Wheat grain protein content regulation gene TaPK-1B as well as encoding protein and application thereof
By knocking out the TaPK-1B gene on wheat chromosome 1B through genome-wide association analysis and genetic transformation, the problem of insufficient genes regulating wheat grain protein content was solved, thereby increasing wheat grain protein content and providing a new approach for wheat quality improvement.
Patent Information
- Application Number
- CN202511732744.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-24
- Publication Date
- 2026-01-02
AI Technical Summary
There are few reports on genes regulating wheat grain protein content in existing technologies, making it difficult to improve wheat quality.
By using genome-wide association analysis to identify the TaPK-1B gene on wheat chromosome 1B, and then knocking out this gene through genetic transformation, wheat grain protein content was regulated and increased.
The function of the TapKP-1B gene in negatively regulating grain protein content has been clarified, providing a new gene resource for wheat quality improvement and increasing wheat grain protein content.
Smart Images

Figure CN121249705A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to wheat breeding, and more specifically, to genes regulating wheat grain protein content. TaPK-1B Its encoded proteins and applications. Background Technology
[0002] Wheat is one of the world's most important staple food crops, providing humans with approximately 20% of calories and 30% of their main food source. The protein content of wheat grains affects both wheat quality indicators and its processing uses. Improving wheat grain protein content and overall quality has become one of the main goals of wheat breeding in my country.
[0003] To date, few genes regulating wheat grain protein content have been reported. In 2006, a major gene regulating grain protein content was reported in wild wheat 6BS. NAM-B1 However, this gene has not been fully utilized in modern wheat breeding practices.
[0004] Therefore, utilizing current molecular biology techniques and methods to further explore genes that control grain protein content, screen and identify superior allelic variations of these genes, and elucidate the molecular mechanisms of gene action will provide genetic resources for wheat quality improvement and offer an effective approach for wheat molecular breeding. Summary of the Invention
[0005] To address the relatively limited research on the regulation of wheat protein content genes, this invention provides a wheat grain protein content gene... TaPK-1B Its encoded proteins and applications, knocking out wheat cells through genetic transformation. TaPK-1B Genes can increase the protein content of wheat grains.
[0006] To achieve the above objectives, the present invention provides a gene for regulating wheat grain protein content. TaPK- 1B It is located on wheat chromosome 1B and has a nucleotide sequence as shown in SEQ ID No. 3, or a nucleotide sequence encoding a protein with the same function obtained by substituting, deleting or inserting one or more nucleotides from the nucleotide sequence shown in SEQ ID No. 3.
[0007] A second aspect of the present invention provides a TapK-1B protein having an amino acid sequence as shown in SEQ ID No. 4, or an amino acid sequence of a protein having the same function obtained by substituting, deleting or inserting one or more amino acid residues from the amino acid sequence shown in SEQ ID No. 4.
[0008] A third aspect of the present invention provides the use of the above-described gene or protein in any of the following: (1) Regulate the protein content of wheat grains; (2) Prepare transgenic wheat with increased or decreased protein content in wheat grains.
[0009] Specifically, TaPK-1B Genes negatively regulate the protein content of wheat grains.
[0010] Furthermore, reducing the expression level of TaPK-1B protein in wheat plants increases the protein content of wheat grains; or knocking out the expression level of TaPK-1B protein in wheat... TaPK-1B Genes that increase the protein content of wheat grains.
[0011] The fourth aspect of the present invention provides the above-described TaPK-1B The sgRNA of the gene is characterized by comprising sgRNA1 shown in SEQ ID No. 5 and sgRNA2 shown in SEQ ID No. 6.
[0012] Through the above technical solution, the present invention achieves the following beneficial effects: This invention discovers a wheat species through genome-wide association analysis. TaPK-1B Genes, knocked out in wheat through genetic transformation TaPK-1B The gene can increase the protein content of wheat grains. The function of this gene in negatively regulating grain protein content has been clarified, providing a new gene resource for wheat quality improvement and an effective approach for wheat molecular breeding. Attached Figure Description
[0013] Figure 1 Genome-wide association analysis of wheat grain protein content; Figure 2 for TaPK-1B Image of gene amplification results; Figure 3 for TaPK-1B Gene editing site detection; Figure 4 for TaPK-1B Figure showing the results of protein content determination in gene knockout transgenic lines. Detailed Implementation
[0014] The specific embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.
[0015] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0016] The wheat materials used in this invention are all germplasm resources preserved by the College of Agriculture of Yangzhou University, which can be obtained and used by technical and research personnel in this field.
[0017] Example 1: Genome-wide association analysis of wheat grain protein content TaPK-1B Acquisition of genes Grain protein content under various environmental conditions was assessed using 327 different wheat germplasm resources. Through genome-wide association analysis and the FarmCPU model, seven stable QTLs associated with grain protein content were identified on chromosomes 1A, 1B, 2A, 2D, 3B, 5A, and 6A. Notably, a pyruvate kinase gene was found near chromosome 1B. TaPK-1B ( Figure 1 ).
[0018] Example 2: Protein content related to wheat grains TaPK-1B Cloning of coding genes 1) Fielder seeds 15 days after flowering were used as experimental material. Total RNA was extracted using a polysaccharide and polyphenol RNA extraction kit, and wheat cDNA was obtained by reverse transcription using the TaKaRa PrimeScript RT reagent Kit with gDNA Eraser reverse transcription kit.
[0019] 2) Using wheat cDNA as a template, PCR amplification was performed using primers (SEQ ID No. 1 and SEQ ID No. 2) synthesized by Yangzhou Youkang Biotechnology Co., Ltd. The specific reaction program was: 94℃ pre-denaturation for 3 min; 98℃ for 10 s, 60℃ for 30 s, 68℃ for 30 s, 33 cycles; 68℃ extension for 10 min; and storage at 15℃. Agarose gel electrophoresis revealed approximately 1.7 kb of PCR amplification product (…). Figure 2 The PCR product was sent to Yangzhou Youkang Biotechnology Co., Ltd. for sequencing. The results showed that the nucleotide sequence of the PCR product included the DNA sequence shown in SEQ ID No. 3. The DNA sequence shown in SEQ ID No. 3 was named... TaPK-1B The gene encodes an amino acid sequence named TapK-1B protein, as shown in SEQ ID No. 4.
[0020] Example 3 TaPK-1B Obtaining knockout genetically modified wheat This implementation case provides TaPK-1B The method for constructing knockout genetically modified wheat follows these steps: 1) Using the CRISPR-P website of South China Agricultural University (http: / / crispr.hzau.edu.cn / CRISPR2 / ), design... TaPK- 1B The gRNA target of the gene was identified, and the specificity of the target was detected using the WheatOmics website (http: / / 202.194.139.32 / jbrowse.html), resulting in sgRNA1 (SEQ ID No. 5) and sgRNA2 (SEQ ID No. 6). The sgRNA was then constructed into the pCBC-MT1T2 vector via PCR, and the PCR product was purified for enzyme digestion and ligation.
[0021] 2) The PCR product from step (1) was digested and ligated with enzymes. The total reaction volume was 30 µL: 4 µL of the PCR product from step (1), 4 µL of pBUE414, 3.0 µL of 10× NEB T4 Buffer, 3.0 µL of CutSmart Buffer, 2 µL of Bsa I, 2 µL of T4DNA Ligase, and 12 µL of ddH2O. Reaction conditions: 37℃ for 5 h, 50℃ for 5 min, and 80℃ for 10 min. After the reaction, the mixture was placed on ice to cool.
[0022] 3) The ligation system obtained in step 2) was transformed into E. coli competent cells DH5α. The cells were evenly spread on LB agar plates containing 50 mg / ml Kana and incubated overnight at 37°C. Colony PCR was performed using primers SEQ ID No. 7 and SEQ ID No. 8. Positive products were sent to Yangzhou Youkang Biotechnology Co., Ltd. for sequencing. Correctly sequenced clones were amplified, plasmids were extracted, and transformed into GV3101 Agrobacterium competent cells. Positive clones were selected and sent to Weimi Biotechnology Co., Ltd. for genetic transformation; the recipient was the wheat variety Fielder.
[0023] 4) Utilize TaPK-1B Specific primer pairs located on chromosome 1B, as shown in SEQ ID No. 9 and SEQ ID No. 10, are used for... TaPK-1B The knockout transgenic line DNA was amplified and then subjected to Sanger sequencing to obtain... TaPK-1B Variation types ( Figure 3 ).
[0024] Example 4 TaPK-1B Phenotypic identification of knockout genetically modified wheat 1) Harvest wild-type Fielder (WT) and knockout lines KO-1 and KO-2 from Example 3, dry them to standard moisture content, and determine the grain protein content of different lines using a Wavetone DA7200 near-infrared grain analyzer.
[0025] 2) Results and Analysis: such as Figure 4 As shown, by measuring and comparing the protein content of wild-type and knockout lines, it was found that the protein content of knockout lines was significantly higher than that of wild-type.
[0026] sequence list SEQ ID No.1: ATGGCGGCGGCGGCGGAGATG; SEQ ID No.2: TCAGCACTGGACTTTCCTCA; SEQ ID No. 3: SEQ ID No. .4: 100. SEQ ID No .5:GCGCGTATGAATATGTCCCATGG; SEQ ID No .6:AGCTGGTGACATACTGTTGGTGG. SEQ ID No. .7:CCATCGTCAACCACTACATCGAGACA. SEQ ID No .8:CTTCAGCAGGTGGGTGTAGAGCGT. SEQ ID No.9:AGTAGTGGATGCGACTCCCCG. SEQ ID No.10:TTAGACTGCACAACAACATAGG。
[0027] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
[0028] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.
[0029] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.
Claims
1. A gene regulating protein content in wheat grains TaPK-1B Its characteristics are, Having a nucleotide sequence as shown in SEQ ID No. 3, or a nucleotide sequence encoding a protein with the same function obtained by substituting, deleting or inserting one or more nucleotides from the nucleotide sequence shown in SEQ ID No.
3.
2. TaPK-1B protein, characterized in that, Having the amino acid sequence shown in SEQ ID No. 4, or the amino acid sequence of a protein having the same function obtained by substituting, deleting or inserting one or more amino acid residues from the amino acid sequence shown in SEQ ID No.
4.
3. The use of the gene of claim 1 or the protein of claim 2 in any of the following: (1) Regulate the protein content of wheat grains; (2) Prepare transgenic wheat with increased or decreased protein content in wheat grains.
4. The application according to claim 3, characterized in that, TaPK-1B Genes negatively regulate the protein content of wheat grains.
5. The application according to claim 4, characterized in that, Reducing the expression level of TapK-1B protein in wheat plants increases the protein content of wheat grains; or Knockout wheat TaPK-1B Genes that increase the protein content of wheat grains.
6. The claim 1 TaPK-1B The sgRNA of a gene is characterized by, This includes sgRNA1 shown in SEQ ID No. 5 and sgRNA2 shown in SEQ ID No. 6.