Molecular marker, primer pair and kit for identifying megalobrama amblycephala-induced red crucian carp gynogenesis progeny as well as application and method thereof

Abstract

The invention discloses a molecular marker, a primer pair and a kit for identifying megalobrama amblycephala-induced red crucian carp gynogenesis progeny as well as application and a method of the molecular marker. The nucleotide sequence of the molecular marker is shown as SEQ ID NO.1. The invention further discloses a method for identifying megalobrama amblycephala-induced red crucian carp gynogenesis progeny. Based on re-sequencing analysis and genome comparison of megalobrama amblycephala-induced gynogenesis progeny of the red crucian carp, a male parent gene segment from megalobrama amblycephala is screened, and a primer pair with megalobrama amblycephala molecular marker and specificity is developed, so that the megalobrama amblycephala-induced gynogenesis progeny of the red crucian carp can be effectively identified, and the application prospect of the megalobrama amblycephala-induced gynogenesis progeny is broad. The method effectively avoids the problem that identification is difficult due to the fact that appearance is difficult to distinguish, is simple, rapid and high in accuracy, and can play an important role in the field of fish genetic breeding.

Description

Technical Field

[0001] This invention belongs to the field of fish breeding, and particularly relates to a molecular marker, primer pair, reagent kit, and its application and method for identifying gynogenetic offspring. Background Technology

[0002] Gynogenesis technology in fish has extremely important applications in the field of aquatic genetics and breeding. Artificial induction of gynogenesis in fish involves activating the egg with artificially inactivated heterologous sperm, then inhibiting the expulsion of the first polar body or the first cleavage of the fertilized egg, allowing the offspring to develop primarily based on the genetic material of the egg. This method can produce all-female offspring, improving aquaculture efficiency and quality. During gynogenesis, the inactivated sperm used to activate the egg is generally heterologous sperm. Although inactivated heterologous sperm do not participate in heredity, they may influence the traits of offspring through the integration or recombination of chromosomes or DNA fragments, introducing or creating some desirable traits; this is known as the "heterospermia effect."

[0003] Red carp ( Carassius auratus *Carassius redissus* var., a variant of crucian carp, belongs to the family Cyprinidae, subfamily Cyprinoideae, and genus *Carassius*. Due to its strong resistance to adverse conditions, high reproductive capacity, and tender flesh, it has been widely studied and applied in aquaculture and breeding. *Carassius rubescens* (also known as blunt-snout bream) Megalobrama amblycephala The crucian carp (Brachys spp.), belonging to the Cyprinidae family, Culterinae subfamily, and genus *Brachys*, is commonly known as the Wuchang bream or grass bream and is an important economically farmed fish in my country. Gynogenetic crucian carp created by inducing gynogenetic development in crucian carp eggs using inactivated *Brachys spp.* sperm possesses advantages such as rapid growth, strong resistance to adverse conditions, and tender flesh, making it a high-quality germplasm resource that plays a crucial role in fish genetic breeding. However, it is difficult to distinguish gynogenetic crucian carp from wild-type crucian carp based on morphological characteristics, especially in the juvenile stage. Currently, there is no effective method to accurately identify gynogenetic offspring of crucian carp. Therefore, efficiently and accurately identifying gynogenetic offspring of crucian carp is a core problem that needs to be solved. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art above, and to provide a molecular marker and its application for identifying gynogenetic offspring of red crucian carp induced by blunt snout bream, primer pairs and their application, reagent kits and their application, and a method for identifying gynogenetic offspring of red crucian carp induced by blunt snout bream, which can accurately distinguish between gynogenetic red crucian carp and wild-type red crucian carp.

[0005] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows: A molecular marker for identifying gynogenetic offspring of red crucian carp induced by blunt snout bream, the molecular marker being derived from the blunt snout bream genome, the nucleotide sequence of the molecular marker being shown in SEQ ID NO.1.

[0006] As a general technical concept, the present application also provides a primer pair for identifying the offspring of the gynogenesis of red crucian carp induced by Megalobrama amblycephala, which comprises a forward primer F and a reverse primer R, and the nucleotide sequences are as follows: Forward primer F: 5'-GGACTGTGACATGGACTGGG-3' (SEQ ID NO. 2); Reverse primer R: 5'-AGCAAAGGACAATAGATTAAGCGT-3' (SEQ ID NO. 3).

[0007] As a general technical concept, the present application also provides a kit for identifying the offspring of the gynogenesis of red crucian carp induced by Megalobrama amblycephala, which comprises the primer pair described above, and further comprises reagents required for PCR.

[0008] In the kit described above, preferably, one or more of 2x Taq Master Mix and dd H2O are further included.

[0009] As a general technical concept, the present application also provides the use of the molecular marker described above, the primer pair described above or the kit described above in identifying the offspring of the gynogenesis of red crucian carp induced by Megalobrama amblycephala.

[0010] As a general technical concept, the present application also provides a method for identifying the offspring of the gynogenesis of red crucian carp induced by Megalobrama amblycephala, which comprises the following steps: (1) obtaining a DNA sample of the offspring of the gynogenesis of red crucian carp induced by Megalobrama amblycephala to be identified; (2) performing PCR amplification on the DNA sample by using the primer pair described above or the kit described above, and performing gel electrophoresis on the PCR amplification product; (3) confirming the source of the DNA sample according to the result of the gel electrophoresis, and if a 232 bp band appears in the result of the gel electrophoresis, the DNA sample is derived from the offspring of the gynogenesis of red crucian carp induced by Megalobrama amblycephala.

[0011] The method for judging whether it is the offspring of the gynogenesis of red crucian carp induced by Megalobrama amblycephala according to the result of gel electrophoresis is specifically that Megalobrama amblycephala and the offspring of the gynogenesis of red crucian carp induced by Megalobrama amblycephala can amplify a 232 bp reference primer band, and wild-type red crucian carp cannot amplify a band.

[0012] In the method described above, preferably, the reaction system of the PCR amplification is as follows: the total system is 10 μL, which comprises 2x Rapid Taq Master Mix 5 μL, DNA template 1-2 μL, 10 μM of forward primer F and reverse primer R each 0.4-1.2 μL, and dd H2O to make up to 10 μL.

[0013] In the above method, preferably, the amplification procedure of the PCR amplification is as follows: pre-denaturation at 93-98 DEG C for 1-5 min, then denaturation at 94 DEG C for 15-30 sec, annealing at 53-58 DEG C for 15-30 sec, extension at 72 DEG C for 15-30 sec for 30 cycles; then extension at 72 DEG C for 3-10 min; and preservation at 4 DEG C.

[0014] In the above method, preferably, the gel electrophoresis uses an agarose gel with a mass concentration of 1.6-2.5%.

[0015] In the above method, preferably, the DNA sample is derived from a caudal fin of the sample to be tested.

[0016] Compared with the prior art, the present application has the following advantages: 1. The present application combines the resequencing data of the genomes of Mylopharyngodon piceus and Megalobrama amblycephala, and the wild type Mylopharyngodon piceus and the offspring of the Mylopharyngodon piceus induced by Megalobrama amblycephala, and performs bioinformatics analysis, thereby providing a molecular marker, a primer pair and a kit for identifying the offspring of the Mylopharyngodon piceus induced by Megalobrama amblycephala at the gene level. Specifically, the present application is based on resequencing analysis of the offspring of the Mylopharyngodon piceus induced by Megalobrama amblycephala, genome alignment, screening of paternal gene fragments from Megalobrama amblycephala, and development of a primer pair with molecular markers and specificity of Megalobrama amblycephala, which can effectively identify the offspring of the Mylopharyngodon piceus induced by Megalobrama amblycephala, and effectively avoid the difficulty in identification caused by difficult differentiation in appearance. The method of the present application is simple, fast and accurate, and can play an important role in the field of fish genetic breeding.

[0017] 2. The method for identifying the offspring of the Mylopharyngodon piceus induced by Megalobrama amblycephala only needs to collect a caudal fin, extract a DNA sample of the caudal fin, perform PCR amplification and agarose gel electrophoresis, and then determine whether the sample to be tested is the offspring of the Mylopharyngodon piceus induced by Megalobrama amblycephala. The method causes little harm to fish, is suitable for fish from juvenile to adult, can identify the offspring of the Mylopharyngodon piceus induced by Megalobrama amblycephala during embryonic development, and reduces economic losses caused in the later breeding period. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0019] Figure 1Agarose gel electrophoresis figure of the example; in the figure, RCC is wild type red crucian carp, GRCC is the gynogenetic offspring of the mandarin fish induced by the bluegill, and BSB is the bluegill; the lanes M from top to bottom are 1500 bp, 1000 bp, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 400 bp, 300 bp, 200 bp, and 100 bp bands. DETAILED DESCRIPTION

[0020] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present application is not limited to the following specific embodiments.

[0021] Unless otherwise defined, all the professional terms used in the following are the same as those commonly understood by those skilled in the art. The professional terms used in the present application are only for the purpose of describing the specific embodiments, and are not intended to limit the scope of protection of the present application.

[0022] Unless otherwise specified, the various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or can be prepared by existing methods.

[0023] Embodiment: A molecular marker for identifying the gynogenetic offspring of the mandarin fish induced by the bluegill, which is derived from the genome of the bluegill, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1. Specifically as follows: TGATTACATTTCCCTAGGATGTAGAGGACTGTGACATGGACTGGGAAAGTGCCATTTTCCATGAGGAACCATTAACAGCATTTGGAGTTGTGGTTCCAGAACTCCTCCCCCCTCTAAATGAACAAGAAATGAGAAGCCTCCAAGCTGCTGTTGACCCTACAGTGACATCACACTCGAATGGTAGAGACATCTATATTCAGTGCTTTGATATTTTTCACTGACAAATTATGAATACGCTTAATCTATTGTCCTTTGCTTGTTCA.

[0024] The above-mentioned molecular marker can be obtained by the following method: Search the genome data (Genome assembly ASM1881202v1) of the bluegill from the official website of NCBI (National Center for Biotechnology Information) and download it to the local server.

[0025] Open the genome data and annotation file of Megalobrama amblycephala in IGV software, and import the.bam file of the gene fragment from the paternal parent only in the clean data of the resequencing results of the offspring of Megalobrama amblycephala induced gynogenesis of Carassius auratus gibelio.

[0026] Screening the DNA fragments shared by Megalobrama amblycephala and the offspring of Megalobrama amblycephala induced gynogenesis of Carassius auratus gibelio, and selecting the DNA fragments shared by Megalobrama amblycephala and the offspring of Megalobrama amblycephala induced gynogenesis of Carassius auratus gibelio and with high sequencing depth from the above fragments, the total length of the fragments is 263 bp, and the nucleotide sequence is shown as SEQ ID NO. 1.

[0027] The primer pair for identifying the offspring of Megalobrama amblycephala induced gynogenesis of Carassius auratus gibelio in this embodiment comprises a forward primer F and a reverse primer R, the primer pair has high specificity and moderate length, and can stably clone the target fragment. The nucleotide sequence is: Forward primer F: 5'-GGACTGTGACATGGACTGGG-3' (SEQ ID NO. 2); Reverse primer R: 5'-AGCAAAGGACAATAGATTAAGCGT-3' (SEQ ID NO. 3).

[0028] The kit for identifying the offspring of Megalobrama amblycephala induced gynogenesis of Carassius auratus gibelio in this embodiment comprises the primer pair described above, and further comprises one or more of the reagents required for PCR, such as 2x Taq Master Mix and dd H2O.

[0029] The above molecular marker or the above primer pair or the above kit of this embodiment can be used to identify the offspring of Megalobrama amblycephala induced gynogenesis of Carassius auratus gibelio, and the specific method comprises the following steps: (1) Sample collection: collect tail fin samples of 6 wild type Carassius auratus, 6 Megalobrama amblycephala, and 12 offspring of Megalobrama amblycephala induced gynogenesis of Carassius auratus. Wash with physiological saline, absorb water with filter paper, and then store the tail fin in a-80℃ refrigerator for standby.

[0030] (2) DNA extraction: extract genomic DNA from the tail fin samples of wild type Carassius auratus, offspring of Megalobrama amblycephala induced gynogenesis of Carassius auratus, and Megalobrama amblycephala using TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 kit.

[0031] (3) Primer design: design a primer pair using Primer Premier 5, that is, the primer pair is: Forward primer F: 5'-GGACTGTGACATGGACTGGG-3', as shown in SEQ ID NO: 2; Reverse primer R: 5'-AGCAAAGGACAATAGATTAAGCGT-3', as shown in SEQ ID NO: 3.

[0032] (4) PCR amplification: taking the extracted DNA as a template, PCR is carried out by using a primer pair to obtain a PCR product; the PCR system is as follows: 2x Taq Master Mix 5 μL, forward primer F 0.5 μL, reverse primer R 0.5 μL, DNA template 1 μL, double-distilled water 3 μL, and the total volume is 10 μL; The PCR amplification program is as follows: 94℃ pre-denaturation for 5 min, then 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 30 sec for 30 cycles; then 72℃ extension for 10 min; cooling to 16℃ to obtain an amplification product.

[0033] (5) Gel electrophoresis detection: the PCR amplification product is detected by 2.0% agarose gel electrophoresis, 5 μL is spotted, and the electrophoresis result is recorded by a gel imaging instrument.

[0034] The gel imaging result is shown in Figure 1 6 wild-type red crucian carp (RCC) do not amplify a fragment, 12 group head mandarin fish induced red crucian carp gynogenesis offspring (GRCC) and 6 group head mandarin fish (BSB) all amplify a 232 bp band, which is consistent with the sampling result, proving that the identification method of the embodiment is reliable and can be used to identify group head mandarin fish induced red crucian carp gynogenesis offspring and wild-type red crucian carp. Although group head mandarin fish and group head mandarin fish induced red crucian carp gynogenesis offspring both amplify a 232 bp band, they can be distinguished by appearance.

[0035] As can be seen from the above, the present application is based on resequencing analysis of group head mandarin fish induced red crucian carp gynogenesis offspring, genome alignment, screening of paternal gene fragments from group head mandarin fish, development of a primer pair with group head mandarin fish molecular marker and specificity, which can effectively identify group head mandarin fish induced red crucian carp gynogenesis offspring, effectively avoid the difficulty in identification caused by difficult-to-distinguish appearance, and the method is simple, fast and accurate, and can play an important role in the field of fish genetic breeding.

Claims

1. A molecular marker for identifying the offspring of red crucian carp induced gynogenesis by Megalobrama amblycephala, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO.

1.

2. A primer pair for identifying the offspring of red crucian carp induced gynogenesis by Megalobrama amblycephala, characterized in that, The primer pair comprises a forward primer F and a reverse primer R, and the nucleotide sequences thereof are as follows: Forward primer F: 5'-GGACTGTGACATGGACTGGG-3'; Reverse primer R: 5'-AGCAAAGGACAATAGATTAAGCGT-3'.

3. A kit for identifying the offspring of red amur female gynogenesis induced by Ctenopharyngodon idellus, characterized in that, The kit comprises the primer pair as claimed in claim 2.

4. The kit of claim 3, wherein The kit further comprises one or more of 2x Taq Master Mix and dd H2O.

5. Use of the molecular marker as claimed in claim 1 or the primer pair as claimed in claim 2 or the kit as claimed in any one of claims 3-4 in identifying the Acipenser ruthenus female nuclear development offspring induced by Acipenser baerii.

6. A method for identifying the offspring of red amur female gynogenesis induced by Ctenopharyngodon idellus, characterized in that, The kit comprises the following steps: (1) obtaining a DNA sample of the Acipenser baerii induced Acipenser ruthenus female nuclear development offspring to be identified; (2) performing PCR amplification on the DNA sample by using the primer pair as claimed in claim 2 or the kit as claimed in any one of claims 3-4, and performing gel electrophoresis on the PCR amplification product; (3) confirming the source of the DNA sample according to the result of the gel electrophoresis, and if a 232bp band appears in the result of the gel electrophoresis, the DNA sample is derived from the Acipenser baerii induced Acipenser ruthenus female nuclear development offspring.

7. The method of claim 6, wherein, The reaction system of the PCR amplification is as follows: the total system is 10 μL, which comprises 2x Rapid Taq Master Mix 5 μL, DNA template 1-2 μL, 10 μM of forward primer F and reverse primer R each 0.4-1.2 μL, and dd H2O to make up to 10 μL.

8. The method of claim 6, wherein, The amplification procedure of the PCR amplification is as follows: 93-98℃ pre-denaturation for 1-5 min, then 94℃ denaturation for 15-30 sec, 53-58℃ annealing for 15-30 sec, 72℃ extension for 15-30 sec for 30 cycles; then 72℃ extension for 3-10 min; 4℃ preservation.

9. The method of claim 6, wherein, The gel electrophoresis adopts agarose gel with a mass concentration of 1.6-2.5%.

Images