody derived from a camelid. In some embodiments, the IL-6 antagonist is an immunobinder or fusion comprising an IL-6 antigen binding fragment. In some embodiments, the antibody is bispecific or multispecific, with at least one of the antigen binding moieties having specificity for IL-6.

[0183] In some embodiments, the antibody is fully human. In some embodiments, the antibody is humanized. In some embodiments, the antibody is chimeric and has a non-human V region and a human C region. In some embodiments, the antibody is murine.

[0184] In typical embodiments, the anti-IL-6 antibody binds human IL-6 with a Kd of less than 100 nM. D In some embodiments, the anti-IL-6 antibody binds human IL-6 with a Kd of less than 75 nM, 50 nM, 25 nM, 20 nM, 15 nM, or 10 nM. D In particular embodiments, the anti-IL-6 antibody binds human IL-6 with a Kd of less than 5 nM, 4 nM, 3 nM, or 2 nM. D In selected embodiments, the anti-IL-6 antibody binds human IL-6 with a Kd of less than 1 nM, 750 pM, or 500 pM. D In specific embodiments, the anti-IL-6 antibody binds human IL-6 with a Kd of no more than 500 pM, 400 pM, 300 pM, 200 pM, or 100 pM. D .

[0185] In typical embodiments, the anti-IL-6 antibody neutralizes a biological activity of IL-6. In some embodiments, the neutralizing antibody prevents IL-6 from binding to an IL-6 receptor.

[0186] In a typical implementation, the anti-IL-6 antibody has an elimination half-life of at least 7 days after intravenous administration. In some implementations, the elimination half-life of the anti-IL-6 antibody is at least 14 days, at least 21 days, or at least 30 days.

[0187] In some implementations, the anti-IL-6 antibody has a human IgG constant region with at least one amino acid substitution (prolonging serum half-life) compared to the unsubstituted human IgG constant region.

[0188] In some embodiments, the IgG constant domain comprises substitutions at residues 252, 254, and 256, wherein the amino acid substitution at residue 252 is a tyrosine substitution, the amino acid substitution at residue 254 is a threonine substitution, and the amino acid substitution at residue 256 is a glutamic acid substitution (“YTE”). See U.S. Patent No. 7,083,784, which is incorporated herein by reference in its entirety. In some embodiments with extended half-life, the IgG constant domain comprises substitutions selected from T250Q / M428L. (Hinton et al., J. Immunology 176:346-356 (2006)); N434A (Yeung et al., J. Immunology 182:7663-7671 (2009)); or T307A / E380A / N434A (Petkova et al., International Immunology , 18: 1759-1769 (2006)).

[0189] In some embodiments, the elimination half-life of the anti-IL-6 antibody is increased by utilizing the FcRN binding properties of human serum albumin. In some embodiments, the antibody binds to albumin (Smith et al., Bioconjug. Chem .,12: 750-756 (2001)). In some embodiments, the anti-IL-6 antibody is fused to the bacterial albumin-binding domain (Stork et al., 12: 750-756 (2001)). Prot. Eng. Design Science 20: 569-76 (2007)). In some embodiments, the anti-IL-6 antibody is fused to an albumin-binding peptide (Nguygen et al., Prot Eng Design Sel 19: 291-297 (2006). In some embodiments, the anti-IL antibody is bispecific, with one specificity against IL-6 and the other specificity against human serum albumin (Ablynx, WO 2006 / 122825 (Bispecific nanobody)).

[0190] In some implementations, the elimination half-life of the anti-IL-6 antibody is increased by the following: PEGylation (Melmed et al., Nature Reviews Drug Discovery7: 641-642 (2008)); HPMA copolymer conjugation (Lu et al, Nature Biotechnology 17: 1101-1104 (1999)); polydextrose conjugation (Kabanov et al, Nuclear Medicine Communications , 16: 362-369 (1995)); conjugation with high amino acid polymers (HAP; HAPylation) (Schlapschy et al, Prot Eng Design Sel 20: 273-284 (2007)); or polysialylation (Constantinou et al, Bioconjug. Chem . 20: 924-931 (2009)).

[0191] 5.7.1.1.1 MED5117 and Derivatives In certain embodiments, the anti-IL-6 antibody or antigen-binding portion thereof comprises all six CDRs of MEDI5117. In particular embodiments, the antibody or antigen-binding portion thereof comprises the MEDI5117 heavy chain V region and light chain V region. In specific embodiments, the antibody is a full-length MEDI5117 antibody. MEDI5117 antibodies are described in WO 2010 / 088444 and US 2012 / 0034212, the disclosures of which are incorporated herein by reference in their entireties. The MEDI5117 antibody has the following CDRs and heavy and light chain sequences: MEDI5117 VH CDR1 MEDI5117 VH CDR2 MEDI5117 VH CDR3 MEDI5117 VL CDR1 MEDI5117 VL CDR2 MEDI5117 VL CDR3 MEDI5117 Heavy Chain MEDI5117 Light Chain In various embodiments, the anti-IL-6 antibody is a derivative of MED5117.

[0192] In some embodiments, the MED5117 derivative comprises one or more amino acid substitutions in the heavy chain and / or light chain V regions of MED5117.

[0193] In certain embodiments, the MED5117 derivative comprises fewer than 25 amino acid substitutions, fewer than 20 amino acid substitutions, fewer than 15 amino acid substitutions, fewer than 10 amino acid substitutions, fewer than 5 amino acid substitutions, fewer than 4 amino acid substitutions, fewer than 3 amino acid substitutions, fewer than 2 amino acid substitutions, or 1 amino acid substitution relative to the original V H and / or V L H and VL domains of MEDI5117 while retaining specificity for human IL-6.

[0194] In certain embodiments, the MED5117 derivative comprises an amino acid sequence that is at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequence of the VH and VL domains of MEDI5117. Percent sequence identity is determined using the BLAST algorithm using default parameters.

[0195] In certain embodiments, the MED5117 derivative comprises an amino acid sequence in which the CDRs comprise an amino acid sequence that is at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequence of the respective CDRs of MEDI5117. Percent sequence identity is determined using the BLAST algorithm using default parameters.

[0196] In certain embodiments, the V H and / or V L CDR derivative comprises a conservative amino acid substitution at one or more predicted non-essential amino acid residues (i.e., amino acid residues that are not critical for specific binding of the antibody to human IL-6).

[0197] 5.7.1.1.2 Other Anti-IL-6 Antibodies In various embodiments, the anti-IL-6 antibody comprises six CDRs from an antibody selected from the group consisting of: sirukumab, clazakizumab, siltuximab, ontrizumab, emapalumab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb). In certain embodiments, the anti-IL-6 antibody comprises a heavy chain V region and a light chain V region from an antibody selected from the group consisting of: sirukumab, clazakizumab, siltuximab, ontrizumab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb). In particular embodiments, the anti-IL-6 antibody is an antibody selected from the group consisting of: sirukumab, clazakizumab, siltuximab, ontrizumab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb).

[0198] In some embodiments, the anti-IL-6 antibody comprises the six CDRs from an antibody selected from those described in US 2016 / 0168243, US 2016 / 0130340, US 2015 / 0337036, US 2015 / 0203574, US 2015 / 0140011, US 2015 / 0125468, US 2014 / 0302058, US 2014 / 0141013, US 2013 / 0280266, US 2013 / 0017575, US 2010 / 0215654, US 2008 / 0075726, US Patent No. 5,856,135, US 2006 / 0240012, US 2006 / 0257407, or US Patent No. 7,291,721, the disclosures of which are incorporated by reference herein in their entireties.

[0199] 5.7.2 Anti-IL-6 Receptor Antibodies In various embodiments, the IL-6 antagonist is an anti-IL-6 receptor antibody or antigen binding fragment or derivative thereof.

[0200] In some embodiments, the IL-6 antagonist is a full-length anti-IL-6 receptor monoclonal antibody. In particular embodiments, the full-length monoclonal antibody is an IgG antibody. In certain embodiments, the full-length monoclonal antibody is an IgGl, IgG2, IgG3, or IgG4 antibody. In some embodiments, the IL-6 antagonist is a polyclonal composition comprising a plurality of species of full-length anti-IL-6 receptor antibodies, each of the plurality of species having unique CDRs. In some embodiments, the IL-6 antagonist is an antibody fragment selected from a Fab and a Fab' fragment. In some embodiments, the IL-6 antagonist is a scFv, a single domain antibody, including a VHH single domain nanobody derived from a camelid. In some embodiments, the antibody is bispecific or multispecific, with at least one of the antigen binding moieties having specificity for IL-6R.

[0201] In some embodiments, the antibody is fully human. In some embodiments, the antibody is humanized. In some embodiments, the antibody is chimeric and has a non-human V region and a human C region. In some embodiments, the antibody is murine.

[0202] In typical embodiments, the anti-IL-6 receptor antibody has a Kd for binding to human IL-6R of less than 100 nM. D In some embodiments, the anti-IL-6R antibody has a Kd for binding to human IL-6R of less than 75 nM, 50 nM, 25 nM, 20 nM, 15 nM, or 10 nM. DIn certain embodiments, the anti-IL-6 receptor antibody has a Kd for binding to human IL-6R of less than 5 nM, 4 nM, 3 nM, or 2 nM. D In selected embodiments, the anti-IL-6 receptor antibody has a Kd for binding to human IL-6R of less than 1 nM, 750 pM, or 500 pM. D In particular embodiments, the anti-IL-6 receptor antibody has a Kd for binding to human IL-6R of no more than 500 pM, 400 pM, 300 pM, 200 pM, or 100 pM. D .

[0203] In exemplary embodiments, the anti-IL-6R reduces the biological activity of IL-6.

[0204] In exemplary embodiments, the anti-IL-6R antibody has an elimination half-life of at least 7 days following intravenous administration. In certain embodiments, the anti-IL-6R antibody has an elimination half-life of at least 14 days, at least 21 days, or at least 30 days.

[0205] In some embodiments, the anti-IL-6R antibody has a human IgG constant region with at least one amino acid substitution (to extend the serum half-life) compared to an unsubstituted human IgG constant domain.

[0206] In certain embodiments, the IgG constant domain comprises substitutions at residues 252, 254, and 256, wherein the amino acid substitution at amino acid residue 252 is substitution with tyrosine, the amino acid substitution at amino acid residue 254 is substitution with serine, and the amino acid substitution at amino acid residue 256 is substitution with glutamic acid (“YTE”). See U.S. Patent No. 7,083,784, which is incorporated herein by reference in its entirety. In certain half-life extending embodiments, the IgG constant domain comprises a substitution selected from: T250Q / M428L (Hinton et al., J. Immunology 176:346-356 (2006)); N434A (Yeung et al., J. Immunology 182:7663-7671 (2009)); or T307A / E380A / N434A (Petkova et al., International Immunology, 18: 1759-1769 (2006)).

[0207] In some embodiments, the elimination half-life of an anti-IL-6R antibody is increased by taking advantage of the FcRN binding properties of human serum albumin. In certain embodiments, the antibody is bound to albumin (Smith et al., Bioconjug. Chem., 12: 750-756 (2001)). In some embodiments, the anti-IL-6R antibody is fused to a bacterial albumin binding domain (Stork et al., Prot. Eng. Design Science 20: 569-76 (2007)). In some embodiments, the anti-IL-6 antibody is fused to an albumin binding peptide (Nguygen et al., Prot Eng Design Sel 19: 291-297 (2006)). In some embodiments, the anti-IL antibody is bispecific, with one specificity directed against IL-6R and one specificity directed against human serum albumin (Ablynx, WO 2006 / 122825 (bispecific nanobody)).

[0208] In some embodiments, the elimination half-life of an anti-IL-6R antibody is increased by PEGylation (Melmed et al., Nature Reviews Drug Discovery 7: 641-642 (2008)); HPMA copolymer binding (Lu et al., Nature Biotechnology 17: 1101-1104 (1999)); polyglucose binding (Nuclear Medicine Communications, 16: 362-369 (1995)); binding to a homoamino acid polymer (HAP; HAPylation) (Schlapschy et al., Prot Eng Design Sel 20: 273-284 (2007)); or polysialylation (Constantinou et al., Bioconjug. Chem. 20: 924-931 (2009)).

[0209] In certain embodiments, the anti-IL-6R antibody or antigen-binding portion thereof comprises all six CDRs of tocilizumab. In particular embodiments, the antibody or antigen-binding portion thereof comprises the heavy chain and light chain V regions of tocilizumab. In specific embodiments, the antibody is a full-length tocilizumab antibody.

[0210] In certain embodiments, the anti-IL-6R antibody or antigen-binding portion thereof comprises all six CDRs of sarilumab. In particular embodiments, the antibody or antigen-binding portion thereof comprises the heavy chain and light chain V regions of sarilumab. In specific embodiments, the antibody is a full-length sarilumab antibody.

[0211] In certain embodiments, the anti-IL-6R antibody, or antigen-binding portion thereof, comprises all six CDRs of the antibody described in US 2012 / 0225060.

[0212] In certain embodiments, the anti-IL-6R antibody, or antigen-binding portion thereof, is a single domain antibody. In particular embodiments, the single domain antibody is a camelid VHH single domain antibody. In specific embodiments, the antibody is febuxostat (ALX-0061) (Ablynx NV).

[0213] 5.7.3 Anti-IL-6:IL-6R complex antibodies In various embodiments, the IL-6 antagonist is an antibody specific for the complex of IL-6 and IL-6R. In certain embodiments, the antibody has six CDRs of an antibody selected from those described in US 2011 / 0002936, which is incorporated herein by reference in its entirety.

[0214] 5.7.4 JAK and STAT inhibitors IL-6 is known to signal through the JAK-STAT pathway.

[0215] In various embodiments, the IL-6 antagonist is an inhibitor of the JAK signaling pathway. In some embodiments, the JAK inhibitor is a JAK1 specific inhibitor. In some embodiments, the JAK inhibitor is a JAK3 specific inhibitor. In some embodiments, the JAK inhibitor is a pan-JAK inhibitor.

[0216] In certain embodiments, the JAK inhibitor is selected from the group consisting of tofacitinib (Xeljanz), desatinib, ruxolitinib, upadacitinib, baricitinib, filgotinib, lestaurtinib, pacritinib, pesonitinib, INCB-039110, ABT-494, INCB-047986, and AC-410.

[0217] In various embodiments, the IL-6 antagonist is a STAT3 inhibitor. In a specific embodiment, the inhibitor is AZD9150 (AstraZeneca, Isis Pharmaceuticals), a STAT3 antisense molecule.

[0218] 5.7.5 Additional IL-6 antagonists In various embodiments, the IL-6 antagonist is an antagonist peptide.

[0219] In certain embodiments, the IL-6 antagonist is C326 (an IL-6 inhibitor by Avidia, also known as AMG220) or FE301, a recombinant protein inhibitor of IL-6 (Ferring International Center S.A., Conaris Research Institute AG). In some embodiments, the anti-IL-6 antagonist comprises soluble gpl30, FE301 (Conaris / Ferring).

[0220] 5.8 Dosage Regimens 5.8.1 Antibodies, antigen-binding fragments, peptides In typical embodiments, the antibody, antigen-binding fragment, and peptide IL-6 antagonists are administered parenterally.

[0221] In some parenteral embodiments, the IL-6 antagonist is administered intravenously. In certain intravenous embodiments, the IL-6 antagonist is administered as a bolus. In certain intravenous embodiments, the IL-6 antagonist is administered as an infusion. In certain intravenous embodiments, the IL-6 antagonist is administered as a bolus followed by an infusion. In some parenteral embodiments, the IL-6 antagonist is administered subcutaneously.

[0222] In various embodiments, the antibody, antigen-binding fragment, or peptide IL-6 antagonist is administered in a dose that is independent of the patient's weight or surface area (uniform dose).

[0223] In some embodiments, the intravenous uniform dose is 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, or 10 mg. In some embodiments, the intravenous uniform dose is 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, or 20 mg. In some embodiments, the intravenous uniform dose is 25 mg, 30 mg, 40 mg, or 50 mg. In some embodiments, the intravenous uniform dose is 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg. In some embodiments, the intravenous uniform dose is 1 - 10 mg, 10 - 15 mg, 15 - 20 mg, 20 - 30 mg, 30 - 40 mg, or 40 - 50 mg. In some embodiments, the intravenous uniform dose is 1 - 40 mg or 50 - 100 mg.

[0224] In some embodiments, the subcutaneous uniform dose is 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg. In some embodiments, the subcutaneous uniform dose is 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, or 200 mg. In some embodiments, the subcutaneous uniform dose is 210 mg, 220 mg, 230 mg, 240 mg, or 250 mg. In some embodiments, the subcutaneous uniform dose is 10 - 100 mg, 100 - 200 mg, or 200 - 250 mg. In some embodiments, the subcutaneous uniform dose is 10 - 20 mg, 20 - 30 mg, 30 - 40 mg, 40 - 50 mg, 50 - 60 mg, 60 - 70 mg, 70 - 80 mg, 80 - 90 mg, or 90 - 100 mg. In some embodiments, the subcutaneous uniform dose is 100 - 125 mg, 125 - 150 mg, 150 - 175 mg, 175 - 200 mg, or 200 - 250 mg.

[0225] In various embodiments, the antibody, antigen binding fragment, or peptide IL-6 antagonist is administered at a dose based on the weight of the patient.

[0226] In some embodiments, the antagonist is administered at an intravenous dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, or 1.0 mg / kg. In some embodiments, the antagonist is administered at a dose of 1.5 mg / kg, 2 mg / kg, 2.5 mg / kg, 3 mg / kg, 3.5 mg / kg, 4 mg / kg, 4.5 mg / kg, or 5 mg / kg.

[0227] In some embodiments, the subcutaneous weight-based dose is 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, or 1.0 mg / kg. In some embodiments, the antagonist is administered at a dose of 1.5 mg / kg, 2 mg / kg, 2.5 mg / kg, 3 mg / kg, 3.5 mg / kg, 4 mg / kg, 4.5 mg / kg, or 5 mg / kg.

[0228] In various intravenous embodiments, the IL-6 antagonist is administered once every 7 days, once every 14 days, once every 21 days, once every 28 days, or once a month. In various subcutaneous embodiments, the IL-6 antagonist is administered once every 14 days, once every 28 days, once a month, once every two months (once every other month), or once every three months.

[0229] In certain preferred embodiments, the IL-6 antagonist is the MEDI5117 antibody. In various embodiments, MEDI5117 is administered IV once a week at a uniform dose of 1 - 30 mg. In certain embodiments, the MEDI5117 antibody is administered IV once a week at a uniform dose of 1, 2, 3, 4, 5, 7.5, 10, 15, 20, 25, or 30 mg. In some embodiments, the MEDI5117 antibody is administered s.c. once a month to once every three months at a uniform dose of 25 - 250 mg. In particular embodiments, the MEDI5117 is administered s.c. once a month, once every two months, or once every 3 months at a dose of 30 mg, 45 mg, 60 mg, 75 mg, 100 mg, 120 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, or 250 mg.

[0230] In some embodiments, the IL-6 antagonist is tocilizumab. In various embodiments, tocilizumab is administered s.c. once a week at a starting dose of 162 mg for patients > 100 kg. In some embodiments, tocilizumab is administered IV once every 4 weeks at a dose of 4 mg / kg, followed by escalation to 8 mg / kg every 4 weeks, based on clinical response.

[0231] 5.8.2 JAK and STAT Inhibitors In typical embodiments, the small molecule JAK inhibitors and STAT inhibitors are administered orally.

[0232] In various embodiments, the inhibitor is administered at an oral dose of 1 - 10 mg, 10 - 20 mg, 20 - 30 mg, 30 - 40 mg, or 40 - 50 mg once or twice a day. In some embodiments, the inhibitor is administered at a dose of 50 - 60 mg, 60- 70 mg, 70 - 80 mg, 80 - 90 mg, or 90 - 100 mg once or twice a day. In some embodiments, the inhibitor is administered at a dose of 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 mg PO once or twice a day. In some embodiments, the inhibitor is administered at a dose of 75 mg PO QD or BID, at a dose of 100 mg PO QD or BID.

[0233] In certain embodiments, the JAK inhibitor is tofacitinib, and is administered at a dose of 5 mg PO BID, or at a dose of 11 mg PO QD.

[0234] In certain embodiments, the JAK inhibitor is decernotinib, and is administered at a dose of 25 mg, 50 mg, 100 mg, or 150 mg PO BID.

[0235] In certain embodiments, the inhibitor is ruxolitinib, and is administered at a dose of 25 mg PO BID, at a dose of 20 mg PO BID, at a dose of 15 mg PO BID, at a dose of 10 mg PO BID, or at a dose of 5 mg PO BID.

[0236] 5.9 Other Therapeutic Agents In various embodiments of the methods described herein, the method further comprises administering a therapeutic agent other than an IL-6 antagonist, wherein the second therapeutic agent is also capable of reducing hepcidin expression.

[0237] In some embodiments, the second therapeutic agent is a BMP antagonist. In certain embodiments, the BMP antagonist is an anti-BMP6 antibody. In particular embodiments, the anti-BMP6 antibody has the six CDRs of the antibodies described in US 2016 / 0176956 or US 2016 / 0159896, the disclosure of which is incorporated herein by reference in its entirety.

[0238] In certain embodiments, the second therapeutic agent is a hepcidin regulator antagonist. In particular embodiments, the hepcidin regulator antagonist is an anti-hepcidin regulator antibody. In specific embodiments, the anti-hepcidin regulator antibody has the six CDRs of the antibodies described in Kovac et al, HaematologicaThe six CDRs of the antibody revealed in (2016) doi:10.3324 / haematol.2015.140772 [electronic version prior to print].

[0239] In some embodiments, the second therapeutic agent is a hepazilidine antagonist. In a particular embodiment, the hepazilidine antagonist is an anti-hepazilidine antibody. In a specific embodiment, the antibody has the six CDRs of the antibody described in US 2016 / 0017032, the disclosure of which is incorporated herein by reference in its entirety.

[0240] 5.10 Reagent Kit On the other hand, reagent kits are provided.

[0241] In a typical implementation, the kit provides reagents to identify patients using biological samples obtained from the patients themselves. TMPRSS6 Genotype at the location of SNP rs855791.

[0242] 5.11 Other aspects and implementation methods 5.11.1 Methods for treating inflammation in chronic kidney disease or cardiovascular disease In other aspects and embodiments, compositions and methods are provided for characterizing and treating inflammation in chronic kidney disease or cardiovascular disease with an IL-6 antagonist, as well as methods for characterizing a patient’s response to treatment.

[0243] These aspects and implementation methods are based, at least in part, on the discovery that: [the presence of G or C at nucleotide position 2321]. TMPRSS6 One or more alleles (encoding amino acids containing alanine at amino acid position 736) TMPRSS6 Inflammation in patients with chronic kidney disease and cardiovascular disease (containing peptides) increases their risk of death, and these individuals can be treated with IL-6 antagonists to reduce this risk. As reported in more detail below, chronic kidney disease patients were genotyped, serum IL-6 and CRP levels were analyzed, and these diagnostic data were compared with EPO administration and mortality risk. [The following section describes a study involving a G or C nucleotide at position 2321.] TMPRSS6 One or more alleles (encoding amino acids containing alanine at amino acid position 736) TMPRSS6 Patients with elevated levels of peptides, IL-6, and / or CRP require higher doses of EPO for treatment and have a higher mortality rate. Nucleotides at this location have been shown to be important in identifying patients with iron deficiency anemia (see Finberg et al., Nat. Genet. 2008; 40(5): 569-571, the entire contents of which are hereby cited in full (including its notes and the full content concerning sequences, variants, nomenclature, etc.). These data strongly support the use of...TMPRSS6 Genotypic subsets of patients require higher doses of EPO and / or have a higher risk of death, and may respond to IL-6 inhibition, with or without standard therapy for anemia (e.g., associated with chronic kidney disease). By suppressing inflammation, EPO dosing can be reduced, thereby avoiding adverse side effects of EPO (e.g., cardiovascular risks).

[0244] These aspects and implementation methods are further based on the following finding: having a G or C nucleotide at position 2321. TMPRSS6 One or more alleles (encoding amino acids containing alanine at amino acid position 736) TMPRSS6 Patients with IL-6 (peptides) are at higher risk of death associated with myocardial infarction or cardiovascular disease. These patients may also benefit from IL-6 inhibition, which will reduce inflammation and the increased risk.

[0245] Therefore, the following treatment method is provided: by inhibiting, for example, at SNP rs855791. TMPRSS6 The biological activity of IL-6 in patients selected through genotyping is used to treat inflammation associated with cardiovascular disease or chronic kidney disease (including chronic kidney disease anemia) and / or reduce the risk of death associated with such conditions by blocking the binding of IL-6 or its receptor (gp80) to each other, or by blocking its signal transduction or expression (e.g., by anti-IL-6 antibodies or by anti-IL-6R antibodies or JAK1 / STAT3 inhibition). In one embodiment, treatment of chronic kidney disease is performed with or without standard treatment for anemia and by methods such as targeting SNP rs855791. TMPRSS6 Genotyping and detection of inflammatory marker levels (such as increased serum IL-6 and / or CRP levels) were used to characterize the response of patients with chronic kidney disease to treatment for anemia.

[0246] This provides a method for treating cardiovascular disease or chronic kidney disease with anemia and / or reducing chronic inflammation-related mortality in such patients by administering agents that inhibit the biological activity or expression of IL-6.

[0247] In some aspects and embodiments, compositions and methods are provided for treating chronic inflammation that promotes death in individuals with chronic kidney disease or cardiovascular disease, and for characterizing a patient's response to such treatments. In certain embodiments, methods are provided for characterizing and treating chronic inflammatory anemia and death (e.g., in chronic kidney disease) and for characterizing a patient's response to treatments for anemia (e.g., administration of erythropoietin or an erythropoiesis-stimulating agent). In one aspect, a method for treating chronic inflammation in selected individuals is provided, the method comprising administering an IL-6 antagonist to the individual, wherein, for treatment, the individual receives an IL-6 antagonist via a method having alanine encoded at amino acid position 736.TMPRSS6 one or more alleles of a polypeptide are selected.

[0248] In another aspect, a method for treating inflammation or chronic inflammation in a selected individual having a cardiovascular disease or chronic kidney disease is provided, the method involving administering to the individual an IL-6 antagonist (e.g., an anti-IL-6 antibody), wherein the individual is selected for treatment by having one or more alleles of a polypeptide encoding an alanine at amino acid position 736. TMPRSS6 one or more alleles of a polypeptide are selected. In one embodiment, the method reduces the risk of death in the individual. In one embodiment, the individual has a history of myocardial infarction or heart failure.

[0249] In another aspect, a method for reducing the risk of inflammation and death in a selected individual having a cardiovascular disease or kidney disease is provided, the method comprising administering to the individual an IL-6 antagonist (e.g., an anti-IL-6 antibody), wherein the individual is selected as having one or more alleles of a polypeptide encoding an alanine at amino acid position 736, and has increased inflammation relative to a reference. TMPRSS6 one or more alleles of a polypeptide are selected. In one embodiment, the individual has a history of myocardial infarction or heart failure.

[0250] In another aspect, a method for reducing the risk of death in an individual having chronic kidney disease or heart failure is provided, the method comprising administering to the individual an IL-6 antagonist, wherein the individual is identified as having one or more alleles of a polypeptide encoding an alanine at amino acid position 736, and has increased inflammation relative to a reference. TMPRSS6 one or more alleles of a polypeptide are selected. In one embodiment, the individual has a history of myocardial infarction or heart failure.

[0251] In another aspect, a method of treating anemia in an individual is provided, the method involving administering to the individual an IL-6 antagonist alone or in combination with a therapy for anemia, wherein the individual is identified as having one or more alleles of a polypeptide (also known as matrix metalloproteinase-2; MT2) encoding an alanine at amino acid position 736 (e.g., at nucleotide position 2321 of a nucleic acid molecule having a G or C), and has increased inflammation relative to a reference. TMPRSS6 one or more alleles of a polypeptide (also known as matrix metalloproteinase-2; MT2) encoding an alanine at amino acid position 736 (e.g., at nucleotide position 2321 of a nucleic acid molecule having a G or C), and has increased inflammation relative to a reference. TMPRSS6 one or more alleles of a polypeptide (also known as matrix metalloproteinase-2; MT2) encoding an alanine at amino acid position 736 (e.g., at nucleotide position 2321 of a nucleic acid molecule having a G or C), and has increased inflammation relative to a reference.

[0252] In another aspect, a method of treating anemia in an individual having increased inflammation is provided, the method involving administering an IL-6 antagonist (e.g., an IL-6 antibody) alone or in combination with an erythropoietic factor in an amount effective to neutralize inflammation in the individual having one or more alleles of a polypeptide encoding an alanine at amino acid position 736 (e.g., at nucleotide position 2321 of a nucleic acid molecule having a G or C). TMPRSS6 one or more alleles of a polypeptide (also known as matrix metalloproteinase-2; MT2) encoding an alanine at amino acid position 736 (e.g., at nucleotide position 2321 of a nucleic acid molecule having a G or C), and has increased inflammation relative to a reference. TMPRSS6 one or more alleles of a polypeptide (also known as matrix metalloproteinase-2; MT2) encoding an alanine at amino acid position 736 (e.g., at nucleotide position 2321 of a nucleic acid molecule having a G or C), and has increased inflammation relative to a reference.

[0253] In yet another aspect, a method of enhancing the response to EPO in an individual identified as in need thereof is provided, the method comprising administering an IL-6 antagonist (e.g., an IL-6 antibody) in an amount effective to neutralize inflammation in the individual having one or more alleles of a polypeptide (e.g., in an individual having a nucleic acid molecule having a G or C at nucleotide position 2321 of the nucleic acid molecule) encoding a threonine at amino acid position 736, thereby reducing the dose of EPO. TMPRSS6 In another aspect, a method of reducing mortality in an individual having increased inflammation is provided, the method involving administering an IL-6 antagonist in an amount effective to neutralize inflammation in the individual having one or more alleles of a polypeptide (e.g., in an individual having a nucleic acid molecule having a G or C at nucleotide position 2321 of the nucleic acid molecule) encoding a threonine at amino acid position 736. TMPRSS6 In another aspect, a method of reducing mortality in an individual having increased inflammation is provided, the method involving administering an IL-6 antagonist in an amount effective to neutralize inflammation in the individual having one or more alleles of a polypeptide (e.g., in an individual having a nucleic acid molecule having a G or C at nucleotide position 2321 of the nucleic acid molecule) encoding a threonine at amino acid position 736.

[0254] In another aspect, a method of reducing mortality in an individual having increased inflammation is provided, the method involving administering an IL-6 antagonist in an amount effective to neutralize inflammation in the individual having one or more alleles of a polypeptide (e.g., in an individual having a nucleic acid molecule having a G or C at nucleotide position 2321 of the nucleic acid molecule) encoding a threonine at amino acid position 736. TMPRSS6 In another aspect, a method of reducing mortality in an individual having increased inflammation is provided, the method involving administering an IL-6 antagonist in an amount effective to neutralize inflammation in the individual having one or more alleles of a polypeptide (e.g., in an individual having a nucleic acid molecule having a G or C at nucleotide position 2321 of the nucleic acid molecule) encoding a threonine at amino acid position 736. TMPRSS6 In another aspect, a method of reducing mortality in an individual having increased inflammation is provided, the method involving administering an IL-6 antagonist in an amount effective to neutralize inflammation in the individual having one or more alleles of a polypeptide (e.g., in an individual having a nucleic acid molecule having a G or C at nucleotide position 2321 of the nucleic acid molecule) encoding a threonine at amino acid position 736.

[0255] In another aspect, a method of reducing mortality in an individual having increased inflammation is provided, the method involving administering an IL-6 antagonist in an amount effective to neutralize inflammation in the individual having one or more alleles of a polypeptide (e.g., in an individual having a nucleic acid molecule having a G or C at nucleotide position 2321 of the nucleic acid molecule) encoding a threonine at amino acid position 736. TMPRSS6 In another aspect, a method of reducing mortality in an individual having increased inflammation is provided, the method involving administering an IL-6 antagonist in an amount effective to neutralize inflammation in the individual having one or more alleles of a polypeptide (e.g., in an individual having a nucleic acid molecule having a G or C at nucleotide position 2321 of the nucleic acid molecule) encoding a threonine at amino acid position 736. TMPRSS6 In another aspect, a method of reducing mortality in an individual having increased inflammation is provided, the method involving administering an IL-6 antagonist in an amount effective to neutralize inflammation in the individual having one or more alleles of a polypeptide (e.g., in an individual having a nucleic acid molecule having a G or C at nucleotide position 2321 of the nucleic acid molecule) encoding a threonine at amino acid position 736.

[0256] In another aspect, a method of reducing mortality in an individual having increased inflammation is provided, the method involving administering an IL-6 antagonist in an amount effective to neutralize inflammation in the individual having one or more alleles of a polypeptide (e.g., in an individual having a nucleic acid molecule having a G or C at nucleotide position 2321 of the nucleic acid molecule) encoding a threonine at amino acid position 736. TMPRSS6 In another aspect, a method of reducing mortality in an individual having increased inflammation is provided, the method involving administering an IL-6 antagonist in an amount effective to neutralize inflammation in the individual having one or more alleles of a polypeptide (e.g., in an individual having a nucleic acid molecule having a G or C at nucleotide position 2321 of the nucleic acid molecule) encoding a threonine at amino acid position 736. TMPRSS6 In another aspect, a method of reducing mortality in an individual having increased inflammation is provided, the method involving administering an IL-6 antagonist in an amount effective to neutralize inflammation in the individual having one or more alleles of a polypeptide (e.g., in an individual having a nucleic acid molecule having a G or C at nucleotide position 2321 of the nucleic acid molecule) encoding a threonine at amino acid position 736.

[0257] In various embodiments of any of the aspects described herein, the individual has or is identified as having anemia, including cancer anemia, anemia in chronic autoimmune disease, anemia in chronic inflammatory disease, anemia in cardiovascular disease, anemia in metabolic syndrome, and the like. In various embodiments of any of the aspects described herein, the individual has or is identified as having chronic kidney disease. In various embodiments of any of the aspects described herein, the individual has or is identified as having inflammation. In various embodiments of any of the aspects described herein, the individual has or is identified as having an increased risk of mortality associated with chronic inflammation, chronic kidney disease, or cardiovascular disease. In various embodiments of any of the aspects described herein, the individual is identified as in need of treatment. In various embodiments of any of the aspects described herein, the individual has or is identified as having increased inflammation. In various embodiments of any of the aspects described herein, the individual has or is identified as having one or more alleles of a polypeptide encoding an alanine at amino acid position 736 (e.g., at nucleotide position 2321 of a nucleic acid molecule having a G or C), and has an increased inflammation relative to a reference. TMPRSS6 In various embodiments of any of the aspects described herein, the individual has or is identified as having anemia, including cancer anemia, anemia in chronic autoimmune disease, anemia in chronic inflammatory disease, anemia in cardiovascular disease, anemia in metabolic syndrome, and the like. In various embodiments of any of the aspects described herein, the individual has or is identified as having chronic kidney disease. In various embodiments of any of the aspects described herein, the individual has or is identified as having inflammation. In various embodiments of any of the aspects described herein, the individual has or is identified as having an increased risk of mortality associated with chronic inflammation, chronic kidney disease, or cardiovascular disease. In various embodiments of any of the aspects described herein, the individual is identified as in need of treatment. In various embodiments of any of the aspects described herein, the individual has or is identified as having increased inflammation. In various embodiments of any of the aspects described herein, the individual has or is identified as having one or more alleles of a polypeptide encoding an alanine at amino acid position 736 (e.g., at nucleotide position 2321 of a nucleic acid molecule having a G or C), and has an increased inflammation relative to a reference. TMPRSS6 In various embodiments of any of the aspects described herein, the individual has or is identified as having anemia, including cancer anemia, anemia in chronic autoimmune disease, anemia in chronic inflammatory disease, anemia in cardiovascular disease, anemia in metabolic syndrome, and the like. In various embodiments of any of the aspects described herein, the individual has or is identified as having chronic kidney disease. In various embodiments of any of the aspects described herein, the individual has or is identified as having inflammation. In various embodiments of any of the aspects described herein, the individual has or is identified as having an increased risk of mortality associated with chronic inflammation, chronic kidney disease, or cardiovascular disease. In various embodiments of any of the aspects described herein, the individual is identified as in need of treatment. In various embodiments of any of the aspects described herein, the individual has or is identified as having increased inflammation. In various embodiments of any of the aspects described herein, the individual has or is identified as having one or more alleles of a polypeptide encoding an alanine at amino acid position 736 (e.g., at nucleotide position 2321 of a nucleic acid molecule having a G or C), and has an increased inflammation relative to a reference.

[0258] In various embodiments of any of the aspects described herein, the therapy for anemia comprises administration of an erythropoietic factor. In various embodiments, the erythropoietic factor is one or more of erythropoietin, erythropoiesis stimulating agent, HIF stabilizer, and supplemental iron.

[0259] In various embodiments, the increased inflammation is characterized by increased IL-6 and / or CRP levels relative to a reference group (e.g., as measured by a conventional CRP assay or high sensitivity assay (hsCRP), both of which detect CRP but differ in assay performance). In various embodiments, the increased inflammation is characterized by IL-6 greater than about 5 pg / ml. In various embodiments, the increased inflammation is characterized by CRP greater than about 2 mg / L.

[0260] In various embodiments of any of the aspects described herein, the IL-6 antagonist is administered in an amount that effectively neutralizes inflammation. In various embodiments, the amount that effectively neutralizes inflammation reduces IL-6 to less than about 15 pg / ml, less than about 10 pg / ml, or less than about 5 pg / ml. In various embodiments, the amount that effectively neutralizes inflammation reduces CRP to less than about 2 mg / L or less than about 0.2 mg / L.

[0261] In various embodiments of any of the aspects described herein, administration of an IL-6 antagonist or anti-IL-6 antibody reduces the dose of EPO. In some embodiments, the EPO dose is reduced by about 40 IU / kg / week, about 50 IU / kg / week, about 80 IU / kg / week, about 100 IU / kg / week, or greater than 100 IU / kg / week. In various embodiments, administration of an IL-6 antagonist or anti-IL-6 antibody reduces the side effects of the increased EPO dose.

[0262] In one implementation, a patient with chronic kidney disease is treated with or without standard treatment for anemia. Specifically, an agent that inhibits the biological activity or expression of IL-6 is administered to an individual with chronic kidney disease-related anemia, with or without treatment for anemia (e.g., administration of EPO, ESA, HIF sedatives, iron supplementation, or red blood cell transfusion). Treatment for anemia works by stimulating erythropoiesis or erythrocyte production. Therefore, agents that increase the growth or proliferation of erythrocytes or their progenitors and / or reduce cell death of erythrocytes or their progenitors may also be administered. Erythrocyte progenitors include, for example, hematopoietic stem cells, common bone marrow progenitors, proerythroblasts, erythroblasts, reticulocytes, or any cell capable of differentiating or maturing into erythrocytes.

[0263] Agents that inhibit the biological activity of IL-6 by blocking the binding of IL-6 or its receptor (gp80) to each other or by blocking its signal transduction or expression can be provided in the form of a pharmaceutical composition to an individual suffering from anemia associated with chronic kidney disease, wherein the pharmaceutical composition comprises an effective amount of the agent, an agent for treating anemia (e.g., EPO, ESA, HIF prolyl-hydroxylase inhibitor, iron supplementation), and suitable excipients. In one embodiment, the agent is an IL-6 antagonist or anti-IL-6 antibody that reduces the content or activity of IL-6 peptides or nucleic acid molecules in the individual, or that inhibits intracellular signal transduction triggered by IL-6 receptor activation. Anti-IL-6 antibodies (e.g., MEDI5117) may be administered in combination with treatments for anemia (e.g., administration of EPO, ESA, HIF tranquilizers, iron supplementation). The method of treatment for anemia depends on the patient's condition. TMPRSS6genotype and the inflammatory state of the patient. In the case of treatment for anemia (e.g., administration of EPO, ESA, HIF stabilizers, iron supplementation), patients who are homozygous for the major allele of TMPRSS6 (encoding a polypeptide comprising an alanine at amino acid position 736) TMPRSS6 patients who are homozygous for the minor allele of TMPRSS6 (encoding a polypeptide comprising a valine at amino acid position 736) TMPRSS6 do not require anti-IL-6 therapy to supplement treatment for anemia. Methods for treatment of anemia can vary depending on the stage of chronic kidney disease, patient age, health, and physical condition.

[0264] In another aspect, assays suitable for characterizing an individual having anemia associated with chronic inflammation (e.g., in chronic kidney disease) are provided. The inflammatory markers IL-6 and CRP can be detected by any suitable method. The methods described herein can be used individually or in combination for detecting the IL-6 or CRP biomarkers and / or an inflammatory condition. In one embodiment, inflammation is characterized by detecting the amount of IL-6 and / or CRP polypeptide in a biological sample (e.g., serum) of an individual relative to the expression of a reference (e.g., serum from a healthy control individual), wherein an increase in IL-6 and / or CRP expression is indicative of inflammation. In another embodiment, an increase in IL-6 and / or CRP expression is indicative of an individual having anemia associated with chronic kidney disease will not respond to treatment for anemia and / or will respond to treatment for anemia when administered in combination with an IL-6 antagonist (e.g., an anti-IL-6 antibody).

[0265] In one embodiment, the amount of IL-6 and / or CRP polypeptide is measured by immunoassay. Immunoassays generally use antibodies (or other agents that specifically bind to a marker) to detect the presence or amount of a biomarker in a sample. Antibodies can be prepared by methods well known in the art (e.g., by immunizing an animal with a biomarker or fragment thereof). The biomarker can be isolated from a sample based on its binding characteristics. Alternatively, if the amino acid sequence of a polypeptide biomarker is known, the polypeptide can be synthesized and used to generate antibodies by methods well known in the art.

[0266] In various embodiments, conventional immunoassays are used, including, for example, Western blotting; sandwich immunoassays, including ELISA and other enzyme immunoassays; fluorescence-based immunoassays and chemiluminescence. Nephelometry is an assay performed in the liquid phase, where the antibody is in solution. Binding of antigen to antibody results in a change in light absorbance, which is measured. Other forms of immunoassay include magnetic immunoassay, radioimmunoassay, and real-time immunoquantitative PCR (iqPCR). Other detection methods include liquid chromatography and mass spectrometry.

[0267] Immunoassays can be performed on solid substrates (e.g., chips, beads, microfluidic platforms, membranes) or on any other format that supports the binding of antibodies to markers and subsequent detection. A single marker can be detected at a time or a multiplex format can be used. Multiplexed immunoassays can involve planar microarrays (protein chips) and bead-based microarrays (suspension arrays).

[0268] Chronic kidney disease patients with anemia identified as having increased IL-6 and / or CRP polypeptide levels are selected for treatment with an agent that reduces IL-6 expression or activity (e.g., an anti-IL-6 antibody) in combination with treatment of anemia. Patients treated by the methods of the application can be monitored by detecting changes in hemoglobin, hematocrit, erythropoietin dose, IL-6 and / or CRP expression following treatment. Patients showing reduced IL-6 and / or CRP expression and / or reduced inflammation are identified as responsive to IL-6 inhibition.

[0269] Other aspects and embodiments are provided in the following numbered clauses.

[0270] 1. A method of treating chronic inflammation in a selected individual, the method comprising administering to the individual an IL-6 antagonist, wherein the individual selected for treatment has one or more alleles encoding a polypeptide comprising alanine at amino acid position 736. TMPRSS6

[0271] 2. A method of treating inflammation in a selected individual having cardiovascular disease, heart failure, and / or chronic kidney disease, the method comprising administering to the individual an IL-6 antagonist, wherein the individual selected for treatment has one or more alleles encoding a polypeptide comprising alanine at amino acid position 736. TMP RSS6

[0272] 3. A method of reducing inflammation and risk of death in a selected individual having cardiovascular disease, heart failure, and / or chronic kidney disease, the method comprising administering to the individual an IL-6 antagonist, wherein the individual is selected as having one or more alleles encoding a polypeptide comprising alanine at amino acid position 736 and having increased inflammation relative to a reference. TMPRSS6

[0273] ​​​4. A method of treating anemia in an individual having chronic kidney disease, the method comprising administering to the individual an IL-6 antagonist, wherein the individual is identified as having one or more alleles of a polypeptide that encodes an alanine at amino acid position 736, and has increased inflammation relative to a reference. TMPRSS6

[0274] 5. The method of any one of clauses 1 to 4, wherein the IL-6 antagonist is administered in an amount effective to neutralize inflammation.

[0275] 6. The method of any one of clauses 1 to 4, wherein the IL-6 antagonist is an anti-IL-6 antibody.

[0276] 7. The method of clause 5, wherein the method further comprises administering to the individual an erythropoietic factor.

[0277] 8. The method of any one of clauses 1 to 4, wherein the method reduces the risk of death in the individual.

[0278] 9. A method of reducing the risk of death in an individual having chronic kidney disease or heart failure, the method comprising administering to the individual an IL-6 antagonist, wherein the individual is identified as having one or more alleles of a polypeptide that encodes an alanine at amino acid position 736, and has increased inflammation relative to a reference. TMPRSS6

[0279] 10. A method of treating anemia in an individual having increased inflammation, the method comprising: administering an erythropoietic factor and an anti-IL-6 antibody in an amount effective to neutralize inflammation in the individual having one or more alleles of a polypeptide that encodes an alanine at amino acid position 736. TMPRSS6

[0280] 11. The method of any one of clauses 1 to 10, wherein the increased inflammation is characterized by increased IL-6 and / or CRP levels relative to a reference.

[0281] 12. The method of clause 11, wherein the increased inflammation is characterized by IL-6 greater than about 5 pg / ml, about 10 pg / ml, or about 15 pg / ml.

[0282] 13. The method of clause 10, wherein the increased inflammation is characterized by CRP greater than about 2 mg / L.

[0283] 14. The method of clause 10, wherein the erythropoietic factor is one or more of erythropoietin, an erythropoiesis stimulating agent, a HIF stabilizer, and supplemental iron.

[0284] ​​​15. A method for enhancing the response to EPO in individuals identified as having a need, the method comprising administering an IL-6 antagonist or an anti-IL-6 antibody in an amount that effectively neutralizes inflammation in the individual, thereby enhancing the individual's response to EPO, the individual having an amino acid encoding alanine at amino acid position 736. TMPRSS6 One or more alleles of a polypeptide.

[0285] 16. The method of paragraph 15, wherein the amount of anti-IL-6 antibody that effectively neutralizes inflammation reduces IL-6 to less than about 15 pg / ml, less than about 10 pg / ml, or less than about 5 pg / ml.

[0286] 17. The method as described in paragraph 16, wherein the amount of an IL-6 antagonist or anti-IL-6 antibody that effectively neutralizes inflammation reduces CRP to less than about 2 mg / L.

[0287] 18. The method of paragraph 15, wherein an IL-6 antagonist or anti-IL-6 antibody is administered to reduce the dose of EPO.

[0288] 19. The method of paragraph 17, wherein the dose of EPO is reduced by about 40 IU / kg / week, about 50 IU / kg / week, about 80 IU / kg / week, about 100 IU / kg / week, or more than 100 IU / kg / week.

[0289] 20. The method of paragraph 15, wherein administration of an IL-6 antagonist or anti-IL-6 antibody reduces the side effects of increased EPO.

[0290] 21. A method for selecting a therapy for identifying individuals deemed to have a need, the method comprising: a) Characterize individuals as having an amino acid encoding alanine at amino acid position 736. TMPRSS6 One or more alleles of the polypeptide; and b) Detect the levels of one or more inflammatory markers, IL-6 and CRP, wherein the indicator is that an IL-6 antagonist should be administered in combination with the therapy for anemia.

[0291] 22. The method of paragraph 21, wherein the method further comprises administering an IL-6 antagonist to an individual and a therapy for anemia.

[0292] 23. The method of paragraph 21, wherein the treatment for anemia comprises administering erythropoietin.

[0293] 24. A method for increasing proliferation or survival of red blood cells or progenitors thereof in an individual identified as being in need thereof, the method comprising administering to the individual an IL-6 antagonist and an erythropoiesis-stimulating factor, wherein the individual is identified as having one or more alleles encoding a polypeptide comprising an alanine at amino acid position 736, and wherein the individual has increased inflammation relative to a reference. TMPRSS6

[0294] 25. The method of clause 24, wherein the method reduces cell death of red blood cells or progenitors thereof.

[0295] 26. The method of clause 24, wherein the progenitor cells are hematopoietic stem cells, proerythroblast cells, erythroblast cells, or reticulocytes.

[0296] 27. The method of any one of clauses 15-24, wherein the individual has chronic kidney disease.

[0297] 28. The method of any one of clauses 15-24, wherein the individual has anemia.

[0298] 29. The method of clause 28, wherein the anemia is cancer anemia, anemia in chronic autoimmune disease, anemia in chronic inflammatory disease, or anemia in metabolic syndrome.

[0299] 30. The method of any one of clauses 15-24, wherein the IL-6 antagonist is administered in an amount effective to neutralize inflammation.

[0300] 31. The method of any one of clauses 15-24, wherein the IL-6 antagonist is an anti-IL-6 antibody.

[0301] 32. The method of any one of clauses 15-24, wherein the increased inflammation is characterized by increased IL-6 and / or CRP levels relative to a reference.

[0302] 33. The method of any one of clauses 15-24, wherein the increased inflammation is characterized by IL-6 greater than about 5 pg / ml, about 10 pg / ml, or about 15 pg / ml.

[0303] 34. The method of any one of clauses 15-24, wherein the increased inflammation is characterized by CRP greater than about 2 mg / L.

[0304] 35. The method of any one of clauses 15-24, wherein the amount effective to neutralize inflammation reduces IL-6 to less than about 10 pg / ml or less than about 5 pg / ml.

[0305] ​36. The method of any one of clauses 15 to 24, wherein the amount effective to neutralize inflammation reduces CRP to less than about 2 mg / L.

[0306] 37. The method of any one of clauses 15 to 24, wherein the erythropoiesis- promoting factor is one or more of erythropoietin, an erythropoiesis-stimulating agent, a HIF stabilizer, and supplemental iron.

[0307] 38. The method of clause 24, wherein administration of the IL-6 antagonist reduces the dosage of EPO.

[0308] 39. The method of clause 38, wherein the IL-6 antagonist is an anti-IL-6 antibody.

[0309] 40. The method of clause 38, wherein the dosage of EPO is reduced by about 40 IU / kg / week, about 50 IU / kg / week, about 80 IU / kg / week, about 100 IU / kg / week, or more than 100 IU / kg / week.

[0310] 41. The method of clause 23, wherein administration of the IL-6 antagonist reduces side effects of increased EPO.

[0311] 42. The method of any one of clauses 1 to 40, wherein the allele comprises a G at position 2321 of the polynucleotide. TMPRSS6

[0312] 43. The method of any one of clauses 1 to 42, wherein the IL-6 antagonist is an anti-IL-6 antibody having one or more CDRs selected from the following nucleic acid sequences: SNYMI (SEQ ID NO: 12); DLYYYAGDTYYADSVKG (SEQ ID NO: 13); WADDHPPWIDL (SEQ ID NO: 14); RASQGISSWLA (SEQ ID NO: 15); KASTLES (SEQ ID NO: 16); and QQSWLGGS (SEQ ID NO: 17).

[0313] ​44. The method of clause 42, wherein the anti-IL-6 antibody has a heavy chain CDR1 comprising the sequence SNYMI (SEQ ID NO: 12); a heavy chain CDR2 comprising the sequence DLYYYAGDTYYADSVKG (SEQ ID NO: 13); a heavy chain CDR3 comprising the sequence WADDHPPWIDL (SEQ ID NO: 14); a light chain CDR1 comprising the sequence RASQGISSWLA (SEQ ID NO: 15); a light chain CDR2 comprising the sequence (SEQ ID NO: 16); and a light chain CDR3 comprising the sequence QQSWLGGS (SEQ ID NO 17).

[0314] 45. The method of clause 42, wherein the anti-IL-6 antibody has a heavy chain comprising the sequence: .

[0315] 46. The method of clause 42, wherein the anti-IL-6 antibody has a light chain comprising the sequence: .

[0316] 47. The method of clause 42, wherein the anti-IL-6 antibody is MEDI5117.

[0317] 48. The method of any one of clauses 1 to 47, wherein the individual is a human.

[0318] 5.11.2 Methods for treating cardiorenal syndrome In other aspects and embodiments, compositions and methods for treating cardiorenal syndrome are provided.

[0319] These aspects and embodiments are based, at least in part, on the discovery that anti-IL-6 treatment of a rodent model of cardiorenal syndrome has an equivalent effect as standard of care treatment of cardiac injury. As reported in more detail below, following myocardial infarction, a rodent model of cardiorenal syndrome is treated with either anti-IL-6 or standard of care therapy (ACE inhibitor, perindopril). Following treatment, the degree of ejection fraction, myocardial contractility, and the percentage of fibrotic tissue in the heart tissue is measured. The degree of ejection fraction is increased in both the group of individuals treated with anti-IL-6 and the group of individuals treated with standard of care therapy as compared to the amount in the group of individuals treated with control therapeutic agent. Myocardial contractility is increased in both the group treated with anti-IL-6 and the group treated with standard of care therapy as compared to the amount in the group of individuals treated with control therapeutic agent. The amount of fibrotic tissue is decreased in both the group treated with anti-IL-6 and the group treated with standard of care therapy as compared to the amount in the group of individuals treated with control therapeutic agent. Furthermore, the degree of ejection fraction and the amount of fibrotic tissue are similar in the group of individuals treated with anti-IL-6 and the group of individuals treated with standard of care therapy. The results indicate that anti-IL-6 therapy has an equivalent efficacy as standard of care therapy in treating cardiorenal syndrome in a rodent model.

[0320] These aspects and embodiments are further based, at least in part, on the discovery that patients identified as having cardiorenal syndrome following myocardial infarction and having elevated IL-6 levels have an increased risk of cardiovascular death, including heart failure. Without being bound by theory, IL-6 can play a causal role in the development and / or progression of cardiorenal syndrome. Therefore, patients having elevated IL-6 levels following myocardial infarction or patients having cardiorenal syndrome and elevated IL-6 levels would likely benefit from IL-6 inhibition.

[0321] Accordingly, there is provided a method of treatment for cardiac and / or renal injury in an individual having cardiorenal syndrome, which involves administering to the individual an IL-6 antagonist. In some embodiments, the cardiac and / or renal injury in an individual having cardiorenal syndrome is treated in the presence or absence of standard treatment for cardiorenal syndrome. There is also provided a method for characterizing the risk of cardiovascular death in a patient following myocardial infarction, which involves detecting an increase in IL-6 levels in a biological sample obtained from the patient.

[0322] In one aspect, there is provided a method of treatment for cardiac and / or renal injury in an individual having cardiorenal syndrome, which involves administering to the individual an IL-6 antagonist.

[0323] In another aspect, there is provided a method of increasing cardiac function in an individual having cardiorenal syndrome, which involves administering to the individual an IL-6 antagonist.

[0324] In yet another aspect, a method of reducing fibrosis in an individual having cardiorenal syndrome is provided, the method involving administering to the individual an IL-6 antagonist.

[0325] In various embodiments of any of the aspects described herein, the method further involves administering to the individual a standard of care therapy. In various embodiments, the standard of care therapy is an angiotensin-converting enzyme (ACE) inhibitor.

[0326] In various embodiments of any of the aspects described herein, the increased cardiac function is characterized by an increase in ejection fraction and / or myocardial contractility in the individual relative to a reference group. In various embodiments of any of the aspects described herein, the reduced fibrosis is characterized by a decrease in the percentage of fibrotic tissue in a tissue sample from the individual relative to a reference group. In various embodiments, the fibrosis is in cardiac tissue.

[0327] In various embodiments of any of the aspects described herein, the individual has cardiac and / or renal injury. In various embodiments of any of the aspects described herein, the individual has cardiac injury followed by renal injury.

[0328] In another aspect, the present application provides a method of identifying an individual having an increased risk of cardiovascular death (e.g., heart failure) after myocardial infarction in an individual, the method involving measuring the amount of one or more of an IL-6 polynucleotide or polypeptide in a sample from the individual relative to a reference group, wherein an increased amount of one or more of the IL-6 polynucleotide or polypeptide is indicative of an increased risk of cardiovascular death.

[0329] In yet another aspect, the present application provides a method of characterizing the risk of cardiovascular death (e.g., heart failure) in an individual after myocardial infarction in an individual, the method involving measuring the amount of one or more of an IL-6 polynucleotide or polypeptide in a sample from the individual relative to a reference, wherein an increased amount of one or more of the IL-6 polynucleotide or polypeptide is indicative of an increased risk of cardiovascular death.

[0330] In various embodiments of any of the aspects described herein, the individual has cardiorenal syndrome, heart failure, chronic kidney disease, or absence of cardiorenal pathology. In various embodiments of any of the aspects described herein, the individual is identified as having cardiorenal syndrome, heart failure, chronic kidney disease, or absence of cardiorenal pathology about one month after myocardial infarction.

[0331] In another aspect, the present application provides a method of treating cardiac and / or renal injury in a selected individual having cardiorenal syndrome, the method involving administering to the individual an IL-6 antagonist, wherein the individual is selected for treatment by detecting in a biological sample from the individual an increased level of one or more of an IL-6 polynucleotide or polypeptide relative to a reference.

[0332] In another aspect, the present application provides a method of reducing the risk of cardiovascular death (e.g., heart failure) in a selected individual having cardiorenal syndrome, the method involving administering to the individual an IL-6 antagonist, wherein the individual is selected by detecting in a biological sample from the individual an increased level of one or more of an IL-6 polynucleotide or polypeptide relative to a reference. In various embodiments of any of the aspects described herein, the individual has suffered a myocardial infarction.

[0333] In various embodiments of any of the aspects described herein, the IL-6 antagonist is an anti-IL-6 antibody. In various embodiments, the anti-IL-6 antibody is MEDI5117.

[0334] In various embodiments of any of the aspects described herein, the biological sample is a plasma sample or a serum sample. In various embodiments of any of the aspects described herein, the individual is a human.

[0335] In another aspect, a method for treating cardiorenal syndrome and / or reducing the risk of death or heart failure in a patient by administering an agent that inhibits IL-6 biological activity or expression is provided. In one embodiment, a patient having cardiorenal syndrome is treated in the presence or absence of standard therapy for cardiorenal syndrome, such as an angiotensin converting enzyme (ACE) inhibitor. In particular, an agent that inhibits IL-6 biological activity or expression is provided to an individual having cardiorenal syndrome (e.g., an anti-IL-6 antibody is administered).

[0336] In another aspect, a method of increasing cardiac function and a method of reducing fibrosis in an individual having cardiorenal syndrome is provided. The method comprises administering to the individual an agent that inhibits IL-6 biological activity or expression. In some embodiments, the increase in cardiac function is characterized by an increase in the individual's ejection fraction relative to a reference (e.g., the ejection fraction of a healthy control individual), or an increase in myocardial contractility (e.g., dP / dt 最大 ) relative to a reference (e.g., the myocardial contractility of a healthy control individual). In some embodiments, the reduction in fibrosis is characterized by a decrease in the percentage of fibrotic tissue in a tissue sample from the individual relative to a reference (e.g., a tissue sample obtained from a healthy control individual). In one embodiment, the fibrosis is in cardiac tissue.

[0337] Agents that inhibit IL-6 biological activity by blocking the binding of IL-6 or its receptor (gp80) to each other or blocking its signal transduction or expression can be provided to an individual having cardiorenal syndrome in the form of a pharmaceutical composition, where the pharmaceutical composition comprises an effective amount of the agent and suitable excipients. In one embodiment, the agent is an IL-6 antagonist or an anti-IL-6 antibody that reduces the amount or activity of IL-6 polypeptides or polynucleotides in the individual, or inhibits intracellular signal transduction triggered by activation of the IL-6 receptor. Anti-IL-6 antibodies (e.g., MEDI5117) can be administered. The method for treatment of cardiorenal syndrome can vary depending on the stage of cardiorenal syndrome, the age, health, and physical condition of the patient.

[0338] In various embodiments, individuals having cardiorenal syndrome are treated with an IL-6 antagonist. In addition, individuals having an increased risk of cardiovascular death and / or heart failure following myocardial infarction can be identified by characterizing the plasma IL-6 levels in the individual. Individuals having elevated IL-6 levels have an increased risk of cardiovascular death and / or heart failure. Such individuals can be selected for treatment with an IL-6 antagonist. In addition, individuals having cardiorenal syndrome and having increased IL-6 levels, including such individuals who have suffered a myocardial infarction, can be selected for treatment. After selection for treatment, such individuals can be administered virtually any IL-6 antagonist known in the art. Suitable IL-6 antagonists include, for example, IL-6 antagonists, commercially available IL-6 antagonists, IL-6 antagonists developed using methods well known in the art, and antagonists directed to the intracellular signaling system associated with IL-6R.

[0339] In another aspect, an assay for characterizing the risk of cardiovascular death, heart failure, and / or death in an individual following myocardial infarction is provided. The assay provides for detection of IL-6 in a biological sample obtained from the individual. IL-6 can be detected by any suitable method. In one embodiment, the risk of cardiovascular death or heart failure is characterized by detecting the amount of IL-6 polypeptide in a biological sample (e.g., serum or plasma) of the individual relative to expression in a reference (e.g., serum or plasma from a healthy control individual or from a control individual not having cardiorenal pathology), where an increase in IL-6 indicates an increased risk of cardiovascular death or heart failure. Individuals identified as having an increased risk of cardiovascular death, heart failure, or death can be selected for treatment. In another embodiment, individuals having cardiorenal syndrome and having increased IL-6 levels are selected for treatment with an IL-6 antagonist (e.g., an anti-IL-6 antibody).

[0340] In one embodiment, IL-6 polynucleotide levels are measured. IL-6 polynucleotide levels can be measured by standard methods, such as quantitative PCR, Northern blotting, microarray, mass spectrometry, and in situ hybridization.

[0341] In one embodiment, IL-6 polypeptide levels are measured. IL-6 polypeptide levels can be measured by standard methods, such as by immunoassay. Immunoassays generally use antibodies (or other agents that specifically bind to a marker) to detect the presence or levels of a biomarker in a sample. Antibodies can be prepared by methods well known in the art, for example by immunizing an animal with a biomarker or fragment thereof. The biomarker can be isolated from a sample based on its binding characteristics. Alternatively, if the amino acid sequence of a polypeptide biomarker is known, the polypeptide can be synthesized and used to generate antibodies by methods well known in the art.

[0342] In various embodiments, the analysis employs traditional immunoassays, including, for example, Western blotting; sandwich immunoassays, including ELISA and other enzyme immunoassays; fluorescence-based immunoassays and chemiluminescence. Nephelometry is an assay performed in the liquid phase, where the antibody is in solution. Binding of antigen to antibody results in a change in light absorbance, which is measured. Other forms of immunoassay include magnetic immunoassay, radioimmunoassay, and real-time immunoquantitative PCR (iqPCR). Other detection methods include liquid chromatography and mass spectrometry.

[0343] Immunoassays can be performed on solid substrates (e.g., chips, beads, microfluidic platforms, membranes) or in any other format that supports binding of antibody to marker and subsequent detection. A single marker can be detected at a time or multiplexed formats can be used. Multiplexed immunoassays can involve planar microarrays (protein chips) and bead-based microarrays (suspension arrays).

[0344] For treatment with an agent that reduces IL-6 expression or activity (e.g., an anti-IL-6 antibody), a patient with cardiorenal syndrome is selected who has been identified as having increased IL-6 polypeptide levels. The therapeutic agent can be given in combination with standard treatments for cardiorenal syndrome (e.g., ACE inhibitors). Patients treated with the methods of the application can be monitored by detecting changes in IL-6 following treatment.

[0345] Other aspects and embodiments are provided in the following numbered clauses.

[0346] 1. A method of treating cardiac and / or renal injury in an individual with cardiorenal syndrome, the method comprising administering to the individual an IL-6 antagonist.

[0347] 2. A method of increasing cardiac function in an individual having cardiorenal syndrome, the method comprising administering to the individual an IL-6 antagonist.

[0348] 3. A method of reducing fibrosis in an individual having cardiorenal syndrome, the method comprising administering to the individual an IL-6 antagonist.

[0349] 4. The method of clause 2, wherein the increase in cardiac function is characterized by an increase in ejection fraction in the individual relative to a reference group.

[0350] 5. The method of clause 3, wherein the fibrosis is in cardiac tissue.

[0351] 6. The method of clause 3 or 5, wherein the reduction in fibrosis is characterized by a reduction in the percentage of fibrotic tissue in a tissue sample from the individual relative to a reference group.

[0352] 7. The method of any one of clauses 1 to 6, wherein the individual has cardiac and / or renal injury.

[0353] 8. The method of any one of clauses 1 to 7, wherein the individual has cardiac injury followed by renal injury.

[0354] 9. The method of any one of clauses 1 to 8, further comprising administering to the individual a standard of care therapy.

[0355] 10. The method of any one of clauses 1 to 9, wherein the standard of care therapy is an angiotensin-converting enzyme (ACE) inhibitor.

[0356] 11. A method of identifying an individual having an increased risk of cardiovascular death following myocardial infarction in an individual, the method comprising measuring the amount of one or more of an IL-6 polynucleotide or polypeptide in a sample from the individual relative to a reference, wherein an increased amount of one or more of the IL-6 polynucleotide or polypeptide indicates an increased risk of cardiovascular death.

[0357] 12. A method of characterizing the risk of cardiovascular death in an individual following myocardial infarction in an individual, the method comprising measuring the amount of one or more of an IL-6 polynucleotide or polypeptide in a sample from the individual relative to a reference, wherein an increased amount of one or more of the IL-6 polynucleotide or polypeptide indicates an increased risk of cardiovascular death.

[0358] 13. The method of clause 11 or 12, wherein the individual has cardiorenal syndrome, heart failure, chronic kidney disease, or no cardiorenal pathology.

[0359] 14. The method of any one of clauses 11 to 13, wherein the individual is identified as having cardiorenal syndrome, heart failure, chronic kidney disease, or no cardiorenal pathology about one month after myocardial infarction.

[0360] 15. A method of treating cardiac and / or renal injury in a selected individual having cardiorenal syndrome, the method comprising administering to the individual an IL-6 antagonist, wherein the individual is selected for treatment by detecting in a biological sample from the individual an increased level of one or more of an IL-6 polynucleotide or polypeptide relative to a reference.

[0361] 16. A method of reducing the risk of cardiovascular death in a selected individual having cardiorenal syndrome, the method comprising administering to the individual an IL-6 antagonist, wherein the individual is selected by detecting in a biological sample from the individual an increased level of one or more of an IL-6 polynucleotide or polypeptide relative to a reference.

[0362] 17. The method of clause 15 or 16, wherein the individual has had a myocardial infarction.

[0363] 18. The method of any one of clauses 1 to 10 or 15 to 17, wherein the IL-6 antagonist is an anti-IL-6 antibody.

[0364] 19. The method of clause 18, wherein the anti-IL-6 antibody is MEDI5117.

[0365] 20. The method of any one of clauses 11 to 19, wherein the biological sample is a plasma sample.

[0366] 21. The method of any one of clauses 1 to 20, wherein the individual is a human.

[0367] The present invention is also directed to the following embodiments: 1. A method of treating a hepcidin-mediated disorder, comprising: administering to a patient having a hepcidin-mediated disorder a therapeutically effective amount of an IL-6 antagonist, wherein the patient has been determined to have TMPRSS6 at least one copy of the major allele of rs855791.

[0368] 2. The method of embodiment 1, wherein the patient has previously been determined to have the TMPRSS6 at least one copy of the major allele of rs855791.

[0369] 3. The method of embodiment 1, further comprising the earlier step of: determining that the patient has the TMPRSS6at least one copy of the major allele of rs855791.

[0370] 4. The method of any one of embodiments 1 to 3, wherein the patient has elevated serum IL-6 levels prior to treatment.

[0371] 5. The method of any one of embodiments 1 to 4, wherein the patient has elevated serum CRP levels prior to treatment.

[0372] 6. The method of any one of embodiments 1 to 5, wherein the hepcidin-mediated disorder is chronic anemia.

[0373] 7. The method of embodiment 6, wherein the patient is male and has a hemoglobin (Hb) level of less than 14 g / dl prior to treatment.

[0374] 8. The method of embodiment 7, wherein the patient has a Hb level of less than 13 g / dl prior to treatment.

[0375] 9. The method of embodiment 8, wherein the patient has a Hb level of less than 12 g / dl prior to treatment.

[0376] 10. The method of embodiment 9, wherein the patient has a Hb level of less than 11 g / dl prior to treatment.

[0377] 11. The method of embodiment 6, wherein the patient is female and has a Hb level of less than 12 g / dl prior to treatment.

[0378] 12. The method of embodiment 11, wherein the patient has a Hb level of less than 11 g / dl prior to treatment.

[0379] 13. The method of embodiment 12, wherein the patient has a Hb level of less than 10 g / dl prior to treatment.

[0380] 14. The method of embodiment 13, wherein the patient has a Hb level of less than 9 g / dl prior to treatment.

[0381] 15. The method of any one of embodiments 6 to 10, wherein the patient is male and has a hematocrit of less than 40% prior to treatment.

[0382] 16. The method of embodiment 15, wherein the patient has a hematocrit of less than 35% prior to treatment.

[0383] 17. The method of embodiment 16, wherein the patient has a hematocrit of 30-34% prior to treatment.

[0384] 18. The method of any one of embodiments 6, 11 to 14, wherein the patient has a pre-treatment hematocrit of less than 36%.

[0385] 19. The method of embodiment 18, wherein the patient has a pre-treatment hematocrit of less than 30%.

[0386] 20. The method of embodiment 19, wherein the patient has a pre-treatment hematocrit of 26-29%.

[0387] 21. The method of any one of embodiments 6 to 20, wherein the patient has received at least one pre-treatment administration of an ESA.

[0388] 22. The method of embodiment 6, wherein the patient has received at least one pre-treatment administration of an ESA and has a normal Hb level or a normal hematocrit.

[0389] 23. The method of any one of embodiments 6 to 20, wherein the patient has received at least one pre-treatment administration of an iron supplement.

[0390] 24. The method of embodiment 6, wherein the patient has received at least one pre-treatment administration of an iron supplement and has a normal Hb level or a normal hematocrit.

[0391] 25. The method of any one of embodiments 6 to 20, wherein the patient has received at least one pre-treatment transfusion of blood or packed red blood cells.

[0392] 26. The method of embodiment 6, wherein the patient has received at least one pre-treatment transfusion of blood or packed red blood cells and has a normal Hb level or a normal hematocrit.

[0393] 27. The method of any one of embodiments 6 to 26, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to increase the Hb level of the patient above the pre-treatment level.

[0394] 28. The method of any one of embodiments 6 to 27, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to increase the hematocrit of the patient above the pre-treatment level.

[0395] 29. The method of embodiment 21 or 22, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to decrease the ESA dose of the patient without decreasing the Hb level of the patient below a level approximating the pre-treatment level.

[0396] 30. The method of either embodiment 21 or 22, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient for the ESA dose of the patient to be reduced without the hematocrit of the patient being reduced below a level close to that present prior to treatment.

[0397] 31. The method of any one of embodiments 21, 22, 29, or 30, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient for the ESA dose of the patient to be reduced by at least 10% compared to the ESA dose prior to treatment.

[0398] 32. The method of embodiment 31, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient for the ESA dose of the patient to be reduced by at least 20% compared to the ESA dose prior to treatment.

[0399] 33. The method of embodiment 32, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient for the ESA dose of the patient to be reduced by at least 50% compared to the ESA dose prior to treatment.

[0400] 34. The method of any one of embodiments 6 to 33, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reverse functional iron deficiency.

[0401] 35. The method of any one of embodiments 6 to 34, wherein the chronic disease is chronic kidney disease (CKD).

[0402] 36. The method of embodiment 35, wherein the patient has KDOQI stage 1 chronic kidney disease, KDOQI stage 2 chronic kidney disease, KDOQI stage 3 chronic kidney disease, KDOQI stage 4 chronic kidney disease, or KDOQI stage 5 chronic kidney disease.

[0403] 37. The method of embodiment 36, wherein the patient has KDOQI stage 5 chronic kidney disease.

[0404] 38. The method of embodiment 35, wherein the patient has cardiorenal syndrome (CRS).

[0405] 39. The method of embodiment 38, wherein the patient has type 4 CRS.

[0406] 40. The method of any one of embodiments 35 to 39, wherein the patient has received at least one dialysis treatment prior to treatment.

[0407] 41. The method of any one of embodiments 35 to 40, wherein one dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce cardiovascular (CV) mortality as compared to a historical control group that is age-matched and disease-matched.

[0408] 42. The method of any one of embodiments 6 to 34, wherein the chronic disease is a chronic inflammatory disease.

[0409] 43. The method of embodiment 42, wherein the chronic inflammatory disease is rheumatoid arthritis (RA).

[0410] 44. The method of embodiment 43, wherein the patient has a DAS28 score prior to treatment of greater than 5.1.

[0411] 45. The method of embodiment 43, wherein the patient has a DAS28 score prior to treatment of 3.2 to 5.1.

[0412] 46. The method of embodiment 43, wherein the patient has a DAS28 score prior to treatment of less than 2.6.

[0413] 47. The method of embodiment 43, wherein the patient has moderate to severe active RA prior to treatment.

[0414] 48. The method of any one of embodiments 43 to 47, wherein the patient has received at least one prior administration of methotrexate.

[0415] 49. The method of any one of embodiments 43 to 48, wherein the patient has received at least one prior administration of a TNFα antagonist.

[0416] 50. The method of embodiment 49, wherein the TNFα antagonist is selected from the group consisting of etanercept, adalimumab, infliximab, certolizumab, and golimumab.

[0417] 51. The method of any one of embodiments 43 to 47, wherein the patient has received at least one prior administration of an IL-6 antagonist.

[0418] 52. The method of embodiment 51, wherein the prior IL-6 antagonist is tocilizumab.

[0419] 53. The method of embodiment 51, wherein the pre-treatment IL-6 antagonist is tofacitinib.

[0420] 54. The method of any one of embodiments 51-53, wherein the treatment IL-6 antagonist is MEDI5117.

[0421] 55. The method of embodiment 42, wherein the chronic inflammatory disease is selected from the group consisting of juvenile idiopathic arthritis, ankylosing spondylitis, psoriasis, psoriatic arthritis, inflammatory bowel disease, Crohn's disease, and ulcerative colitis.

[0422] 56. The method of any one of embodiments 6-34, wherein the chronic disease is cancer.

[0423] 57. The method of embodiment 56, wherein the cancer is selected from the group consisting of solid tumors, small cell lung cancer, non-small cell lung cancer, hematological cancer, multiple myeloma, leukemia, chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), lymphoma, Hodgkin's lymphoma, and hepatocellular adenoma.

[0424] 58. The method of any one of embodiments 6-34, wherein the chronic disease is a chronic infection.

[0425] 59. The method of any one of embodiments 6-34, wherein the chronic disease is congestive heart failure (CHF).

[0426] 60. The method of any one of embodiments 1-5, wherein the hepcidin-mediated disorder is iron-refractory iron deficiency anemia (IRIDA).

[0427] 61. The method of any one of embodiments 1-5, wherein the hepcidin-mediated disorder is acute coronary syndrome.

[0428] 62. The method of embodiment 61, wherein the patient has suffered a myocardial infarction (MI) within 60 days prior to the first administration of the IL-6 antagonist.

[0429] 63. The method of embodiment 62, wherein the patient has suffered a MI within 30 days prior to the first administration of the IL-6 antagonist.

[0430] 64. The method of embodiment 63, wherein the patient has suffered a MI within 48 hours prior to the first administration of the IL-6 antagonist.

[0431] 65. The method of embodiment 64, wherein the patient has suffered a MI within 24 hours prior to the first administration of the IL-6 antagonist.

[0432] 66. The method of any of embodiments 61-65, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to improve myocardial contractility compared to the degree prior to treatment.

[0433] 67. The method of any of embodiments 61-66, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to improve cardiac ejection fraction compared to the degree prior to treatment.

[0434] 68. The method of any of embodiments 61-67, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce cardiac fibrosis compared to the degree prior to treatment.

[0435] 69. The method of any of embodiments 1-5, wherein the hepcidin-mediated disorder is Castleman's disease.

[0436] 70. A method for improving treatment of a hepcidin-mediated disorder, the method comprising: interrupting administration of an IL-6 antagonist to a patient having a hepcidin-mediated disorder, wherein the patient has been determined to be homozygous for TMPRSS6 a minor allele of rs855791.

[0437] 71. The method of embodiment 70, wherein the patient has been previously determined to be homozygous for the TMPRSS6 a minor allele of rs855791.

[0438] 72. The method of embodiment 70, further comprising the prior step of determining that the patient is homozygous for the TMPRSS6 a minor allele of rs855791.

[0439] 73. A method of treating an IL-6-mediated inflammatory disorder in a patient who is not anemic, comprising: administering to a patient who is not anemic and who has an IL-6-mediated inflammatory disorder a therapeutically effective amount of an IL-6 antagonist, wherein the patient has been determined to have TMPRSS6 at least one copy of a major allele of rs855791.

[0440] 74. The method of embodiment 73, wherein the patient has been previously determined to have the TMPRSS6 at least one copy of a major allele of rs855791.

[0441] 75. The method of embodiment 73, further comprising determining that the patient has at least one copy of the major allele of rs855791. TMPRSS6 the earlier step of determining that the patient has at least one copy of the major allele of rs855791.

[0442] 76. The method of any one of embodiments 1 to 75, wherein the patient has elevated pre-treatment serum IL-6 levels.

[0443] 77. The method of embodiment 76, wherein the patient has pre-treatment serum IL-6 levels greater than 2.5 pg / ml.

[0444] 78. The method of embodiment 77, wherein the patient has pre-treatment serum IL-6 levels greater than 5 pg / ml.

[0445] 79. The method of embodiment 78, wherein the patient has pre-treatment serum IL-6 levels greater than 7.5 pg / ml.

[0446] 80. The method of embodiment 79, wherein the patient has pre-treatment serum IL-6 levels greater than 10 pg / ml.

[0447] 81. The method of embodiment 80, wherein the patient has pre-treatment serum IL-6 levels greater than 12.5 pg / ml.

[0448] 82. The method of any one of embodiments 76 to 81, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce the free IL-6 levels in the serum of the patient below pre-treatment levels.

[0449] 83. The method of embodiment 82, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce free IL-6 levels by at least 10% compared to pre-treatment levels.

[0450] 84. The method of embodiment 83, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce free IL-6 levels in the serum of the patient by at least 20% compared to pre-treatment levels.

[0451] 85. The method of embodiment 84, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce free IL-6 levels in the serum of the patient by at least 50% compared to pre-treatment levels.

[0452] 86. The method of any one of embodiments 1 to 85, wherein the patient has elevated pre-treatment C-reactive protein (CRP) levels.

[0453] 87. The method of embodiment 86, wherein the patient has a pre-treatment CRP level greater than 2 mg / ml.

[0454] 88. The method of embodiment 87, wherein the patient has a pre-treatment CRP level greater than 3 mg / ml.

[0455] 89. The method of embodiment 88, wherein the patient has a pre-treatment CRP level greater than 5 mg / ml.

[0456] 90. The method of embodiment 89, wherein the patient has a pre-treatment CRP level greater than 7.5 mg / ml.

[0457] 91. The method of embodiment 90, wherein the patient has a pre-treatment CRP level greater than 10 mg / ml.

[0458] 92. The method of any one of embodiments 86 to 91, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce the patient's CRP level below the pre-treatment level.

[0459] 93. The method of embodiment 92, wherein a dose of the IL-6 antagonist is administered on a schedule and for a period of time sufficient to reduce the patient's CRP level by at least 50% compared to the pre-treatment level.

[0460] 94. The method of any one of embodiments 1 to 93, wherein the patient has been determined to have at least one copy of the major allele of rs855791 using TaqMan® real-time PCR analysis. TMPRSS6

[0461] 95. The method of any one of embodiments 1 to 94, wherein the IL-6 antagonist is an anti-IL-6 antibody or antigen-binding fragment or derivative thereof.

[0462] 96. The method of embodiment 95, wherein the anti-IL-6 antibody or antigen-binding fragment or derivative thereof has a K D .

[0463] 97. The method of embodiment 96, wherein the antibody or antigen-binding fragment or derivative thereof has a K D .

[0464] ​98. The method of embodiment 97, wherein the antibody or antigen-binding fragment or derivative has a Kd for binding to human IL-6 of less than 10 nM. D .

[0465] 99. The method of embodiment 98, wherein the antibody or antigen-binding fragment or derivative has a Kd for binding to human IL-6 of less than 1 nM. D .

[0466] 100. The method of any one of embodiments 95-99, wherein the anti-IL-6 antibody or antigen-binding fragment or derivative has an elimination half-life of at least 7 days following intravenous administration.

[0467] 101. The method of embodiment 100, wherein the anti-IL-6 antibody or antigen-binding fragment or derivative has an elimination half-life of at least 14 days following intravenous administration.

[0468] 102. The method of embodiment 101, wherein the anti-IL-6 antibody or antigen-binding fragment or derivative has an elimination half-life of at least 21 days following intravenous administration.

[0469] 103. The method of embodiment 102, wherein the anti-IL-6 antibody or antigen-binding fragment or derivative has an elimination half-life of at least 30 days following intravenous administration.

[0470] 104. The method of any one of embodiments 95-103, wherein the IL-6 antagonist is a full-length monoclonal anti-IL-6 antibody.

[0471] 105. The method of embodiment 104, wherein the antibody is an IgGl or IgG4 antibody.

[0472] 106. The method of embodiment 105, wherein the antibody is an IgGl antibody.

[0473] 107. The method of any one of embodiments 95-106, wherein the anti-IL-6 antibody or antigen-binding fragment or derivative is fully human.

[0474] 108. The method of any one of embodiments 95-106, wherein the anti-IL-6 antibody or antigen-binding fragment or derivative is humanized.

[0475] 109. The method of any one of embodiments 95-108, wherein the anti-IL-6 antibody or antigen-binding fragment or derivative comprises all six variable region CDRs of MED5117.

[0476] 110. The method of embodiment 109, wherein the antibody comprises the VH and VL of MED5117.

[0477] 111. The method of embodiment 110, wherein the antibody is MED5117.

[0478] 112. The method of any one of embodiments 95-108, wherein the anti-IL-6 antibody or antigen binding fragment or derivative comprises all six variable region CDRs of an antibody selected from the group consisting of siltuximab, gerilimzumab, sirukumab, clazakizumab, olokizumab, elsilimomab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb).

[0479] 113. The method of embodiment 112, wherein the anti-IL-6 antibody or antigen binding fragment or derivative comprises the heavy chain V region and light chain V region of an antibody selected from the group consisting of: sirukumab, clazakizumab, siltuximab, ontrizumab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb). In particular embodiments, the anti-IL-6 antibody is an antibody selected from the group consisting of: sirukumab, clazakizumab, siltuximab, ontrizumab, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb).

[0480] 114. The method of embodiment 113, wherein the anti-IL-6 antibody or antigen binding fragment or derivative is an antibody selected from the group consisting of: siltuximab, givinostat, sirukumab, clazakizumab, ono- 131, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb). In particular embodiments, the anti-IL-6 antibody is an antibody selected from the group consisting of: siltuximab, givinostat, sirukumab, clazakizumab, ono-131, VX30 (VOP-R003; Vaccinex), EB-007 (EBI-029; Eleven Bio), ARGX-109 (ArGEN-X), FM101 (Femta Pharmaceuticals, Lonza), and ALD518 / BMS-945429 (Alder Biopharmaceuticals, Bristol-Myers Squibb).

[0481] 115. The method of any one of embodiments 95-103, wherein the IL-6 antagonist is a single domain antibody, a VHH Nanobody, a Fab, or a scFv.

[0482] 116. The method of any one of embodiments 1-94, wherein the IL-6 antagonist is an anti-IL-6R antibody or antigen binding fragment or derivative thereof.

[0483] 117. The method of embodiment 116, wherein the anti-IL-6R antibody, antigen binding fragment or derivative is tocilizumab.

[0484] 118. The method of embodiment 116, wherein the anti-IL-6R antibody, antigen binding fragment or derivative is vobarilizumab.

[0485] 119. The method of any one of embodiments 1-94, wherein the IL-6 antagonist is a JAK inhibitor.

[0486] 120. The method of embodiment 119, wherein the JAK inhibitor is selected from the group consisting of: tofacitinib (Xeljanz), decernotinib, ruxolitinib, upadacitinib, baricitinib, filgotinib, lestaurtinib, pacritinib, peficitinib, INCB-039110, ABT-494, INCB-047986, and AC-410.

[0487] 121. The method of any one of embodiments 1 to 94, wherein the IL-6 antagonist is a STAT3 inhibitor.

[0488] 122. The method of any one of embodiments 95 to 118, wherein the IL-6 antagonist is administered non-enterally.

[0489] 123. The method of embodiment 122, wherein the IL-6 antagonist is administered subcutaneously.

[0490] 124. The method of any one of embodiments 119 to 120, wherein the IL-6 antagonist is administered orally.

[0491] 5.12 Example The following examples are provided in an illustrative rather than limiting manner.

[0492] 5.12.1 Example 1: EPO dosage and overall survival in patients with chronic kidney disease are only related to those with Cell Serum IL-6 and CRP levels were associated with patients who had at least one copy of the major allele of SNP rs855791. The peptide hormone hyapazidine plays a major role in systemic iron homeostasis. Hentze et al., TMPRSS6 142:24-38 (2010). It is known that hepatosil expression is affected by... TMPRSS6 The gene's product, interstitial protease-2, has an effect; this interstitial protease-2 is a type II transmembrane serine protease. It has been shown... Nature Genetics Common variants of the gene are associated with iron status, according to Benyamin et al. TMPRSS6 41(11):1173-1175 (2009), and has been displayed. Nature Genetics Certain gene mutations cause iron-refractory iron deficiency anemia (IRIDA), Finberg et al. TMPRSS640(5):569-571 (2008). SNPrs855791 (2321G→A; A736V) is TMPRSS6 Naturally occurring variants of the gene are associated with hepatocillin expression and blood heme levels.

[0493] To determine PLOS Computational Biol. Whether the genotype at the rs855791 SNP predicts the degree of anemia in end-stage renal disease was investigated by combining newly identified SNP genotyping with data collected from previous clinical studies in patients with chronic kidney disease. Since hepatocillin expression is also regulated by IL-6, Casanovas et al. Methods 10(1):e1003421(2014), also analyzed data to determine whether serum IL-6 levels could predict the degree of anemia in end-stage renal disease.

[0494] TMPRSS6 Based on general dialysis guidelines, ferritin >100 ng / mL and Hb >10 mg / dL, data from N=257 patients enrolled in the MIMICK1, MIMICK2 (localization of inflammatory markers in chronic kidney disease), and MIA (malnutrition, inflammation, and atherosclerosis) groups were managed down to N=208 to select patients who were stable on hemodialysis without iron deficiency anemia and without labeled anemia, thus excluding patients with factors that can be separated from iron transport by heme content. These groups were recruited in six dialysis units in the Stockholm-Uppsala (Sweden) region during the period from October 2003 to September 2004.

[0495] All patient clinical data, including erythropoietin (EPO) dose in IU / kg / week, serum IL-6 level in pg / ml, serum CRP level in mg / L, monthly survival, and SNP at rs855791, were collected. TMPRSS6 Genotyping was performed and analyzed using statistical analysis software (SPSS desktop; IBM). The studied... Results Alleles and their nucleotide and amino acid indicators are shown in Table 1 below.

[0496] Groups were split into rs855791 subgroups (homozygous AA, heterozygous AG, and homozygous GG), and each genotype group was split into tertiles or quartiles of serum IL-6 levels (e.g., IL-6 < 5 pg / ml compared to > 10 pg / ml, and IL-6 < 5 pg / ml compared to > 15 pg / ml) or serum CRP levels (CRP < 2 mg / L compared to > 2 mg / L). EPO dose was compared in the top and bottom tertiles and quartiles. Statistical analysis was performed within genotype groups by Students T-Test and between groups by ANOVA.

[0497] Figure 1 Since EPO dose has been titrated by the treating physician to achieve normal hemoglobin levels in each patient, EPO dose can be used as a proxy for underlying anemia severity. EPO dose was relatively insensitive to IL-6 variation in individuals homozygous for the minor allele (A / A) (A; left panel). However, EPO dose was sensitive to individual IL-6 levels in individuals with at least one copy of the major allele - patients who were heterozygous (A / G) or homozygous (G / G) for the major allele (B; right panel). In these latter individuals, increased serum IL-6 levels (e.g., > 5 pg / ml) were associated with increased EPO dose. Figure 1 TMPRSS6 B; right panel). In these latter individuals, increased serum IL-6 levels (e.g., > 5 pg / ml) were associated with increased EPO dose.

[0498] Without being bound by a particular theory, homozygosity for the minor allele removes the effect of IL-6 on iron delivery. Thus, independent of IL-6 levels, EPO dose was approximately the same in these patients (A / A).

[0499] Independent of IL-6 levels, individuals homozygous for the minor allele of rs855791 (A) showed similar mortality ( Figure 2A ). However, survival was variable in individuals with at least one copy of the major allele - patients who were heterozygous or homozygous for the major allele (G) - depending on IL-6 levels ( Figure 2B ). In fact, in response to elevated IL-6 levels in chronic kidney disease stage 5 dialysis individuals, TMPRSS6 the G allele conferred higher all-cause mortality. In individuals with at least one copy of the major allele (G), IL-6 levels ≥ 5 pg / ml (i.e., mid and highest IL-6) were associated with increased mortality compared to IL-6 levels < 5 pg / ml (i.e., low IL-6) ( Figure 2B ). Figure 3

[0500] ​​In individuals with heterozygous or homozygous major allele (G), the levels of the acute-phase reactant CRP—an inflammatory marker—were also associated with increased EPO doses, but this was not the case in patients with homozygous minor alleles. Discussion ).

[0501] Figure 1 like TMPRSS6 As shown in the figure, in having Figure 1 In patients with at least one copy of the major allele at the rs855791 SNP, the degree of basal anemia—measured as a clinically titrated dose of EPO—is correlated only with IL-6 levels. In these patients, higher serum IL-6 levels correspond to higher EPO doses. Figure 1 B). Conversely, the degree of anemia in patients with two copies of the minor allele was not correlated with serum IL-6 levels (B). TMPRSS6 A).

[0502] Similarly, in having TMPRSS6 In patients with at least one copy of the major allele at SNP rs855791, overall survival was associated with IL-6 levels only. Figure 2B In individuals with at least one copy of the rs855791 major allele, survival was inversely correlated with serum IL-6 levels, with patients at the highest IL-6 levels having statistically significantly worse survival rates than those at the lowest IL-6 levels. Figure 2A Conversely, overall survival in patients homozygous for the minor allele at rs855791 was not affected by IL-6 levels. TMPRSS6 ).

[0503] Not intending to be bound by theory, but having TMPRSS6 In patients with at least one copy of the major allele, increased serum IL-6 promotes increased hepatocelide expression, thereby increasing anemia. The increased risk of death is a consequence of dysregulation of iron metabolism, resulting anemia, and / or increased doses of erythropoiesis-stimulating agents (such as EPO). If these correlations reflect causality, they increase the likelihood that in patients with chronic kidney disease, reduced IL-6 levels or IL-6 signaling can reduce anemia, decrease the required EPO dose, and increase survival, but only in patients with... TMPRSS6 It has the greatest effect in patients with at least one copy of the major allele of rs855791, and in those with elevated serum IL-6 levels.

[0504] 5.12.2 Example 2: The risk of death and heart failure after acute myocardial infarction is only related to those with TMPRSS6Serum IL-6 levels in patients with at least one copy of the major allele of SNP rs855791 are associated with To determine in patients with acute illness rather than chronic illness Methods Whether the rs855791 genotype affects IL-6 sensitivity was investigated by combining newly identified SNP genotyping with data collected from previous clinical studies in patients hospitalized for acute coronary syndrome.

[0505] Results Data were analyzed from individuals previously enrolled in the multicenter study of Platelet Inhibition and Patient Outcomes (PLATO). Patients were eligible for PLATO if they were hospitalized for acute coronary syndrome (with symptomatic onset within the previous 24 hours). Mortality and the presence of heart failure were measured in these individuals starting 30 days after myocardial infarction.

[0506] TMPRSS6 against Figure 4 Death in individuals homozygous for the minor allele (A) of the rs855791 SNP is not associated with IL-6 variants. Figure 4 A). However, in response to elevated IL-6 levels in individuals following myocardial infarction, one or two copies of the major allele (G) confer higher mortality from various causes ( TMPRSS6 B). Therefore, TMPRSS6 Moderating the risk of IL-6-mediated death after myocardial infarction.

[0507] Measurements were also taken in individuals enrolled in PLATO starting 30 days after myocardial infarction. Figure 5 The effect of genotype on the risk of IL-6-mediated heart failure. Heart failure in individuals homozygous for the minor allele (A) was not associated with IL-6 variants. TMPRSS6 A). However, in response to elevated IL-6 levels in individuals following myocardial infarction, Figure 5 The G allele confers a higher rate of heart failure ( TMPRSS6 B). Therefore, Discussion Moderating the risk of IL-6-mediated heart failure after myocardial infarction.

[0508] ​ These data indicate TMPRSS6 The correlation between genotype, IL-6 levels, and adverse clinical outcomes is not limited to patients with chronic kidney disease. This is not intended to be a theoretical exercise, but rather to be applied in contexts where... TMPRSS6In patients with at least one copy of the major allele, increased serum IL-6 drives increased hepatocillin expression, followed by increased iron chelation in cardiomyocytes, and subsequently iron-mediated cytotoxicity. If these correlations reflect causality, they increase the likelihood that decreased IL-6 levels or IL-6 signaling may reduce heart failure and death in patients with acute coronary syndrome, but only in patients with... TMPRSS6 It has the greatest effect in patients with at least one copy of the major allele of rs855791, and in those with elevated serum IL-6 levels.

[0509] 5.12.3 Example 3: In vitro study confirming the presence of human cardiomyocytes derived from iPS cells TMPRSS6 Causal relationship between genotype and IL-6-mediated cytotoxicity Although the correlations observed in Examples 1 and 2 suggest that in the presence of TMPRSS6 At least one copy of the rs855791 major allele, elevated IL-6 levels, and decreased IL-6-mediated signal transduction should provide clinical benefit in patients with anemia or hepaxidine-mediated cytotoxicity, but the observed correlations do not prove causation. Therefore, experiments were conducted in cardiomyocytes derived from human induced pluripotent cells (iPS-CMs) to investigate the effects of BMP and BMP plus IL-6 on hepaxidine expression and cellular susceptibility to ischemic injury. TMPRSS6 Variant transfection.

[0510] 5.12.3.1 Method Culture of human iPS-derived cardiomyocytes iCell cardiomyocytes (Cellular Dynamics International, CDI Inc.) were plated onto 6-well or 96-well cell culture dishes coated with 0.1% gelatin-soaked iCell cardiomyocyte seeding medium (CDI Inc.). Forty-eight hours after seeding, the seeding medium was replaced with maintenance medium (CDI Inc.). The maintenance medium was changed every other day until the end of the experimental period.

[0511] Simulated ischemia / reoxygenation protocolAs previously reported, iPS cardiomyocytes were subjected to simulated ischemia (SI) for 90 min by replacing cell culture medium with "ischemic buffer" containing 118 mm NaCl, 24 mm NaHC03, 1.0 mm NaH2P04, 2.5 mm CaCl2-2H20, 1.2 mm MgCl2, 20 mm sodium lactate, 16 mm KC1, 10 mm 2-deoxyglucose (pH adjusted to 6.2) (Das, A., Xi, L., and Kukreja, K. C. (2005) J. Biol. Chem . 280: 12944-12955; Das A, Smolenski A, Lohmann SM, Kukreja RC. (2006) J. Biol Chem. 281(50):38644-52). Cells were incubated at 37°C in a 3-gas incubator with 1-2% 02and 5% C02throughout the SI period. Reoxygenation (RO) was achieved by replacing the ischemic buffer with normal cell culture medium under normoxic conditions. Cells were necrotic after 2 or 18 h of RO, respectively. As above, iCells were subjected to 4 h SI and 24 h RO.

[0512] Assessment of cell viability and apoptosis - Trypan blue exclusion assay was performed to analyze cell necrosis as previously reported (Das, A., Xi, L., and Kukreja, K. C. (2005) J. Biol. Chem . 280, 12944-12955; Das A, Smolenski A, Lohmann SM, Kukreja RC. (2006) J. Biol. Chem . 281(50):38644-52).

[0513] Transfection of iCell cardiomyocytes - On day 8 post-seeding, the medium was replaced with fresh maintenance medium and cells were incubated for 4 h. ViaFect Transfection Reagent (Promega Corp., Madison, WI) was used to transfect cells with pCMV6-XL5 TMPRSS6 (K523) or pCMV6-XL5 TMPRSS6 (K523) V763A according to the manufacturer's instructions. Forty-eight hours after transfection, cells were subjected to other experiments. TM - Trypan blue exclusion assay was performed to analyze cell necrosis as previously reported (Das, A., Xi, L., and Kukreja, K. C. (2005)

[0514] Western blot analysis - Western blotting was performed as previously described (Das, A., Xi, L., and Kukreja, K. C. (2005) J. Biol. Chem. 280, 12944-12955; Das A, Smolenski A, Lohmann SM, Kukreja RC. (2006) J. Biol. Chem . 281(50):38644-52). Total soluble protein was extracted from cells with lysis buffer (Cell Signaling, MA). The homogenate was centrifuged at 10,000 x g for 5 min at 4°C, and the supernatant layer was recovered. Protein (50 μg from each sample) was separated by 12% acrylamide gel and transferred to nitrocellulose membrane, and then blocked with 5% non-fat dry milk in TBST (10 mm Tris-HCl, pH 7.4, 100 mm NaCl, and 0.1% Tween 20) for 1 h. Subsequently, for each of the respective proteins, i.e., phospho-Beclin-1 (Ser93) (D9A5G) rabbit monoclonal, Beclin-1, SQSTM1 / p62, LC3A / B (D3U4C) XP® rabbit monoclonal, phospho-Akt (Ser473) (D9E) XP® rabbit monoclonal, Akt (pan) (C67E7) rabbit monoclonal, phospho-S6 ribosomal protein (Ser240 / 244) (D68F8) XP® rabbit monoclonal, S6 ribosomal protein (5G10) rabbit monoclonal (from Cell Signaling, MA), anti-tissue

[0515] Real-time PCR - Taqman assay- Total RNA including small RNA was isolated using the miRNeasy mini kit according to the manufacturer's protocol (QIAGEN Sciences, MD, USA). The concentration and purity of the isolated RNA were measured using a Nanodrop ND-1000 spectrophotometer (Agilent technologies, CA, USA). Briefly, 1 μg of total RNA was converted to cDNA using random hexamers with the High Capacity cDNA Synthesis Kit (Applied Biosystems, CA, USA). Reverse transcription reactions were performed using the following PCR conditions: 25°C for 10 min; 37°C for 120 min and 85°C for 5 min. Real-time PCR was performed using the TaqMan Assay specific probe (Applied Biosystems, CA, USA) for Hamp (CGGCTCTGCAGCCTTG) (SEQ ID NO: 20) under the following PCR cycle conditions: 95°C for 10 min; 95°C for 15 s and 60°C for 60 s. Expression of Hamp was normalized to the GAPDH (CTTCCAGGAGCGAGATCCCGCTAA) (SEQ ID NO: 21) housekeeping gene. Relative gene expression was analyzed using the 2-ΔΔCt method.

[0516] TMPRSS6 mutation induction and transfection of iPS cells- pCMV6-XL5 TMPRSS6 was purchased from Origene Technologies (Rockville, MD) Cat# SC306623, corresponding to GenBank Accession Number NM_153609. This clone contains a mutation that causes an amino acid change, K253A. A site-directed mutagenesis was performed to revert the amino acid at position 253 to the typical lysine (K). After confirmation of the reversion, a site-directed mutagenesis was performed to introduce the V736A mutation. All mutagenesis reactions were performed using the Agilent Technologies QuikChange II XL Site-Directed Mutagenesis Kit (Santa Clara, CA; Cat# 200521). All vectors were sequenced for confirmation. The primer sequences used were: antisense (as) TMPRSS6 E253K GCATGAGGTCCTTGGGGCCCTGCAG (SEQ ID NO: 22); sense (s) TMPRSS6 E253K CTGCAGGGCCCCAAGGACCTCATGC (SEQ ID NO: 23); antisense (as) TMPRSS6 V736A CCTGGTAGCGATAGGCCTCGCTGCACAGG (SEQ ID NO: 24); sense (s) TMPRSS6 V736A CCTGTGCAGCGAGGCCTATCGCTACCAGG (SEQ ID NO: 25).

[0517] 5.12.3.2 Results Human iPS-CMs expressed only minimally mesplasm-2 at baseline. Following the homozygous major and homozygous minor allele myocytes, respectively, cells were transfected with constructs that promote constitutive expression of: TMPRSS6 mesplasm-2 736A encoded by the major allele of the rs855791 SNP or mesplasm-2 736V encoded by the minor allele.

[0518] Hepcidin expression is regulated by the BMP6 / SMAD and IL-6 / STAT signaling pathways, where both BMP and IL-6 act via their respective receptors to promote increased hepcidin expression. Casanovas et al, PLOS Comp. Biol.10(1):e1003421 (2014). In vitro treatment of major and minor allele iPS cardiomyocytes with agonists of the signal transduction pathway—recombinant BMP2 and IL-6—or BMP2 agonists alone, to model a clinical intervention with reduced IL-6 levels (or signal transduction). Control iPS cells were not treated with agonists. Cell death rate was measured under normal oxygen tension (noroxic) and under simulated hypoxia followed by simulated reoxygenation (reperfusion).

[0519] Figure 6A This shows the results when cells are treated under normal oxygen conditions. Only [the following is expressed]: TMPRSS6 iPS cardiomyocytes expressing the rs855791 minor allele (“736V minor allele”) were not significantly affected by elimination of IL-6 signaling (“ns”): Cell death as a percentage of trypan blue-positive cells was not significantly reduced when cells were treated with BMP2 compared to treatment with BMP2 + IL-6. Conversely, cell death was significantly reduced when IL-6 signaling was eliminated. TMPRSS6 iPS cardiomyocytes with the major allele of rs855791 showed statistically significantly lower cell death.

[0520] Figure 6B This demonstrates the results when cells undergo hypoxia followed by reoxygenation. Compared to normoxic conditions, hypoxia / reoxygenation is significantly toxic to iPS cardiomyocytes, with approximately 40% of major and minor allele control cells being killed (compared to approximately 20% of control cells under normoxic conditions). Figure 6B and Figure 6A (In comparison). Relative to this increased background toxicity, minor allele iPS cardiomyocytes were not significantly affected by the elimination of IL-6 signaling: cell death was not significantly reduced when cells were treated with BMP2 alone compared to treatment with BMP2+IL-6. Conversely, when IL-6 signaling was eliminated, expression... TMPRSS6 iPS cardiomyocytes with the major allele of rs855791 showed statistically significantly lower cell death.

[0521] 5.12.3.3 Discussion These data reinforce the inferences drawn from the hoc analysis following the clinical trial data from Examples 1 and 2: a reduction in IL-6 signaling transduction can effectively reduce expression. TMPRSS6IL-6 mediated toxicity in cardiomyocytes of rs855791 major allele homozygotes, but not in cardiomyocytes expressing only the minor allele. Without intending to be bound by theory, the increased IL-6 in the major allele iPS cardiomyocytes can result from IL-6 mediated increase in hepcidin expression, followed by increased iron sequestration in the cells, followed by iron mediated cellular toxicity.

[0522] 5.12.4 Example 4: In a rat model of cardiorenal syndrome in rats genotypically similar to humans homozygous for the rs855791 major allele, anti-IL-6 therapy is effective as current standard of care TMPRSS6 rs855791 major allele homozygotes, anti-IL-6 therapy is effective as current standard of care Patients with chronic kidney disease, such as those enrolled in the MIMICK study analyzed in Example 1, often suffer from impaired cardiac function, which is a major contributor to mortality. This secondary cardiac injury after primary chronic kidney disease is termed cardiorenal syndrome type 4 (CRS4).

[0523] To test whether anti-IL-6 therapy is effective in treating CRS4 patients with at least one copy of the rs855791 major allele, as suggested by the data in Examples 1 and 3, we used a rat model of CRS4 that is genotypically similar to humans homozygous for the rs855791 major allele. TMPRSS6 rs855791 major allele homozygotes, anti-IL-6 therapy is effective as current standard of care TMPRSS6 rs855791 major allele homozygotes, anti-IL-6 therapy is effective as current standard of care

[0524] Figure 7 The study design is outlined.

[0525] At week 0, myocardial infarction is induced in the CRS animals. At week 2, nephrectomy is performed. The control group is instead subjected to sham surgery. Prior to nephrectomy, the individuals are assessed. The assessments include measurement of serum creatinine, glomerular filtration rate, 24 hour protein content in urine, echocardiogram, tail cuff blood pressure, and biomarkers in plasma and urine.

[0526] Treatment begins at day 1 after nephrectomy. The animals are divided into three groups: (i) control treatment, (ii) anti-IL-6 therapy, and (iii) standard of care therapy. The anti-IL-6 therapy is an anti-IL-6 antibody suitable for use in rodents. The standard of care therapy is administration of perindopril, an ACE (angiotensin converting enzyme) inhibitor. At the start of treatment, the individuals in all groups are assessed. The assessments include measurement of serum creatinine, glomerular filtration rate, 24 hour protein content, and biomarkers in plasma.

[0527] Individuals in all groups were evaluated at day 3 and day 7 post-nephrectomy. Evaluations included measurement of serum creatinine and plasma biomarkers at day 3, and measurement of serum creatinine, glomerular filtration rate, 24-hour protein content, echocardiogram, blood pressure, and plasma biomarkers at day 7.

[0528] Individuals in all groups were evaluated prior to sacrifice at week 6. Evaluations included measurement of serum creatinine, glomerular filtration rate, 24-hour protein content, blood pressure, plasma biomarkers, echocardiogram, and pressure-volume loop analysis. Following sacrifice, tissues were also collected from individuals in all groups for histological evaluation (i.e., Sirius Red staining of heart tissue).

[0529] Figures 8A-8D Cardiac ejection fraction is shown for rats without CRS ("sham"), CRS animals treated with a pharmacologically unrelated isotype control antibody ("isotype"), CRS animals treated with anti-IL-6 antibody ("IL-6 ab"), and CRS animals treated with a standard-of-care ACE inhibitor ("Peri") in a cardiorenal syndrome model summarized in Figure 7

[0530] Figure 8A Baseline ejection fraction levels for all groups are shown two weeks post-myocardial infarction but prior to nephrectomy and treatment, indicating that the experimentally induced myocardial infarction significantly reduced cardiac ejection fraction. Figure 8B A plot of ejection fraction levels for all groups one week post-nephrectomy, one week post-treatment is shown. Figure 8C A plot of ejection fraction levels for all groups two weeks post-nephrectomy, two weeks post-treatment is shown. Figure 8D A plot of ejection fraction levels for all groups four weeks post-nephrectomy, four weeks post-treatment is shown. Results are expressed as mean + / - SEM.

[0531] Both treatment groups - the group treated with anti-IL-6 and the group treated with standard-of-care ACE inhibitor therapy - showed statistically significant increases in ejection fraction levels compared to the isotype control group ( Figure 8D ) (p < 0.001) four weeks post-treatment. Similar ejection fraction levels in the anti-IL-6 and standard-of-care groups measured four weeks post-treatment show that anti-IL-6 therapy has equivalent efficacy to ACE inhibitor perindopril (standard-of-care therapy), indicating that anti-IL-6 therapy has equivalent therapeutic efficacy to standard-of-care therapy in preserving cardiac function in a cardiorenal syndrome model as measured by changes in cardiac ejection fraction.

[0532] Measurements of cardiac contractility ( Figure 9 ​) also had an effect equivalent to the standard of care therapy using an ACE inhibitor. After 4 weeks of treatment, the myocardial contractility of the groups treated with anti-IL-6 and standard of care therapy was significantly increased over the myocardial contractility of the control, isotype group. The similar myocardial contractility in the anti-IL-6 and standard of care groups indicates that anti-IL-6 therapy has an efficacy equivalent to the ACE inhibitor perindopril (standard of care therapy) in preserving cardiac function in the heart failure model.

[0533] Fibrosis measurements of heart tissue collected from animals in all groups also demonstrate that anti-IL-6 therapy has an effect equivalent to the standard of care therapy Figures 10A-10C ). Fibrosis in heart tissue was quantified by measuring the percent area of fibrotic tissue in two regions: the "normal" region and the "fibrosis border" region. The "normal" region is indicated by the delineated portion of the tissue section shown in the micrograph Figure 10A . The inset in the micrograph shows a magnified view of the "normal" region, showing that a small portion of the "normal" region has fibrotic tissue. The "fibrosis border" region is the region of tissue in the "normal" region surrounding the fibrotic tissue.

[0534] Figure 10B and the plots in 10C show that the heart tissue from individuals in the groups treated with anti-IL-6 or standard of care therapy has a significantly reduced percent area of fibrotic tissue compared to the isotype control group, when measured in the "normal" region Figure 10B or in the "fibrosis border" region Figure 10C . In addition, the percent area of fibrotic tissue measured in the anti-IL-6 and standard of care therapy groups was similar (both in the "normal" region and the "fibrosis border" region), indicating that anti-IL-6 has an anti-fibrotic effect equivalent to the ACE inhibitor perindopril (standard of care therapy).

[0535] These data indicate that treatment with an anti-IL-6 agent effectively reduces cardiac injury and restores function in an in vivo model of heart failure in animals that are genotypically similar to humans TMPRSS6 homozygous for the major allele of rs855791.

[0536] 5.12.5 Example 5: Anti-IL-6 therapy is effective in preserving cardiac function in an acute myocardial infarction model in mice that are genotypically similar to humans TMPRSS6 homozygous for the major allele of rs855791. The data in Examples 2 and 3 indicate that reduced IL-6 levels or IL-6 signaling can reduce heart failure and death in patients with acute coronary syndrome, but only in patients that are homozygous for the major allele of rs855791. TMPRSS6Those patients with at least one copy of the rs855791 major allele, and those patients with elevated serum IL-6 levels, had the greatest effect.

[0537] Rodent studies were performed to determine the effect of anti-IL-6 therapy in mice that are genotypically similar to humans who are TMPRSS6 The effect of anti-IL-6 therapy after acute myocardial infarction in mice that are homozygous for the rs855791 major allele, and humans.

[0538] Figure 11A and 11B Data from in vivo models were presented in which myocardial infarction was induced in mice that are genotypically similar to humans who are TMPRSS6 Data from in vivo models were presented in which myocardial infarction was induced in mice that are genotypically similar to humans who are Figure 11A Treatment with anti-IL-6 was shown to provide a statistically significant improvement in ejection fraction. Figure 11B Treatment with anti-IL-6 was shown to provide a statistically significant improvement in contractility, measured as fractional shortening. The data demonstrate that anti-IL-6 therapy given immediately after myocardial infarction improves the functional recovery of the left ventricle in rodents that are genotypically similar to humans who are TMPRSS6 Functional recovery of the left ventricle in rodents that are genotypically similar to humans who are homozygous for the rs855791 major allele.

[0539] 6. incorporated by reference All publications, patents, patent applications and other documents cited in this application are hereby incorporated by reference in their entireties for all purposes to the same extent as if each individual publication, patent, patent application or other document were specifically and individually indicated to be incorporated by reference for all purposes.

[0540] 7. Equivalents While various specific embodiments have been illustrated and described, the foregoing specification is inclusive of all specific embodiments and only illustrative of the generic inventive concepts. Many variations, modifications and alternative implementations will occur to those skilled in the art without departing from the spirit and scope of the application. Many alternatives, modifications, and variations will be apparent to those skilled in the art in view of the foregoing disclosure.

Claims

1. A method for treating hepcidin-mediated conditions, comprising: Administer a therapeutically effective dose of an IL-6 antagonist to patients with heptacil-mediated disease. The patient has been identified as having TMPRSS6 At least one copy of the major allele of rs855791.

2. The method of claim 1, wherein the patient has been previously determined to have the [condition / condition]. TMPRSS6 At least one copy of the major allele of rs855791.

3. The method of claim 1, further comprising the following earlier steps: The patient was determined to have this TMPRSS6 At least one copy of the major allele of rs855791.

4. The method of any one of claims 1 to 3, wherein the patient has elevated pre-treatment serum IL-6 levels.

5. The method of any one of claims 1 to 4, wherein the patient has elevated pre-treatment serum CRP levels.

6. The method of any one of claims 1 to 5, wherein the condition mediated by the hepazidine is chronic anemia.

7. The method of claim 6, wherein the patient is male and has a pre-treatment heme (Hb) level of less than 14 g / dl.

8. The method of claim 7, wherein the patient's pre-treatment Hb level is less than 13 g / dl.

9. A method for improving the treatment of hepazilidine-mediated diseases, the method comprising: Discontinuing the administration of IL-6 antagonists to patients with hepaxidine-mediated disease It has been determined that the patient is... TMPRSS6 The minor allele of rs855791 is homozygous.

10. A method for treating IL-6-mediated inflammatory conditions in patients without chronic inflammatory anemia, comprising: Administer therapeutically effective doses of IL-6 antagonists to patients without anemia suffering from IL-6-mediated inflammatory conditions. The patient has been identified as having TMPRSS6 At least one copy of the major allele of rs855791.

Images