MO2 gene as well as function verification method and application thereof
By cloning the MO2 gene in *Arabidopsis thaliana* and verifying its function in *Arabidopsis thaliana*, the problem of insufficient salt tolerance of *Arabidopsis thaliana* in saline soil was solved, and the salt tolerance and salt stress resistance were significantly improved, providing a scientific basis and new materials.
Patent Information
- Application Number
- CN202511560633.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-29
- Publication Date
- 2026-01-02
AI Technical Summary
Forage grasses such as *Leymus chinensis* lack salt tolerance in saline soils, resulting in decreased germination rates and reduced biomass. This affects grassland productivity, exacerbates the conflict between grass and livestock, and hinders the sustainable development of grassland animal husbandry.
The MO2 gene was cloned into an overexpression vector containing a 35S promoter and transformed into Arabidopsis thaliana to verify transcription factor function, assess the regulatory effect of the MO2 gene on salt tolerance of *Agrostis spp.*, and verify the function of the MO2 gene using indicators such as leaf Na+, K+, and MDA content.
The MO2 gene significantly improves the salt tolerance of *Leymus chinensis* by maintaining Na+/K+ balance and scavenging reactive oxygen species. This provides a scientific basis and new materials for the breeding of superior salt-tolerant *Leymus chinensis* varieties. The verification methods are extensive and the evaluation indicators are accurate.
Smart Images

Figure CN121249697A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biotechnology, and particularly relates to a MO2 gene and a functional verification method and application thereof. BACKGROUND
[0002] The saline-alkali high-cold prairie is mainly concentrated in the northeastern Qinghai-Tibet Plateau (such as the Qinghai Lake basin and the Qaidam Basin) and the arid-semiarid prairie in the northwest, and the soil salt mainly includes Na+, Cl- and SO42-, the surface soil electrical conductivity (EC) can reach 4-8 dS / m, and the proportion of local severe saline-alkali area (EC>8 dS / m) is more than 20%. The saline-alkali causes are complex, and the imbalance of high evaporation and low precipitation (annual average precipitation is less than 300 mm) in the climate aggravates the accumulation of salt on the surface; human activities such as excessive irrigation and grazing trampling further damage the soil structure and accelerate the salt accumulation on the surface; in terms of geological factors, the inland closed basin (such as the Qaidam Basin) is difficult to avoid long-term salt accumulation due to high underground water salinity.
[0003] The saline-alkali causes multiple challenges to the maintenance of the ecological health of the high-cold prairie and the production of the grass and livestock industry. Elymus sibiricus and other elymus grasses are the main high-quality forage species for ecological restoration and forage production in the high-cold prairie region of China, and the main distribution and utilization area of the elymus grasses is the Qinghai-Tibet Plateau and the arid-semiarid prairie in the northwest, which is also the main distribution area of the saline-alkali prairie. However, the existing elymus grass species such as Elymus sibiricus have insufficient salt tolerance, and the germination rate of the elymus grasses in the saline-alkali soil is reduced by 40%-60%, the biomass is reduced by more than 50%, and the overwintering survival rate is also significantly reduced. At the same time, the saline-alkali soil deteriorates in physical and chemical properties, and is characterized by soil compaction, sharp reduction of microbial diversity, generally low organic matter content, and serious degradation of grassland productivity, which aggravates the contradiction between grass and livestock, and hinders the sustainable development of the regional grass and livestock industry. SUMMARY
[0004] The technical problem to be solved by the application is to provide a MO2 gene capable of improving the salt tolerance of Elymus sibiricus.
[0005] The technical solution adopted by the application to solve the technical problem is that the coding region sequence of the MO2 gene is shown in the sequence table SEQ ID NO. 1.
[0006] The application further provides a functional verification method of the MO2 gene, and the functional verification method comprises the following steps.
[0007] 1) MO2 gene coding sequence is amplified and cloned into overexpression vector pBWA(V)BS containing 35S promoter, the coding sequence of MO2 gene is shown in SEQ ID NO. 1; positive clones are extracted and transformed into GV3101 Agrobacterium competent cells; positive Agrobacterium is picked up in resuspension liquid, and Agrobacterium resuspension liquid with OD600 = 0.8-1.2 is prepared, silwet-77 is added to a concentration of 0.02%, and the whole inflorescence of Arabidopsis material is dipped in the bacterial liquid for 2-3 s, the film is sealed to maintain humidity > 90%, and it is cultured at 25℃ in the dark for 24 h; the immersion period is 7 d, and the immersion is performed for 3 times; the immersed seedlings are placed in a 23℃ 16 h / 8 h light / dark incubator for culture, and they are allowed to set seed; the mature fruit pods are gently rubbed onto clean white paper, wrapped up and dried at 37℃ for 24 h; the seeds are disinfected and uniformly spread on plates containing 35 mg / L Kana and 20 mg / L Basta for positive seedling screening, and DNA is extracted for further detection, and then T3 generation positive seedlings are used for resistance treatment;
[0008] 2) Transcription factor function verification: select transgenic Arabidopsis (Overexpression, OE) with consistent growth as experimental material, and wild-type Arabidopsis (Wildtype, WT) as control material, and the experimental material and the control material are treated with 200 mM NaCl containing nutrient solution, and the control group is only irrigated with nutrient solution, and the treatment time is 7 d, and the salt tolerance related indexes of the experimental material and the control material are evaluated and compared, and whether the MO2 gene has a regulatory effect on improving the salt tolerance of Elymus macgillivray is verified.
[0009] Further, the evaluation and comparison of the salt tolerance related indexes of the experimental material and the control material include the leaf Na + , K + and MDA content.
[0010] Further, the determination method of the leaf Na + , K + is as follows: the leaf tissue is first dried and ground into powder, weighed, dissolved in 10 mL of 98% H2SO4 and 3 mL of H2O2, placed for 5 h, and cooked at 380℃; after the sample is completely cooked, the solution is filtered and diluted to 50 mL; different concentrations of KCl and NaCl solution are prepared to draw the standard curve; the determination of Na + and K + content is performed by using a flame spectrophotometer, and the final leaf Na + and K + content is obtained according to the standard curve.
[0011] Further, the determination method of the MDA content of the leaf is as follows: 0.1 g of fresh leaf is taken and 2 mL of 10% TCA solution is added and grinded to homogenate, then 8 mL of TCA solution is added and further grinded and mixed; centrifuged, the supernatant is taken and determined in an enzyme label instrument; the calculation formula is: MDA (μmol / g) = (6.452 x D532-0.56 x D450) x V / W, wherein V represents total volume mL; W represents fresh weight g.
[0012] The application also finds the application of the MO2 gene in improving the salt tolerance of Elymus macgathurii.
[0013] The application has the beneficial effect that the MO2 gene of the application can endow the plant with stronger salt tolerance through maintaining the balance of Na + / K + , removing active oxygen and other pathways, the MO2 gene of the application has the function of positively regulating the salt tolerance of the plant, and provides a scientific basis and new material for the research direction of breeding of salt-tolerant Elymus macgathurii excellent varieties and understanding of the plant salt tolerance mechanism; in addition, the function verification method of the MO2 gene provided by the application starts from the internal regulation mechanism of salt stress of Elymus macgathurii and applies transgenic Arabidopsis for function verification, has research depth and breadth, obvious technical effect, and can obtain a plant strain with an intended phenotype; and a plurality of indexes for evaluating the degree of salt stress are used, which has good evaluation effect, the indexes are verified with each other, the function of the MO2 gene can be accurately verified, and after verification, the MO2 gene of the application has a positive regulation effect on the salt tolerance of Elymus macgathurii, and can significantly improve the salt tolerance and salt stress resistance of Elymus macgathurii. BRIEF DESCRIPTION OF DRAWINGS
[0014] Figure 1 is a phenotype diagram of CK and the control material (WT) and the experimental material (OE1, OE2, OE3) under salt stress in the embodiment of the application;
[0015] Figure 2 is a leaf Na + , K + and MDA content index determination diagram of CK and the control material (WT) and the experimental material (OE1, OE2, OE3) under salt stress in the embodiment of the application. DETAILED DESCRIPTION
[0016] The application will be further described below in combination with the embodiments.
[0017] The coding region sequence of the MO2 gene is as follows:
[0018] ATGGCCGATCGCGGCGGCAAGGCACCAGCATCGACGTCGGCGGCGGCCGTGGACGTCGACGCTGAGGTGG
[0019] TCATCGTCGGCGCCGGGATCGCGGGGCTCGCGACCGCGCTGGCGCTGCGGCGGATCGGCGTGGGCGCGGC
[0020] TGGCGGCGGCGTCCTGGTGCTGGAGCGGCACGCGGAGCTGCGCTCCACCGGCGCCGCGCTCACCATCTTC
[0021] CCCAACGGCTGGTTCGCGCTCCGCGCGCTCGGCGTCGCGCACAAGCTCACCTCCCGCTACGATGCCTTCG
[0022] AAACATGCGTCTCCGTTGCTGGCCGTGATTGTTGCTCCAACGATTTTCGTGATAATTTCTTGCCTGTGAT
[0023] TATTGCTCTAATTTCAGCTATGTCTGCTGCATGCAGATCCCGAGTGACAACTCTTGAGACTGGAGCGACG
[0024] CAGGTGTTCCGCTTTGCTGGGCGCAAAAGCAGCGGCGACGTGAGAGTGAGACCGATGCATCGGAAGGCGC
[0025] TGCTGGAGGCGCTCGCGGAGGAGCTGCCTCCGGGCACCATCAGGTTCTCGTCCAAGCTCGCCTCGATCGC
[0026] CACTGAGAAGGCGCAGGGTTCCCCGGAGATCGCCGTCCTACGGTTAGACGACGGTACGGTGATCCGATCC
[0027] AAGGTGCTGATCGGGTGCGACGGGGTGCACTCCGTGGTGTCGCAGTGGCTGGGCCTGTCGGAGCCGGCGA
[0028] GCTCAGGCCGGTCCGCCGTCCGCGGGCTCGCCGTGTACCCGGATGGGCACGGCCTGAAGAAGGAGCTCCG
[0029] GCAGTTCCTCTCGGAGGGTCTCAGGGCCGGCATGGTGCCCATCAGCGACACTGATGTCTACTGGTTCCTT
[0030] GTCAACAATACCGTCCCTGCGGAGAAGGAGGCCGGCACGGACCCCGCCAAGATCCTGCGGGAGGTCACGG
[0031] ACAACCTGGGCAGGAGCATGCCGGCGGAGTACCTGGACGTGGCGTGCCACTCCGACTCCGGCAACCTGTC
[0032] GTGGGCGCCGCTGCTGTACCGCGCCCCCTGGGCCATCCTCAGGGGTCCGGCGGCCCGCGGGCCGGTGACG
[0033] GTGGCCGGCGACGCGTTCCACCCCATGACCCCCGACATGGCGCAGGGCGGGTGCTCCGCGCTGGAGGACG
[0034] CGGTGGTGCTCGCGCGCGCTCTGTCTCGGGCAGCCACGCCCGCCGACGGCGTGGCCGCCTACGTGGCAGA
[0035] GCGGCGTGGCCGGGCTGCCTGGCTGGTCGCCGGTGCTTACCTGTCGGGCTGGGTCCAGCAGGGCGGGACC
[0036] AACGTCCGGGGCGTGCGAGGGTACATGGTCCGGCTGTTTCGTGACTGGATCTTTTACAGGTTCTTGTTTC
[0037] CCAGGCTCGCCGATACAATGTGGTTCGATTGCGGCGACCTGGTGGAGCCGAAGGAGGGCAAGACCCACTC
[0038] GGAGTAA
[0039] MO2 refers to the gene EsiS02g0031240.
[0040] Examples
[0041] The present embodiment verifies the function of the above-mentioned MO2 gene, and the function verification method specifically comprises the following steps:
[0042] 1), the MO2 gene coding sequence is amplified and cloned into the overexpression vector pBWA(V)BS containing 35S promoter, the coding region sequence of MO2 gene is shown as SEQ ID NO. 1; the positive clone is extracted and transformed into GV3101 agrobacterium competent cells; the positive agrobacterium is picked up in the resuspension solution, and the agrobacterium resuspension solution with OD600=0.8-1.2 is prepared, silwet-77 is added to the concentration of 0.02%, and the whole inflorescence of arabidopsis material is dipped in the bacterial solution for 2-3 s, the film is sealed to maintain humidity> 90%, and 25℃ dark culture for 24 h; the immersion period is 7 d, and the immersion is performed for 3 times; the immersed seedlings are placed in a 23℃ 16 h / 8 h light / dark incubator for culture, and the seeds are obtained; the mature fruit pods are gently rubbed on clean white paper, wrapped in 37℃ dry for 24 h; the seeds are sterilized and uniformly spread on the plate containing 35 mg / L Kana and 20 mg / L Basta for positive seedling screening, and the DNA is extracted for further detection, and then the T3 generation purified positive seedlings are used for resistance treatment;
[0043] 2), the function of the transcription factor is verified: the growth consistent transgenic arabidopsis (Overexpression, OE) is selected as the experimental material, and the wild type arabidopsis (Wildtype, WT) is selected as the control material, the experimental material and the control material are treated with 200 mM NaCl containing nutrient solution, the control group is only irrigated with nutrient solution, the treatment time is 7 d, and the salt tolerance related indexes of the experimental material and the control material are evaluated and compared, the salt tolerance related indexes of the experimental material and the control material include leaf Na + , K + and MDA content;
[0044] The determination method of the leaf Na + , K + is as follows: the leaf tissue is dried and ground into powder, weighed, dissolved in 10 mL 98% H2SO4 and 3 mL H2O2, placed for 5 h, and cooked at 380℃; after the sample is completely cooked, the solution is filtered and diluted to 50 mL; different concentrations of KCl and NaCl solution are prepared to draw standard curve; Na + and K + content determination is carried out by using flame spectrophotometer, according to the standard curve, the final leaf Na + and K + content is obtained;
[0045] The method for determining the MDA content of the leaves is as follows: Take 0.1 g of fresh leaves and add 2 mL of 10% TCA (Sinopharm Chemical Reagent Co., Ltd) solution and grind until homogenized. Then add 8 mL of TCA solution and grind further until homogenized. Centrifuge and take the supernatant for determination using an ELISA reader. The calculation formula is: MDA (μmol / g) = (6.452×D532-0.56×D450)×V / W (V: total volume mL; W: fresh weight g).
[0046] Figure 1 These are phenotypic diagrams of CK and control materials (WT) and experimental materials (OE1, OE2, OE3) under salt stress in embodiments of the present invention; Figure 2 The leaf Na+ samples of the control (WT) and experimental materials (OE1, OE2, OE3) under salt stress in this embodiment of the invention are... + K + And a graph showing the determination of MDA content. (From...) Figure 1 It can be seen that after watering with NaCl, the yellowing and chlorosis of WT plants were significantly stronger than that of OE plants in the control material (WT) and experimental materials (OE1, OE2, OE3). Furthermore, OE plants showed good overall growth, while the growth of WT plants was inhibited, resulting in smaller overall plant size. Figure 2 It can be seen that the OE strain has lower leaf Na content than the WT strain under salt stress. + Content, and higher leaf K + In addition, the MDA content of the OE strain was significantly lower than that of the WT strain (P < 0.01), indicating that the OE strain MO2 has a positive effect on the salt tolerance of plants.
Claims
1. The MO2 gene, characterized by: The coding region sequence of the MO2 gene is shown in SEQ ID NO.1 of the sequence listing.
2. A method for verifying the function of the MO2 gene, characterized in that... Includes the following steps: 1) The MO2 gene coding sequence was amplified and cloned into the overexpression vector pBWA(V)BS containing the 35S promoter. The coding region sequence of the MO2 gene is shown in SEQ ID NO.
1. Positive clones were extracted for plasmid extraction and transformed into GV3101 Agrobacterium competent cells. Positive Agrobacterium cells were picked and resuspended to prepare an Agrobacterium resuspending solution with OD600 = 0.8-1.
2. Silwet-77 was added to a concentration of 0.02%. All inflorescences of Arabidopsis thaliana were dipped into the bacterial solution for 2-3 seconds, sealed with a film to maintain humidity >90%, and incubated in the dark at 25℃ for 24 h. The infection cycle was 7 days, with a total of 3 infections. The infected seedlings were placed in a 23℃ 16 h / 8 h light / dark incubator for cultivation until seed formation. Mature pods were gently rubbed onto clean white paper, wrapped, and dried at 37℃ for 24 h. The seeds were sterilized and evenly spread on a substrate containing 35 mg / L Kana and 20 mg / L... Positive seedlings were screened on Basta plates, and DNA was extracted for further testing. Then, T3 generation purified positive seedlings were treated with resistance. 2) Verification of transcription factor function: Transgenic Arabidopsis thaliana (Overexpression, OE) with consistent growth was selected as experimental material, and wild-type Arabidopsis thaliana (Wildtype, WT) was selected as control material. Both experimental and control materials were irrigated with 200 mM NaCl containing nutrient solution, while the control group was irrigated with nutrient solution only. The treatment time was 7 days. Salt tolerance-related indicators of experimental and control materials were evaluated and compared to verify whether the MO2 gene has a regulatory role in improving the salt tolerance of *Agrostis spp.* 3. The method for functional verification of the MO2 gene as described in claim 2, characterized in that: The indicators used to assess and compare the degree of salt stress tolerance of the experimental and control materials included leaf Na+. + K + And MDA content.
4. The method for functional verification of the MO2 gene as described in claim 3, characterized in that: The blade Na + K + The determination method is as follows: First, the leaf tissue needs to be dried and ground into powder, weighed, and dissolved in 10 mL of 98% H2SO4 and 3 mL of H2O2. After standing for 5 h, the solution is digested at 380℃. After complete digestion, the solution is filtered and diluted to 50 mL. Standard curves are plotted using KCl and NaCl solutions of different concentrations. + and K + The Na content was determined using a flame spectrophotometer, and the final Na content in the leaf was obtained based on the standard curve. + and K + content.
5. The method for functional verification of the MO2 gene as described in claim 3, characterized in that: The method for determining the MDA content of the leaves is as follows: Take 0.1 g of fresh leaves and add 2 mL of 10% TCA solution to grind into a homogenate, then add 8 mL of TCA solution to grind and mix further; centrifuge, and take the supernatant for determination in an enzyme-linked immunosorbent assay (ELISA) reader; The calculation formula is: MDA (μmol / g) = (6.452×D532-0.56×D450)×V / W (V: total volume mL; W: fresh weight g).
6. Application of the MO2 gene in improving the salt tolerance of old wheat.