Application of OsHTT9 gene in improving tolerance and / or yield of rice to high temperature stress

Abstract

The invention discloses application of an OsHTT9 gene in improving tolerance and / or yield of rice to high temperature stress. According to the invention, overexpression recombinant plasmids of the OsHTT9 gene are utilized to transform rice calluses, and high-temperature stress is carried out on the constructed OsHTT9 gene overexpression transgenic rice strain, so that the overexpression of the OsHTT9 gene in rice can improve the tolerance and yield of rice to high-temperature stress, and particularly, compared with a wild-type control, the overexpression of the OsHTT9 gene in rice can improve the yield of rice to high-temperature stress. A rice line of the overexpression OsHTT9 gene is better in pollen fertility, and is higher in single plant weight, grain number per ear and maturing rate. Therefore, the invention provides the application of the OsHTT9 gene in improving the tolerance and / or yield of the rice to high temperature stress, which is beneficial to reducing the influence of high temperature on the growth and development of the rice and ensuring the yield of the rice.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and rice seed and seedling cultivation or improvement technology. More specifically, it relates to... OsHTT9 Application of genes in improving rice's tolerance to high temperature stress and / or yield. Background Technology

[0002] Rice ( Rice Rice (L.) is one of the world's three major food crops, and its growth and development are highly sensitive to temperature changes. Especially during the booting, heading, flowering, and grain-filling stages, high-temperature stress (sustained exposure to temperatures above 35°C) significantly reduces the grain-filling rate of rice, severely impacting yield. The frequent occurrence of high temperatures due to global climate change poses a severe challenge to rice production. Therefore, improving rice's tolerance to high-temperature stress and ensuring stable yields under extreme high-temperature conditions has become a key focus of current agricultural technology research.

[0003] Currently reported genes or proteins for improving rice's tolerance to heat stress are mostly concentrated on HSP (heat shock protein) and HSFA1 (heat shock transcription factor A1). While some can improve rice's tolerance to heat stress, they may not simultaneously increase yield, failing to achieve the dual goal of improving both heat tolerance and high yield. Therefore, it is still necessary to explore genetic resources that can improve rice's tolerance to heat stress and yield. Summary of the Invention

[0004] This invention addresses the shortcomings of the prior art by providing... OsHTT9 Application of genes in improving rice's tolerance to high temperature stress and / or yield.

[0005] The first object of the present invention is to provide OsHTT9 Application of genes or their encoded proteins in improving rice's tolerance to high-temperature stress and / or yield.

[0006] The second object of the present invention is to provide OsHTT9 Application of genes or their encoded proteins in the breeding of rice varieties that are tolerant to high-temperature stress and / or have increased yields.

[0007] The third object of the present invention is to provide OsHTT9 Application of gene overexpression recombinant plasmids in improving rice tolerance to high temperature stress and / or yield.

[0008] The fourth object of the present invention is to provide a product containing OsHTT9 Application of recombinant bacteria with gene overexpression recombinant plasmids in improving rice tolerance to high temperature stress and / or yield.

[0009] The fifth object of the present invention is to provide OsHTT9Application of gene overexpression recombinant plasmids in breeding rice varieties with high temperature stress tolerance and / or increased yield.

[0010] The sixth object of the present invention is to provide a product containing OsHTT9 Application of recombinant bacteria with gene overexpression recombinant plasmids in breeding rice varieties with high temperature stress tolerance and / or increased yield.

[0011] A seventh objective of this invention is to provide a method for improving the tolerance and / or yield of rice to high-temperature stress.

[0012] The above-mentioned objective of this invention is achieved through the following technical solution: This invention utilizes OsHTT9 Gene overexpression recombinant plasmids were transformed into rice callus tissue, and the constructed callus tissue was subjected to... OsHTT9 High-temperature stress experiments on transgenic rice lines with overexpressed genes revealed that, compared to the wild-type control, [they showed better performance]. OsHTT9 Transgenic rice lines with overexpressed genes exhibit better pollen fertility, higher single-plant weight, more grains per panicle, and higher seed setting rate, indicating that overexpression in rice... OsHTT9 Genes can improve rice's tolerance to high-temperature stress and its yield. Therefore, this invention seeks protection. OsHTT9 Application of genes or their encoded proteins in improving rice's tolerance to high-temperature stress and / or yield.

[0013] This invention also claims protection. OsHTT9 Application of genes or their encoded proteins in the breeding of rice varieties that are tolerant to high-temperature stress and / or have increased yields.

[0014] Specifically, the application is achieved by overexpressing the [specific ingredient] in rice. OsHTT9 This is achieved by genes or the proteins they encode.

[0015] Specifically, the OsHTT9 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.3.

[0016] In a specific embodiment of the present invention, the OsHTT9 The gDNA sequence of the gene is shown in SEQ ID NO.1.

[0017] In a specific embodiment of the present invention, the OsHTT9 The cDNA sequence of the gene is shown in SEQ ID NO.2.

[0018] This invention also claims protection. OsHTT9 Application of gene overexpression recombinant plasmids in improving rice tolerance to high temperature stress and / or yield.

[0019] This invention also claims protection for containing OsHTT9Application of recombinant bacteria with gene overexpression recombinant plasmids in improving rice tolerance to high temperature stress and / or yield.

[0020] This invention also claims protection. OsHTT9 Application of gene overexpression recombinant plasmids in breeding rice varieties with high temperature stress tolerance and / or increased yield.

[0021] This invention also claims protection for containing OsHTT9 Application of recombinant bacteria with gene overexpression recombinant plasmids in breeding rice varieties with high temperature stress tolerance and / or increased yield.

[0022] Specifically, the OsHTT9 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.3.

[0023] Specifically, the OsHTT9 The gDNA sequence of the gene is shown in SEQ ID NO.1.

[0024] Specifically, the OsHTT9 The cDNA sequence of the gene is shown in SEQ ID NO.2.

[0025] Optionally, the OsHTT9 The overexpression recombinant plasmid of the gene was created by inserting the gene into the pCambia1300-pOX vector. OsHTT9 The cDNA sequence of the gene was obtained. The pCambia1300-pOX vector was obtained by modifying the pCambia1300 vector by inserting the maize ubiquitin gene promoter (Pubi) after the promoter P35s.

[0026] This invention also provides a method for improving the tolerance and / or yield of rice to high temperature stress, the method comprising: overexpressing in rice... OsHTT9 Genes or the proteins they encode.

[0027] Specifically, the OsHTT9 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.3.

[0028] Specifically, the OsHTT9 The gDNA sequence of the gene is shown in SEQ ID NO.1.

[0029] Specifically, the OsHTT9 The cDNA sequence of the gene is shown in SEQ ID NO.2.

[0030] Optionally, the overexpression in rice OsHTT9 The method for constructing the gene or its encoded protein is as follows: OsHTT9Gene overexpression recombinant plasmids were transferred into rice.

[0031] Specifically, construct the OsHTT9 The gene overexpression recombinant plasmid was transferred into Agrobacterium and then transformed into rice callus using Agrobacterium-mediated genetic transformation.

[0032] Optionally, the Agrobacterium is Agrobacterium EHA105.

[0033] Specifically, the rice described in the above-mentioned applications or methods of the present invention is indica rice.

[0034] In a specific embodiment of the present invention, the rice is the indica rice variety Nan Guizhan.

[0035] Specifically, the improvement of rice's tolerance to high temperature stress refers to improving the tolerance of rice during the booting stage to high temperature stress.

[0036] Specifically, the increased rice yield is achieved by increasing the weight of individual rice plants, the number of grains per panicle, and the seed setting rate. Therefore, this invention also claims protection. OsHTT9 Application of genes or their encoded proteins in increasing rice plant weight, number of grains per panicle, and / or seed setting rate.

[0037] This invention also claims protection. OsHTT9 Recombinant plasmids that overexpress genes or contain OsHTT9 Application of recombinant bacteria with gene overexpression recombinant plasmids in improving rice plant weight, number of grains per panicle, and / or seed setting rate.

[0038] The present invention has the following beneficial effects: This invention utilizes OsHTT9 Gene overexpression recombinant plasmids were transformed into rice callus tissue, and the constructed callus tissue was subjected to... OsHTT9 High-temperature stress experiments on transgenic rice lines with overexpressed genes revealed that overexpression was observed in rice. OsHTT9 The gene can improve rice's tolerance to high-temperature stress and yield, specifically by overexpressing it compared to the wild-type control. OsHTT9 The rice lines with this gene exhibit better pollen fertility, higher single-plant weight, more grains per panicle, and higher seed setting rate. Therefore, this invention provides... OsHTT9 Application of genes in improving rice's tolerance to high-temperature stress and / or yield. This invention helps reduce the impact of high temperatures on rice growth and development, thus ensuring rice yield. Attached Figure Description

[0039] tú1 A schematic diagram of the pCambia1300-pOX vector used to construct the overexpression recombinant plasmid.

[0040] tú2For wild-type control (NGZ) and overexpression transgenic lines OEHTT9-1 and OEHTT9-2 OsHTT9 qPCR results of the gene; *** in the figure P <0.001.

[0041] tú3 To determine the differences in seedling growth rates of wild-type NGZ, overexpression transgenic lines OEHTT9-1, and OEHTT9-2 after different durations of high-temperature stress (0, 6, and 12 h). OsHTT9 Gene expression status.

[0042] tú4 The heading results of wild-type NGZ, overexpression transgenic lines OEHTT9-1 and OEHTT9-2 after being subjected to high temperature stress during the booting stage.

[0043] tú5 The figures show the pollen fertility of wild-type NGZ, overexpression transgenic lines OEHTT9-1 and OEHTT9-2 after high-temperature stress treatment during the heading stage; Figure A shows the results of potassium iodide staining of pollen florets after heading, and Figure B shows the statistical results of pollen fertility. P <0.001.

[0044] tú6 The results of reactive oxygen species staining on leaves at the heading stage after high temperature stress treatment during the booting stage of wild-type NGZ, overexpression transgenic lines OEHTT9-1 and OEHTT9-2 were performed; A in the figure is the NBT staining result, and B is the DAB staining result.

[0045] tú7 The figures show the hydrogen peroxide content in leaves at the heading stage after wild-type NGZ, overexpression transgenic lines OEHTT9-1, and OEHTT9-2 were subjected to high-temperature stress during the booting stage; P <0.05.

[0046] tú8 The figures show the yield traits of wild-type NGZ, overexpression transgenic lines OEHTT9-1 and OEHTT9-2 after high-temperature stress treatment during the booting stage; Figure A shows the per-plant weight of each line; Figure B shows the number of grains per panicle of each line; and Figure C shows the seed setting rate of each line. P <0.05; P<0.001. Detailed Implementation

[0047] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0048] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0049] Example 1 Construction OsHTT9 Gene overexpression recombinant plasmid The present invention OsHTT9 The gDNA sequence of the gene is shown in SEQ ID NO.1, and its cDNA sequence is shown in SEQ ID NO.2. OsHTT9 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.3.

[0050] This invention constructs OsHTT9 The process of gene overexpression recombinant plasmids is as follows: 1. OsHTT9 Cloning of gene cDNA sequences This invention is designed for cloning OsHTT9 The nucleotide sequences of the primers (5'-3') used for the gene cDNA sequence are shown below: OsHTT9 F: GGGTACCGGCGCGCCAAGCTTatgtgggtggcggagcgggt; OsHTT9 R: ATCTTTGTAGTCCATACGCGTcgtagaagtagtcttcatgg.

[0051] Total RNA was extracted from the leaves of rice seedlings of *Nanguizhan* and its purity and concentration were determined. 1 μg of total RNA meeting the experimental requirements was used for initiating a reverse transcription reaction to convert the extracted total RNA into cDNA. The enzyme used for the reverse transcription reaction was AMV reverse transcriptase from TAKARA, and the procedure was followed according to the instructions for use of the reverse transcriptase. Using the cDNA obtained from reverse transcription as a template, primers were used... OsHTT9 F and OsHTT9R was used for PCR amplification. The polymerase used in the PCR amplification reaction was Toyobo's KOD FX. The amplification reaction system was prepared according to the KOD FX instruction manual, and the reaction conditions were: 94℃ for 3 min; 94℃ for 30 sec, 60℃ for 30 sec, 68℃ for 150 sec, 35 cycles; 68℃ for 5 min. The PCR amplification products were detected by electrophoresis and sequenced. The sequencing results showed that the present invention successfully cloned... OsHTT9 Gene cDNA sequence.

[0052] 2. OsHTT9 Construction of recombinant plasmids for gene overexpression Gel extraction and recovery of PCR amplification OsHTT9 The cDNA sequence of the gene, using restriction endonucleases Hin d III and Bam HI respectively for OsHTT9 The cDNA sequence of the gene and the pCambia1300-pOX vector (this vector was modified from the pCambia1300 vector by inserting the maize ubiquitin gene promoter (Pubi) after the promoter P35s, and its structural diagram is shown in the figure). tú1 (As shown) The enzyme was digested and the digestion product was recovered; the digested fragment was ligated with homologous recombinase. The ligation system was: 5 μL homologous recombinase, digested fragment... OsHTT9 3 μL (200 ng) of the gene cDNA fragment and 2 μL (50 ng) of the linearized pCambia1300-poX vector were ligated at 50 ℃ for 5 min. 10 μL of the ligation product was then transformed into E. coli DH5α competent cells using the heat shock transformation method. The transformation product was plated on LB solid medium containing kanamycin resistance. After incubation at 37 ℃ overnight, 10 single clones were selected for plasmid extraction, restriction enzyme digestion, and sequencing identification.

[0053] The enzyme digestion and sequencing results confirm that the present invention has successfully constructed... OsHTT9 Gene overexpression recombinant plasmids, used to construct overexpression... OsHTT9 Genetically modified rice.

[0054] Example 2 Construction OsHTT9 Transgenic rice lines with overexpression of genes This invention utilizes an Agrobacterium EHA105-mediated genetic transformation method to transform identified... OsHTT9 Gene overexpression recombinant plasmids were transferred into callus tissue of wild-type indica rice variety Nanguizhan (NGZ) to construct [a gene expression structure]. OsHTT9Transgenic rice lines overexpressing the gene were established. The genetic transformation method was performed according to the method described in the literature (Zhou Lingyan, Jiang Dagang, Wu Hao, et al. Establishment of a rice transformation system based on TAC vector [J]. Acta Genetica Sinica, 2005, 32(005):514-518.). After screening, pre-differentiation, differentiation, PCR, and quantitative real-time PCR detection, T0 generation positive transformed plants were obtained.

[0055] The nucleotide sequences of the primers (5'-3') used for PCR detection are shown below: Primer 1: GACAGCGGTCTCCGACCTGAT; Primer 2: CATCGCCTCGCTCCAGTCAAT.

[0056] The PCR reaction system is shown in Table 1 below: Table 1 PCR reaction system

[0057] The PCR reaction conditions were: 94 ℃ for 2 min; 94 ℃ for 20 sec, 58 ℃ for 20 sec, 72 ℃ for 30 sec, 30 cycles; 72 ℃ for 5 min.

[0058] After the PCR reaction is completed, the PCR amplification products are detected by 1% agarose gel electrophoresis. If a single band of about 600 bp is amplified, the sample is a positive transformed plant.

[0059] The obtained T0 generation positive transformants were self-pollinated to obtain transgenic 1 (T1) generation lines. Ten plants from each line that tested positive for PCR were selected for self-pollination to obtain T2 generation lines. The T2 generation lines were then subjected to PCR testing to obtain T2 generation homozygous lines derived from different T0 generation plants. OsHTT9 Two transgenic lines that overexpressed the gene were named OEHTT9-1 and OEHTT9-2, respectively.

[0060] Total RNA was extracted from the flag leaves of overexpressing transgenic lines OEHTT9-1 and OEHTT9-2 at flowering stage and reverse transcribed to obtain cDNA. The obtained cDNA was then used as a template for qPCR detection. OsHTT9 Changes in gene expression were measured using wild-type NGZ plants as a control (wild-type control). The nucleotide sequences of the primers (5'-3') used for qPCR detection are shown below: Primer F: CAAGCCGTGTGGGAAGTTTG; Primer R: GGGTGGAGCAACCCTAGTTC.

[0061] Internal reference primer F: CACATTCCAGCAGATGTGGA; Internal reference primer R: GCGATAACAGCTCCTCTTGG.

[0062] The qPCR reaction system and conditions are shown in Tables 2 and 3 below: Table 2 qPCR reaction system

[0063] Table 3 qPCR reaction conditions

[0064] Wild-type control and overexpression transgenic lines OEHTT9-1 and OEHTT9-2 OsHTT9 The results of qPCR detection of the gene are as follows tú2 As shown. By tú2 It can be seen that genes OsHTT9 The expression was high in the overexpression transgenic lines OEHTT9-1 and OEHTT9-2, and low in the wild-type control, with a highly significant difference in expression levels between the two, indicating that the present invention has successfully constructed the transgenic line. OsHTT9 overexpression of genes in transgenic rice homozygous lines.

[0065] Example 3: Identification of the tolerance and yield traits of overexpression transgenic lines to high temperature stress. To analyze overexpression OsHTT9 This invention investigated the effects of genes on rice's tolerance to high-temperature stress and yield. Wild-type NGZ and overexpression transgenic lines OEHTT9-1 and OEHTT9-2 were subjected to high-temperature stress treatment at the seedling and booting stages. The effects of different durations of high-temperature stress on seedling rice were detected by qPCR. OsHTT9 Gene expression was analyzed. Phenotypic changes in rice plants before and after high-temperature stress treatment during the booting stage were compared. Heading behavior was observed after high-temperature stress treatment, pollen fertility was assessed, and reactive oxygen species (NBT and DAB staining) and hydrogen peroxide (H2O2) content were detected in leaves during the heading stage (using the Beyotime Hydrogen Peroxide Content Detection Kit (catalog number: S0038); see the kit instructions for specific procedures). Rice plants were cultured to maturity, and seeds were harvested for yield trait analysis (single plant weight, number of grains per panicle, and seed setting rate were recorded).

[0066] 1. Treatment of high temperature stress during the seedling stage Several plump seeds of wild-type NGZ, overexpression transgenic lines OEHTT9-1 and OEHTT9-2 were selected, soaked in water, and then transferred to 96-well plates for hydroponics after germination. After reaching the booting stage, booting plants with uniform growth were selected for high-temperature stress treatment. The high-temperature stress treatment conditions during the seedling stage were set as follows: 45 ℃, 12 h light / 12 h dark. Samples were taken and RNA was extracted at 0, 6 and 12 h, and qPCR detection was performed as in Example 2.

[0067] After different durations of high-temperature stress during the seedling stage, wild-type NGZ, overexpression transgenic lines OEHTT9-1 and OEHTT9-2 showed varying degrees of improvement. OsHTT9 Gene expression status, such as tú3 As shown. By tú3 It can be seen that, OsHTT9 The expression level of the gene increased significantly after 6 h of high temperature stress, indicating that OsHTT9 can respond to high temperature environment, and also indicating that 6 h is the key to regulating the heat tolerance of rice seedlings.

[0068] 2. Treatment of high temperature stress during the booting stage Several plump seeds of wild-type NGZ, overexpression transgenic lines OEHTT9-1 and OEHTT9-2 were selected, soaked in water, and then transferred to 96-well plates for hydroponics after germination. After reaching the booting stage, booting plants with uniform growth were selected for high-temperature stress treatment. The conditions for high-temperature stress treatment during the booting stage were set as follows: 38 ℃ during the day and 34 ℃ at night, with a treatment time of 10 days. After high-temperature treatment, the plants were placed at 28 ℃ for recovery, with a recovery time of 5 days.

[0069] The heading behavior of wild-type NGZ, overexpression transgenic lines OEHTT9-1 and OEHTT9-2 after high temperature stress treatment during the booting stage is as follows: tú4 As shown. By tú4 It can be seen that, compared with the wild-type control, the overexpression transgenic lines OEHTT9-1 and OEHTT9-2 during the booting stage produced significantly more panicles after being treated with high temperature stress, while the wild-type NGZ was inhibited by high temperature and did not produce any panicles.

[0070] The pollen fertility of wild-type NGZ, overexpression transgenic lines OEHTT9-1 and OEHTT9-2 after high temperature stress treatment during the booting stage is as follows: tú5 As shown; tú5 In the diagram, A represents the potassium iodide staining results of pollen from the florets after heading, and B represents the statistical results of pollen fertility. tú5 It can be seen that, compared with the wild-type control, the pollen staining of the overexpressing transgenic lines OEHTT9-1 and OEHTT9-2 during the booting stage was relatively normal after being treated with high temperature stress, the fertility statistics were significantly improved, and they maintained high pollen activity and were able to set fruit.

[0071] The results of reactive oxygen species staining on leaves at the heading stage after high temperature stress treatment during the booting stage of wild-type NGZ, overexpression transgenic lines OEHTT9-1 and OEHTT9-2 are as follows: tú6 As shown; tú6 In the diagram, A represents the NBT staining result, and B represents the DAB staining result. tú6 It can be seen that, compared with the wild-type control, the reactive oxygen species (ROS) levels of the overexpressing transgenic lines OEHTT9-1 and OEHTT9-2 during the booting stage were significantly lighter after high-temperature stress treatment, suggesting that their ROS levels were low.

[0072] The hydrogen peroxide content in leaves at the heading stage after high temperature stress treatment during the booting stage of wild-type NGZ, overexpression transgenic lines OEHTT9-1 and OEHTT9-2 is as follows: tú7 As shown. By tú7 It can be seen that before the high temperature stress treatment, the hydrogen peroxide content in the leaves of the overexpression transgenic lines was not significantly different from that of the wild-type control. However, after the high temperature stress treatment, the hydrogen peroxide content in the leaves of the overexpression transgenic lines was significantly lower than that of the wild-type, indicating that the overexpression transgenic lines are more tolerant to high temperature stress.

[0073] The yield trait analysis results of wild-type NGZ, overexpression transgenic lines OEHTT9-1 and OEHTT9-2 after high temperature stress treatment during the booting stage are as follows: tú8 As shown; tú8 In the table, A represents the statistical results of the single plant weight for each line; B represents the statistical results of the statistical results of the number of grains per ear for each line; and C represents the statistical results of the statistical results of the seed setting rate for each line. tú8 It can be seen that overexpression OsHTT9 Genes can significantly increase the weight of a single rice plant, the number of grains per panicle, and the seed setting rate, thereby increasing rice yield.

[0074] The above results indicate that overexpression OsHTT9 The gene can significantly improve rice's tolerance to high-temperature stress and increase rice yield, while reducing the impact of high-temperature stress on rice yield.

[0075] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. OsHTT9 The application of a gene or its encoded protein in improving the tolerance and / or yield of rice to high-temperature stress is characterized by, The OsHTT9 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

2. OsHTT9 The application of a gene or its encoded protein in the breeding of rice varieties with high tolerance to heat stress and / or increased yield is characterized by, The OsHTT9 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

3. OsHTT9 The application of gene overexpression recombinant plasmids in improving rice's tolerance to high-temperature stress and / or yield is characterized by, The OsHTT9 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

4. Contains OsHTT9 The application of recombinant bacteria with gene overexpression recombinant plasmids in improving rice's tolerance to high temperature stress and / or yield is characterized by, The OsHTT9 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

5. OsHTT9 The application of gene overexpression recombinant plasmids in breeding rice varieties with high tolerance to heat stress and / or increased yield is characterized by, The OsHTT9 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

6. Contains OsHTT9 The application of recombinant bacteria with gene overexpression recombinant plasmids in breeding rice varieties with high temperature stress tolerance and / or increased yield is characterized by, The OsHTT9 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

7. The application according to claim 1 or 2, characterized in that, The application involves overexpressing the [specific ingredient] in rice. OsHTT9 This is achieved by genes or the proteins they encode.

8. A method for improving the tolerance and / or yield of rice to high temperature stress, characterized in that, The method involves overexpression in rice. OsHTT9 A gene or the protein it encodes; the OsHTT9 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

3.

9. The application according to any one of claims 1 to 6 or the method according to claim 8, characterized in that, The OsHTT9 The gDNA sequence of the gene is shown in SEQ ID NO.

1.

10. The application according to any one of claims 1 to 6 or the method according to claim 8, characterized in that, The OsHTT9 The cDNA sequence of the gene is shown in SEQ ID NO.2.

Images