Application of ZmIQM4 gene in regulation and control of plant seed germination

Abstract

The invention discloses application of a ZmIQM4 gene in regulation and control of plant seed germination, and relates to the technical field of plant genetic engineering, a nucleotide sequence of the ZmIQM4 gene is shown as SEQ ID NO.1, an amino acid sequence of an encoded protein of the ZmIQM4 gene is shown as SEQ ID NO.5, and the encoded protein is positioned in a cell nucleus. The ZmIQM4 gene is used as a target gene to be introduced into an arabidopsis thaliana genome, it is found that the ZmIQM4 gene is over-expressed, under normal conditions, the germination rate of plant seeds is normal, and under ABA mediation, the germination rate of ZmIQM4 transgenic seeds is remarkably reduced, it is indicated that the ZmIQM4 gene possibly inhibits seed germination by participating in an ABA signal channel, the discovery can provide gene resources for crop breeding, and the application prospect of the ZmIQM4 gene is broad. The method has important theoretical and practical significance for plant breeding and application.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant genetic engineering, and particularly relates to application of a ZmIQM4 gene in regulating seed germination of plants. BACKGROUND

[0002] As an important food crop, corn plays a key role in global food security, and therefore, it is of important application prospect to study the regulation mechanism of corn seed germination. Seed germination refers to the process that viable seeds swell by absorbing water, release the dormant state, and finally make the embryo break through the seed coat under suitable environmental conditions, which is affected by both endogenous hormones and external environment. Abscisic acid (ABA) is a key hormone in plants, which is involved in regulating various physiological activities, including seed dormancy, germination, plant growth inhibition, fruit flowering, and response to environmental stress, etc. During seed development, ABA maintains the dormant state by accumulation, preventing the seed from germinating before harvest. During the germination process, the ABA content gradually decreases, and exogenous application of ABA can effectively inhibit seed germination.

[0003] ZmIQM4 belongs to the IQM gene family, and the IQM protein encoded thereby is a kind of calcium modulator binding protein specific to plants, which is widely involved in plant growth and development and response to abiotic stress. Although there have been researches on the functions of various genes, the functions of the IQM family in corn have not been reported, especially the role in seed germination has not been clarified. In view of the possible regulation effect, in-depth exploration of the genes related to corn seed germination has important theoretical and practical significance for crop breeding and improvement of corn production. SUMMARY

[0004] In order to overcome the deficiencies of the prior art, the purpose of the present application is to provide application of a ZmIQM4 gene in regulating seed germination of plants.

[0005] The present application achieves the above-mentioned purpose through the following technical solutions: The present application provides application of a ZmIQM4 gene in regulating seed germination of plants in response to ABA, the nucleotide sequence of the ZmIQM4 gene is shown as SEQ ID NO. 1, the amino acid sequence of the encoded protein is shown as SEQ ID NO. 5, and the encoded protein is located in the nucleus.

[0006] As a further optimization scheme of the present application, the ZmIQM4 gene is introduced into the plant genome, and under the mediation of ABA, the seed germination speed of the plant is significantly reduced.

[0007] As a further optimization scheme of the present application, the plant is Arabidopsis thaliana or corn.

[0008] As a further optimization of the present application, the ABA concentration used in the mediation of the ABA is ≥ 0.3 μM.

[0009] The present application also provides a recombinant plasmid, which is obtained by introducing the ZmIQM4 gene into an overexpression vector.

[0010] As a further optimization of the present application, the overexpression vector is pCAMBIA1305.

[0011] The present application also provides a method for obtaining a transgenic plant variety with germination inhibition in response to ABA, wherein the ZmIQM4 gene is used as a target gene, introduced into the genome of Arabidopsis thaliana for expression, and a transgenic Arabidopsis thaliana variety with germination inhibition in response to the ABA signal pathway is obtained through cultivation.

[0012] The present application has the following beneficial effects: The present application introduces the ZmIQM4 gene into the genome of Arabidopsis thaliana, and finds that overexpression of the ZmIQM4 gene causes normal seed germination rate under normal conditions, and significantly reduces the seed germination rate of the transgenic ZmIQM4 gene under the mediation of ABA, indicating that the ZmIQM4 gene may inhibit seed germination by participating in the ABA signal pathway, and providing a theoretical basis for the study of the molecular regulation mechanism of plant germination. The finding can provide gene resources for crop breeding, and has important theoretical and practical significance for plant breeding and application. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 It is a phylogenetic analysis diagram of the IQM protein family in different species.

[0014] Figure 2 It is a ZmIQM gene family promoter response element analysis diagram.

[0015] Figure 3 It is an expression pattern analysis diagram of part of the ZmIQM gene under abscisic acid stress.

[0016] Figure 4 It is a schematic diagram of the pCAMBIA1305-ZmIQM4-GFP recombinant vector.

[0017] Figure 5 It is a germination rate statistical diagram of wild type seeds and ZmIQM transgenic seeds (OE-ZmIQM4, 6, 7) under ABA stress.

[0018] Figure 6 It is a subcellular localization diagram of the ZmIQM4 protein. DETAILED DESCRIPTION

[0019] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0020] 1. Materials Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.

[0021] 2. Method 2.1 Identification of IQM protein in maize This application used the Basic Local Alignment Search (BLASTP) tool to search the Phytozome v13 database (http: / / phytozome-next.jgi.doe.gov) to identify IQM (ZmIQM) protein sequences in maize. IQM protein sequences from Arabidopsis thaliana and rice (6 from Arabidopsis and 8 from rice) were used as query sequences. To annotate conserved domains in candidate sequences, the Pfamscan (https: / / www.ebi.ac.uk / Tools / pfa / pfamscan) and SMART (http: / / smart.emblheidelberg.de) databases were used. Members of the maize IQM family were determined by confirming the presence of complete IQ motifs. IQM protein sequences from Arabidopsis thaliana, soybean, and rice were retrieved from the Phytozome v13 database, and IQM protein sequences from kiwifruit (Actinidia eriantha) were retrieved from the kiwifruit database (https: / / kiwifruitgenome.atcgn.com).

[0022] Information on the maize IQM gene, including its coding sequence (CDS), genome sequence, coordinates, open reading frame (ORF) length, amino acid count, and molecular weight, was obtained from the Phytozome v13 database. The physicochemical properties of the ZmIQM protein were analyzed using the ExPASy tool (http: / / web.expasy.org / protparam).

[0023] Experimental Conclusions: By comparing with known IQM proteins in Arabidopsis thaliana and performing a BLASTP search, 12 candidate ZmIQM genes were identified in maize using SMART and MEME analyses. These genes were named ZmIQM1 to ZmIQM12. The characteristics of each ZmIQM protein are detailed, including gene ID, chromosomal location, coordinates, coding sequence length (CDS), amino acid length, and molecular weight (MW), as shown in Table 1. Table 1. Information on the ZmIQM gene identified in maize. ; 2.2 Phylogenetic Analysis To investigate the evolutionary relationships of IQM genes within and between species, this application retrieved IQM protein sequences from maize (Zea mays B73), rice (Oryza sativa), Arabidopsis thaliana, kiwifruit (Actinidiaeriantha), and soybean (Glycine max). A rootless phylogenetic tree was constructed using the neighbor-joining (NJ) method and p-distance substitution model in MEGA 11 software. Bootstrap analysis was performed with 1000 replicates and paired deletions to calculate the support value for each branch. The resulting phylogenetic tree was visualized using Chiplot (https: / / www.chiplot.online).

[0024] Experimental conclusions: The analysis results show that the IQM protein can be divided into five branches (such as...). Figure 1 As shown in the figure, maize IQM proteins are divided into group I (ZmIQM4, ZmIQM11, ZmIQM9, ZmIQM10), group II (ZmIQM2, ZmIQM3, ZmIQM5, ZmIQM6, ZmIQM12), and group III (ZmIQM1, ZmIQM7, ZmIQM8) according to their evolutionary relationships.

[0025] 2.3 Analysis of cis-regulatory elements in the ZmIQM gene Gene function is typically influenced by cis-regulatory elements in its promoter region. To detect whether the promoter sequence of the ZmIQM gene contains elements that respond to hormones such as ABA, a 2Kbp promoter sequence of the ZmIQM gene was first collected from the MaizeGDB database (http: / / www.maizegdb.org). This sequence was then submitted to the PlantCARE database website (https: / / bioinformatics.psb.ugent.be / webtools / plantcare / html) for cis-regulatory element prediction. Finally, the results were visualized using TBtools software (v1.108).

[0026] Experimental conclusions: The results indicate that, in addition to core components such as the TATA box and CAAT box, six other cis-acting elements associated with stress and hormonal responses (such as...) were identified. Figure 2 As shown in the figure, only the ZmIQM4 gene promoter sequence has all six types of cis-regulatory elements related to stress and hormone response. The following experiments will focus on the ZmIQM4 gene as the main research object.

[0027] 2.4 Analysis of the expression pattern of ZmIQM gene under abscisic acid stress To assess the changes in expression levels of the ZmIQM4 gene and other ZmIQM genes in the same or different groups on the phylogenetic tree under abiotic stress conditions, an expression pattern analysis under abscisic acid stress conditions was conducted. The specific steps included: Abscisic acid stress treatment: Three-leaf stage maize plants were transferred to Hogland solution and Hogland solution containing 100 µM ABA abscisic acid; equal amounts of leaf samples were collected at 0, 3, 6, 12 and 24 hours after treatment, and immediately frozen with liquid nitrogen and stored in an environment of −80℃.

[0028] Expression pattern analysis: After RNA extraction and reverse transcription of the above samples, quantitative PCR was performed using cDNA as a template with Novizan's SYBR dye and a Thermo Scientific PikoReal Cycler instrument. After the reaction, 2 –ΔΔCT The algorithm analyzes the results and calculates the relative expression level of the ZmIQM gene.

[0029] Experimental conclusions: such as Figure 3As shown, the expression level of the ZmIQM4 gene changed significantly when abscisic acid stress occurred. Its expression level reached a highly significant level only after 3 hours of treatment. In contrast, the expression level of ZmIQM11 in the same group first decreased significantly and remained stable after the onset of stress, and only slightly increased after 24 hours of treatment. The expression levels of the other ZmIQM1, ZmIQM2, ZmIQM6, and ZmIQM7 reached a relatively high level after 6 or 12 hours of treatment, but their highest expression levels were all lower than those of the ZmIQM4 gene.

[0030] 2.5 Analysis of ABA-mediated germination in transgenic Arabidopsis thaliana 2.5.1 Gene Amplification: The ZmIQM4, ZmIQM6, and ZmIQM7 genes (ZmIQM4 nucleotide sequence as shown in SEQ ID NO.1, its encoded amino acid sequence as shown in SEQ ID NO.4; ZmIQM6 nucleotide sequence as shown in SEQ ID NO.2, its encoded amino acid sequence as shown in SEQ ID NO.5; ZmIQM7 nucleotide sequence as shown in SEQ ID NO.3, its encoded amino acid sequence as shown in SEQ ID NO.6) were amplified using the pCAMBIA1305-GFP vector as the basic backbone. This vector uses a 35S promoter to regulate gene expression. After obtaining the transcripts of the ZmIQM4, ZmIQM6, and ZmIQM7 genes, the stop codons in the transcripts were removed, and the following primers were designed with SpeI and XbaI as restriction enzyme sites for amplification: SEQ ID NO.7: ZmIQM4-1305-F: 5'GGACAGCCCAGATCAACTAGTATGGGATTGTACCGCAACGA3'; SEQ ID NO.8: ZmIQM4-1305-R: 5'GGTCCTCGAGACGTCTCTAGAGTGCAGTCTGCTCCTCTTGAAGT 3'; SEQ ID NO.9: ZmIQM6-1305-F: 5'GGACAGCCCAGATCAACTAGTATGGGGCTGTCAATCTCGTACC 3'; SEQ ID NO.10: ZmIQM6-1305-R: 5'GGTCCTCGAGACGTCTCTAGAGAACGCAGTCCAAGTGGCAC 3'; SEQ ID NO. 11: ZmIQM7-1305-F: 5'GGACAGCCCAGATCAACTAGTATGGAGGTGGAGGCGGCG3'; SEQ ID NO. 12: ZmIQM7-1305-R: 5'GGTCCTCGAGACGTCTCTAGAGCTTGGCTGCGGCAGGGA3'.

[0031] Recombinant vector construction and transformation: After amplification, the obtained PCR amplification products were ligated to the pCAMBIA1305 vector using homologous recombination (specific operation steps refer to the Novavitian ClonExpress II One Step Cloning Kit) to construct the recombinant plasmid pCAMBIA1305-ZmIQM4 / 6 / 7-GFP; subsequently, the ligation product was transformed into DH5α competent cells using heat shock and positive colonies were screened using kanamycin-containing medium. A suitable number of single colonies were picked from the plate for culture, and the plasmid was extracted for sequencing to obtain the positive recombinant vector; the positive plasmid was then transformed into Agrobacterium competent cells using heat shock to obtain positive Agrobacterium.

[0032] 2.5.2 Genetic transformation of transgenic Arabidopsis thaliana lines Using transgenic technology (inflorescence infection method), positive Agrobacterium containing the pCAMBIA1305-ZmIQM4 / 6 / 7-GFP plasmid was transformed into Arabidopsis thaliana. T0 generation seeds were tested. Since the constructed vector contained both the vector and the target gene, PCR amplification was performed using designed specific primers (SEQ ID NO.7-12). Positive plants containing ZmIQM4 / 6 / 7 (OE-ZmIQM4 / 6 / 7) were screened. Three positive lines were selected from the detected positive plants, and these three lines were then propagated to the T3 generation. Positive plants that no longer exhibited phenotypic segregation were selected as homozygous Arabidopsis lines for subsequent experiments.

[0033] 2.5.3 Seed germination rate test of overexpressing ZmIQM4 / 6 / 7 gene To investigate the effect of ABA on the germination of transgenic seeds, seeds harvested and dried at the same time were selected, and healthy and plump seeds were chosen for the experiment. After sterilization, the transgenic seeds were dispersed and sown in 1 / 2 MS sterile medium with a concentration of 0.3 μM ABA, while a medium without ABA was used as a control group. After two days of dark incubation at 4°C, the seeds were transferred to an artificial climate chamber at 22°C for further incubation, and the seed germination rate was counted.

[0034] Experimental Conclusions: In the previous experiments, this application found a significant association between the ZmIQM4 gene and the plant hormone abscisic acid (ABA). To further explore the functional role of IQM in plant development, this application constructed transgenic Arabidopsis plants (OE-ZmIQM4 / 6 / 7) overexpressing ZmIQM4, ZmIQM6, and ZmIQM7 (IQM proteins on different evolutionary branches). When cultured in MS medium, all Arabidopsis seeds grew normally. However, when these overexpressing ZmIQM gene transgenic seeds were cultured in MS medium supplemented with 0.3 μM ABA, their germination rates decreased to varying degrees. Compared with wild-type Arabidopsis, the ZmIQM4 gene transgenic seeds showed a sensitive phenotype to ABA regulation, and their germination rates were significantly reduced (e.g., ...). Figure 5 As shown in the figure, these results indicate that the maize seed germination process is closely related to the ABA signaling pathway.

[0035] 2.5 Subcellular localization analysis of the ZmIQM4 gene Subcellular localization: The positive Agrobacterium obtained in step 2.5.1 above was transformed into tobacco epidermal cells. After culturing for 36 h, the localization of the protein was observed using a laser scanning confocal microscope. Meanwhile, co-transformed empty GFP was used as a control.

[0036] Experimental conclusions: such as Figure 6 As shown, by observing the fluorescence signal of GFP, it was found that the empty GFP was expressed in all parts of the leaf cells, while the ZmIQM4 protein was only expressed in the cell nucleus. This indicates that the protein encoded by the ZmIQM4 gene is a nuclear localization protein.

[0037] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. An application of the ZmIQM4 gene in regulating plant seed germination, characterized in that, The nucleotide sequence of the ZmIQM4 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.

5. This encoded protein is located in the cell nucleus.

2. The application according to claim 1, characterized in that, When the ZmIQM4 gene was transferred into the plant genome, the germination rate of plant seeds decreased significantly under ABA-mediated transformation.

3. The application according to claim 2, characterized in that, The plant in question is either Arabidopsis thaliana or maize.

4. The application according to claim 3, characterized in that, The ABA concentration used for ABA-mediated conduction is ≥0.3 μM.

5. A recombinant plasmid, characterized in that, The recombinant plasmid was obtained by transforming the ZmIQM4 gene into an overexpression vector.

6. The application according to claim 5, characterized in that, The overexpression vector is pCAMBIA1305.

7. A method for obtaining ABA-responsive germination-inhibiting transgenic plant varieties, characterized in that, The ZmIQM4 gene was introduced into the Arabidopsis thaliana genome for expression, and germination-inhibiting transgenic Arabidopsis thaliana varieties that respond to the ABA signaling pathway were bred.

Images