InDel molecular marker for bitter gourd long fruit character identification and application of InDel molecular marker

By developing InDel molecular markers L345 and L504 in bitter gourd, the genetic analysis of fruit growth traits in bitter gourd was solved, enabling efficient and low-cost fruit shape identification and breeding, providing molecular marker resources, and improving breeding efficiency.

CN121249936APending Publication Date: 2026-01-02JIANGSU XUHUAI DISTRICT HUAIYIN AGRI SCI RES INST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511168960.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-20
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Genetic analysis of the fruit-growing trait in bitter gourd suffers from insufficient QTL mapping accuracy, defects in molecular marker technology, and high breeding application costs, hindering its practical application in molecular breeding.

Method used

InDel molecular markers L345 and L504 located on chromosome 6 of bitter melon were developed. By using BSA mapping combined with linkage mapping, the genetic loci controlling the fruit type of bitter melon were detected, providing tightly linked molecular markers for seedling identification of long-fruited or short-fruited plants.

Benefits of technology

This study has enabled efficient and low-cost molecular breeding of bitter gourd fruit types, providing a theoretical basis and molecular marker resources, and improving the accuracy of fruit morphology identification and breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121249936A_ABST
    Figure CN121249936A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of plant molecular genetics, and particularly discloses an InDel molecular marker for bitter gourd long-fruit character identification and application thereof.The InDel molecular marker is characterized in that a long-fruit bitter gourd inbred line '23C57' and a short-fruit bitter gourd inbred line '23C58' are selected as parent materials, four genetic populations containing three generations (P1 (23C57), P2 (23C58), F1 and F2) are constructed, and the genetic populations are constructed; a BSA (Bovine Serum Albumin) positioning and linkage positioning combined method is used for detecting and controlling genetic loci of melon and fruit types and developing molecular markers closely linked with the genetic loci. The InDel molecular marker site excavated by the invention is different from an annotation gene of a homologous long fruit gene reported in cucurbitaceae species in the past, a theoretical basis is provided for molecular breeding of melon and fruit types, and molecular marker resources are enriched.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular genetics technology, and relates to the discovery of specific InDel molecular markers, particularly to an InDel molecular marker for the identification of fruit growth traits in bitter gourd and its application. Background Technology

[0002] Bitter melon (Momordica charantia L.) is an important vegetable crop with both medicinal and edible uses, playing a crucial role in the summer vegetable supply. Its fruit is rich in bitter melon saponins, polypeptide-P, and flavonoids, exhibiting significant hypoglycemic and antioxidant functions. The fruit's morphology directly determines its appearance and consumer acceptance. In recent years, the consumer market has shown a clear preference for long-fruited bitter melon (≥25cm in length) because of its glossy skin and uniform tubercles, which command a higher purchase price in South China than traditional varieties (e.g., "Reyan No. 3" achieved an average increase in income of over 1000 yuan per mu) (Liu Zhaohua 2014). Simultaneously, its low bitterness content and fine fiber meet the needs of both raw consumption and deep processing (e.g., the purchase price of the raw consumption variety "Ruyu 45" in Ningxia reached 20 yuan per jin) (Lai Miaoling 2023; Wu Shuijin, et al. 2013). More importantly, long-fruited varieties have a significantly lower rate of deformed fruit under drip irrigation cultivation compared to short-fruited varieties, directly improving the economic benefits of cultivation. Therefore, the long fruit trait has become one of the core objectives of bitter gourd quality breeding. Although the long fruit trait has significant industrial value, its genetic analysis still faces three bottlenecks: (1) Insufficient QTL mapping accuracy: Research on fruit type of horticultural crops mainly focuses on crops such as cucumber (Ma Kai, et al. 2019), watermelon (Zhang Jinpeng, et al. 2022), and melon (Luan Feishi, et al. 2017). The QTL mapping work on the fruit shape-related traits of bitter gourd is relatively lagging behind other melons, which hinders the practical application of molecular breeding of bitter gourd fruit type (Wang Jing 2024). (2) Defects in molecular marker technology: Existing bitter gourd fruit longness-related markers are mainly SSRs, but their polymorphism depends on the variation in the number of repeating units (such as (GA)). n (3) High cost of breeding applications: Genotyping based on SNP chips is expensive and depends on high-throughput platforms; although SSR markers can be run by conventional PCR, they require fluorescent labeling and capillary electrophoresis. The high cost of the technology system hinders the application of molecular marker-assisted selection (MAS) by small and medium-sized breeding units.

[0003] Therefore, genetic improvement of the long fruit trait in bitter gourd urgently needs to address the three major bottlenecks mentioned above: low positioning accuracy, poor marker usability, and high cost. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide an InDel molecular marker for identifying the fruit-long trait of bitter gourd. The present invention utilizes BSA mapping combined with linkage mapping to detect genetic loci controlling the fruit type of bitter gourd and develops molecular markers closely linked to them. The InDel molecular marker loci discovered by the present invention are different from the annotation genes of homologous fruit-long genes previously reported in Cucurbitaceae species, providing a theoretical basis and molecular marker resources for molecular breeding of bitter gourd fruit type.

[0005] This invention is achieved through the following technical solution:

[0006] An InDel molecular marker for identifying the fruit-growing trait of bitter melon, wherein the molecular marker is located at locus 21919994 on chromosome 6 of bitter melon and is denoted as molecular marker L345;

[0007] And / or, the molecular marker is located at position 22248217 on chromosome 6 of bitter melon, and is denoted as molecular marker L504.

[0008] A further improvement to the present invention is as follows:

[0009] The nucleotide sequence of the molecular marker L345 is shown in SEQ ID NO.1. In the sequence shown in SEQ ID NO.1, the 251st base C from the 5' end is replaced by a 26-base sequence, and the inserted base sequence is GGCATCAGTTTCATCCTAATGTTTTA (SEQ InDel-L345).

[0010] Furthermore, the nucleotide sequence of the molecular marker L504 is shown in SEQ ID NO.2. The sequence shown in SEQ ID NO.2 has 48 bases inserted after the 349th base C from the 5' end. The inserted base sequence is CTACCATACATCA TCAGACACTATAATGTCAACTTTCACCCCACACTC (SEQ InDel-L504).

[0011] Furthermore, this invention protects the application of the aforementioned InDel molecular marker in identifying bitter gourd as long-fruited or short-fruited during the seedling stage.

[0012] Furthermore, the present invention also provides primers comprising the above-mentioned InDel molecular marker, specifically:

[0013] Primers containing L345 are:

[0014] L345-F:GTTGGTAACAAATTGGTCCT (SEQ ID NO.3),

[0015] L345-R:CATGAATTCTGGTAGGTAAC (SEQ ID NO.4);

[0016] Primers containing L504 are:

[0017] L504-F:AACACTAACTCAGAGGACTC(SEQ ID NO.5),

[0018] L504-R:TTGAATGGAAGCCGATGG (SEQ ID NO. 6).

[0019] Furthermore, this invention protects the application of the above primers in identifying bitter gourd as long-fruited or short-fruited during the seedling stage, comprising the following steps:

[0020] Using bitter gourd genomic DNA as a template, primers L345-F / R were used to scan F2 generation single plants. When the amplified band was 280 bp, the plant was a long-fruited plant; when the amplified band was 254 bp, the plant was a short-fruited plant.

[0021] And / or, using bitter gourd genomic DNA as a template, primers L504-F / R were used to scan F2 generation single plants. When the amplified band was 271 bp, the plant was a long-fruited plant; when the amplified band was 223 bp, the plant was a short-fruited plant.

[0022] Furthermore, the present invention also protects a kit comprising the primers of claim 5.

[0023] Furthermore, this invention also protects the application of the reagent kit in identifying bitter gourd as long-fruited or short-fruited during the seedling stage.

[0024] Furthermore, this invention also protects a method for identifying bitter gourd as long-fruited or short-fruited during the seedling stage, comprising the following steps:

[0025] The genomic DNA of the bitter gourd samples to be tested was amplified by PCR using primer L345-F / DR. The PCR amplification products were sequenced. When the insertion of SEQ InDel-L345 was detected after the 21919994th base from the 5' end of chr06, the sample was a long-fruited plant. When the insertion of SEQ InDel-L345 was not detected, the sample was a short-fruited plant.

[0026] And / or, the genomic DNA of the bitter gourd sample to be tested is amplified by PCR using primer L504-DF / R, and the PCR amplification product is sequenced. When the insertion of SEQ InDel-L504 is detected after the 22248217th base C from the 5' end of chr06, the sample is a long-fruited plant; when there is no insertion of SEQ InDel-L504, the sample is a short-fruited plant.

[0027] The sequence of L345-F is shown in SEQ ID NO.3; the sequence of L345-DR is shown in SEQ ID NO.7; the sequence of L504-DF is shown in SEQ ID NO.8; the sequence of L504-R is shown in SEQ ID NO.6; the sequence of SEQ InDel-L345 is GGCATCAGTTTCATCCTAATGTTTTA; the sequence of SEQ InDel-L504 is CTACCATACATCATCAGACACTATAATGTCAACTTTCACCCCACACTC.

[0028] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0029] This invention selects the long-fruited bitter gourd inbred line "23C57" and the short-fruited bitter gourd inbred line "23C58" as parental materials to construct four genetic populations comprising three generations (P1(23C57), P2(23C58), F1, and F2). Using BSA mapping combined with linkage mapping, the genetic loci controlling bitter gourd fruit type were detected, and molecular markers closely linked to these loci were developed. The InDel molecular marker locus discovered in this invention differs from previously reported annotation genes for homologous long-fruited genes in Cucurbitaceae species. The research results provide a theoretical basis and molecular marker resources for molecular breeding of bitter gourd fruit type. Attached Figure Description

[0030] Figure 1 This is a graph showing the polymorphism detection results of the InDel molecular marker of the present invention;

[0031] Among them, A represents the polymorphism detection of the L345 locus between the parents and the F1 generation; B represents the polymorphism detection of the L054 locus between the parents and the F1 generation.

[0032] Figure 2 This is a graph showing the sequencing results of the InDel site in the parent and F2 generations of the present invention.

[0033] Wherein, A represents the sequence detection of the L345 locus in the parent and F2; B represents the sequence detection of the L504 locus in the parent and F2.

[0034] Figure 3This is a scan of some F2 generation single plants using InDel markers, as shown in this invention.

[0035] In this study, A represents 17 individual plants in F2 scanned using the L345 marker; B represents 39 individual plants in F2 scanned using the L504 marker.

[0036] Figure 4 This is a photograph of a single F2 generation long-fruited plant taken by L345-F / R scanning in Example 3 of the present invention;

[0037] Figure 5 This is a photograph of a single F2 generation short-fruited plant obtained by scanning with L504-F / R in Example 3 of this invention. Detailed Implementation

[0038] The present invention will now be described in detail with reference to specific embodiments.

[0039] Test materials:

[0040] In a specific embodiment of the present invention, the long-fruited bitter gourd inbred line '23C57' and the short-fruited bitter gourd inbred line '23C58' were used as parental materials to construct four genetic populations with three generations (P1(23C57), P2(23C58), F1, F2). The genetic loci controlling the fruit type of bitter gourd were detected by BSA mapping combined with linkage mapping and molecular markers closely linked to it were developed.

[0041] Example 1: Screening of InDel sites

[0042] 1. Single-plant DNA extraction

[0043] Bitter gourd shoot tips were taken from individual plants, frozen in liquid nitrogen, and then stored at -70°C for DNA extraction. A modified CTAB method was used for DNA extraction, and the specific steps are as follows:

[0044] (1) Preheat the 2% CTAB extract solution prepared in advance in a 65℃ water bath. While preheating, put the sample into a mortar and add liquid nitrogen to grind it into powder. Transfer the powder to a pre-cooled 2mL centrifuge tube.

[0045] (2) Add 700 μL of CTAB extraction solution to the centrifuge tube, shake well, and incubate in a 65°C water bath for 40 min, inverting and shaking several times every 10 min.

[0046] (3) Add 700 μL of 24:1 (chloroform:isoamyl alcohol volume ratio), mix thoroughly, place in a 4℃ refrigerator and let stand for 10 min, then centrifuge at 10000 r / min for 10 min;

[0047] (4) Take 500 μL of the supernatant into a new centrifuge tube, add 500 μL of 2% CTAB extraction solution, mix well, and incubate in a water bath at 65°C for 30 min, shaking and inverting several times every 10 min.

[0048] (5) Add 500 μL of 25:24:1 (volume ratio of water-saturated phenol: chloroform: isoamyl alcohol), mix thoroughly, let stand in a 4℃ refrigerator for 10 min, and then centrifuge at 10000 r / min for 10 min.

[0049] (6) Take 400 μL of supernatant, add an equal volume (400 μL) of 24:1 (chloroform:isoamyl alcohol volume ratio), mix thoroughly, let stand in a 4℃ refrigerator for 10 min, and then centrifuge at 10000 r / min for 10 min.

[0050] (7) Take 300 μL of supernatant, add an equal volume (300 μL) of pre-cooled isopropanol, gently invert and mix, let stand at -20℃ for 20 min, and then centrifuge at 10000 r / min for 10 min.

[0051] (8) Discard the supernatant, add 1 mL of 70% ethanol to the centrifuge tube to wash the DNA. Generally, wash 2-3 times, centrifuge and discard the ethanol. You can use a pipette tip to remove the residual ethanol in the centrifuge tube to make it dry faster until it becomes transparent.

[0052] (9) Add 50 μL of 0.1% RNase water to the air-dried DNA and incubate in a water bath at 37°C for 30 min to fully dissolve the DNA;

[0053] (10) DNA quality testing: Electrophoresis was performed on a 1% agarose gel, and the integrity, concentration, and purity of the DNA were detected using Nanodrop 2000. When OD260 / OD280 < 1.8, it indicates a high protein content; when OD260 / OD280 > 2.0, it indicates a high RNA content; when OD260 / OD280 = 1.8-2.0, it indicates relatively pure DNA.

[0054] (11) Take a portion of the stock solution, dilute it to 50 ng / μL as a template, store it at -4℃ for later use, and store the remaining stock solution in a refrigerator at -20℃.

[0055] 2. Construction of DNA pooling based on the long-fruit trait

[0056] Two parents with extreme values ​​of long-fruit and short-fruit traits were selected and mixed with two extreme trait populations that showed trait segregation in the F2 generation to construct a pool, which was then stored at -70℃.

[0057] 3. Genomic DNA pooled sequencing and InDel site analysis

[0058] After the genomic DNA from the two pools passed the initial testing, the pooled DNA sequences were fragmented into random fragments using ultrasound. The fragmented DNA underwent sequential end repair, 3′ A-addition, and sequencing adapter ligation. Magnetic beads were then used to adsorb and enrich fragments of approximately 400 bp in length, which were then amplified by PCR to form sequencing libraries. The constructed libraries underwent quality control; those that passed were sequenced using a sequencing platform, with a total read length of 300 bp. After the sequencing data (Raw Data) was processed, quality control was performed to filter out low-quality data, obtaining high-quality data (Clean Data). BWA software was used to align the Clean Data to the reference genome sequence to determine the sequence location. Then, GATK software was used to detect InDel sites between the pools. Based on the characteristics of the mutant pool data, InDel-index values ​​were calculated to screen InDel sites, selecting those with a ΔIndex value greater than 0.4 and a sequencing depth greater than 15. Sequencing analysis identified one InDel at loci 21919994 and 22248217 on chromosome 6 of bitter gourd, respectively, and named L345 and L504.

[0059] Example 2: InDel site verification

[0060] (1) Polymorphism detection

[0061] Download the nucleotide sequences approximately 200-500 bp upstream and downstream of L345 and L504, as shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0062] SEQ ID NO.1

[0063] ATTTTTTCTTTAATTTTATTTAATGCAACAATATACTTTTTATATCATTACAAACTCAACTTATTTCACCAATATGAACGTAGTTCAACAGTTAAACCACTTTACTTTTTTTCTAGGAGTTGAAGATAGATACAGATATATGTCTAAGTCGGCAAAAATTAGGTTAAAAAAAGATATTTTTGGTCTCTATTATTAAAGTAATGCTTTAATCCTTAAATTTTAGTTGGTAACAAATTGGTCCTTATATTTTCACATTGGTAACAATTTAGTGGTTTAAAGTCTGTAATGATTTAATTCCAT CATGAAAAATGTTGTTGAGATTTAATAGTATTTCTTATATGTAGATGGATAAACTTATGAAGAACCAAATATGTTTATAAATTACAAAAACTATATGGTTATATAATAATAAAAAAACAACACTAATTTTGATAGAAATTTTTACGATATAGACTAAATTGTTACCTACCAAGATTCATGAACTAAATGTTATAATGGAGTATAAGAACCAAAATTATTTTTCAACCTAAAAATTATTAAATTCAGATTCATGCTAGTATATAGAAAATATAAATCCGATTTAGTTCCAACCGTATACTCATCGA

[0064] SEQ ID NO. 2

[0065] GACAACGGCTTGGAGTTTCTTGGTCATGTTGGTTTAGAGGTCTCAAGTCCGAACTTTTCGGTGAGCTTAATACCAAAAACTCTTGATGTCTCCCGGATCCAGGCCTTAAAGTGGGTGTGGGTGCCCATGAATATAGTGGAGTAAAGCTCCGACTCCCCGTTATTAAAGAAAAATAATTAGTAAAGAGAGTACCGGAGACTAAGACTAACAACAATATATGCACCAAAAGAAACTGGTAACACATATTAAAGTGCCAAGAGAACACTAACTCAGAGGACTCCAACTTAGCTAGTAACATAAACTACCATACATCATCAGACACTATAATGTCAACTTTCACCCCACACTCACAGAAGAATCATGAAGTAGAAGAATATTTAAACAAACAAAACTTAATACCAAATATAATAATAATAATAATAAAATAAATTAATGATACATTTTAGTAGAGAAGTTCTCATCTCCCCATCGGCTTCCATTCAAGCATCTTCCAGTAGCCTGATCTTCGAAGCATATCACCATGTTCTCTTCAAAATAAGAAGTAATGAGTTAGCCCAAGATCTCCATTCATACGCAGTATTGTAGCCTCTACTCCTATCTA

[0066] The molecular marker primers L345-F / R and L504-F / R containing InDel sites were designed using Primer Premier 5.0.

[0067] L345-F: GTTGGTAACAAATTGGTCCT (SEQ ID NO.3)

[0068] L345-R: CATGAATCTTGGTAGGTAAC (SEQ ID NO.4)

[0069] L504-F: AACACTAACTCAGAGGACTC (SEQ ID NO.5)

[0070] L504-R: TTGAATGGAAGCCGATGG (SEQ ID NO.6)

[0071] The polymorphism of the InDel marker was detected by PCR amplification using the primer pairs described above. The reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2. Polymorphism of the developed InDel marker was detected using parental strains P1, P2, and F1. The results are shown in [Table 2]. Figure 1 It was found that both markers L345 and L504 exhibit stable polymorphism between their parents.

[0072] Table 1 PCR reaction system

[0073]

[0074] Table 2 PCR reaction procedure

[0075]

[0076]

[0077] (2) Authenticity Detection

[0078] Using long-fruited parent P1 and short-fruited parent P2 of bitter gourd as materials, PCR amplification primers L345-F / DR and L504-DF / R containing the InDel site and with a product length greater than 250bp were designed using Primer Premier 5.0.

[0079] L345-F: Same as SEQ ID NO.3

[0080] L345-DR:CGATGAGTATACGGTTGGAAC(SEQ ID NO.7)

[0081] L504-DF:CTCTTGATGTCTCCCGGATCC(SEQ ID NO.8)

[0082] L504-R: Same as SEQ ID NO.6

[0083] PCR amplification was performed using the primer pairs described above. The PCR reaction system is shown in Table 3, and the PCR reaction procedure is shown in Table 4. The authenticity of InDel was verified using PCR sequencing (results are shown in Table 4). Figure 2 ).

[0084] Table 3 PCR reaction system

[0085]

[0086] Table 4 PCR reaction procedure

[0087]

[0088] like Figure 2As shown in A, L345 is a sequence fragment GGCATCAGTTTCATCCTAATGTTTTA (SEQ InDel-L345) (SEQ ID NO. 9) in which the 21919994th base C from the 5' end of chromosome 6 (chr06) is replaced with 26 bases. When the InDel-L345 insertion is detected after the 21919994th base from the 5' end of chr06, the F2 generation sample F2-1 is the same as P1, both being long-fruited plants. When the InDel-L345 insertion is not detected, the F2 generation sample F2-1 is the same as P2, both being short-fruited plants.

[0089] like Figure 2 As shown in B, L504 is an insertion of 48 bases after the 22248217th base C from the 5' end of chr06, with the inserted base sequence being CTACCATACATCATCAGACACTATAATGTCAACTTTCACCCCACACTC (SEQ InDel-L504) (SEQ ID NO.10). When the InDel-L504 insertion is detected after the 22248217th base C from the 5' end of chr06, the F2 generation sample F2-1 is the same as P1, both being long-fruited plants. When the InDel-L504 insertion is not present, the F2 generation sample F2-2 is the same as P2, both being short-fruited plants.

[0090] The above results are consistent with the plant phenotype, indicating that the molecular markers of the present invention can be used to identify bitter gourd as having long or short fruit types.

[0091] Example 3: Application of InDel molecular markers

[0092] Seventeen F2 generation seedlings were collected, and genomic DNA was extracted. Using the genomic DNA as a template, primers L345-F / R were used to scan the 17 F2 generation seedlings. When the amplified band was 280 bp, the plant was a long-fruited plant; when the amplified band was 254 bp, the plant was a short-fruited plant. Figure 3 As shown in A, among the 17 F2 generation populations, plants 1-8 were long-fruited, and plants 10-17 were short-fruited (see corresponding fruit images). Figure 4 ).

[0093] Genomic DNA was extracted from 39 F2 generation seedlings. Using the genomic DNA as a template, primers L504-F / R were used to scan the 39 F2 generation seedlings. When the amplified band was 271 bp, the plant was a long-fruited plant; when the amplified band was 223 bp, the plant was a short-fruited plant. Figure 3As shown in B, among the 39 F2 generation populations, 1, 2, 4-12, 15-17, and 22-24 were long-fruited plants; 14, 18-21, 25-36, and 36 were short-fruited plants; and 3, 13, and 37-39 were heterozygous plants (see corresponding fruit images). Figure 5 ).

[0094] The above description of the embodiments is only for illustrating the technical concept and features of the present invention. Its purpose is to enable those skilled in the art to understand the content of the present invention and implement it accordingly. Those skilled in the art can obviously easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative effort. Therefore, the above embodiments should not be used to limit the scope of protection of the present invention. All improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be covered within the scope of protection of the present invention.

Claims

1. An InDel molecular marker for identifying the fruit-growing trait of bitter melon, characterized in that, The molecular marker is located at position 21919994 on chromosome 6 of bitter melon and is denoted as molecular marker L345. And / or, the molecular marker is located at position 22248217 on chromosome 6 of bitter melon, and is denoted as molecular marker L504.

2. The InDel molecular marker for identifying the fruit elongation trait of bitter melon according to claim 1, characterized in that: The nucleotide sequence of the molecular marker L345 is shown in SEQ ID NO.

1. The 251st base C in the sequence shown in SEQ ID NO. 1 is replaced by a 26-base sequence, which is GGCATCAGTTTCATCCTAATGTTTTA (SEQ InDel-L345).

3. The InDel molecular marker for identifying the fruit elongation trait of bitter melon according to claim 1, characterized in that: The The nucleotide sequence of molecular marker L504 is shown in SEQ ID NO.

2. The sequence shown in SEQ ID NO. 2 has 48 bases inserted after the 349th base C from the 5' end. The inserted base sequence is CTACCATACATCATCAGACACTATAATGTCAACTTTCACCCCACACTC (SEQ InDel-L504).

4. The application of the InDel molecular marker for identifying the long fruit trait of bitter gourd as described in any one of claims 1 to 3 in identifying bitter gourd as long-fruited or short-fruited during the seedling stage.

5. A primer pair comprising the InDel molecular marker site as described in claim 1, characterized in that, Primers containing the molecular marker L345 are: L345-F: GTTGGTAACAAATTGGTCCT (SEQ ID N.3), L345-R: CATGAATCTTGGTAGGTAAC (SEQ ID NO.4); Primers containing the molecular marker L504 are: L504-F: AACACTAACTCAGAGGACTC (SEQ ID NO.5), L504-R: TTGAATGGAAGCCGATGG (SEQ ID NO. 6).

6. The application of the primers as described in claim 5 in identifying bitter gourd as long-fruited or short-fruited during the seedling stage, characterized in that, Includes the following steps: Using bitter gourd genomic DNA as a template, primers L345-F / R were used to scan F2 generation single plants. The PCR amplification products were then subjected to electrophoresis. When the amplified band was 280 bp, the plant was a long-fruited plant; when the amplified band was 254 bp, the plant was a short-fruited plant. And / or, using bitter gourd genomic DNA as a template, primers L504-F / R were used to scan F2 generation single plants, and electrophoresis was performed on the PCR amplification products. When the amplified band was 271 bp, the plant was a long-fruited plant, and when the amplified band was 223 bp, the plant was a short-fruited plant.

7. A reagent kit, characterized in that, The kit contains the primers as described in claim 5.

8. The application of the kit as described in claim 7 in identifying bitter gourd as long-fruited or short-fruited during the seedling stage.

9. A method for identifying bitter gourd as long-fruited or short-fruited during the seedling stage, characterized in that, Includes the following steps: The genomic DNA of the bitter gourd samples to be tested was amplified by PCR using primer L345-F / DR. The PCR amplification products were sequenced. When the insertion of SEQ InDel-L345 was detected after the 21919994th base from the 5' end of chr06, the sample was a long-fruited plant. When the insertion of SEQ InDel-L345 was not detected, the sample was a short-fruited plant. And / or, the genomic DNA of the bitter gourd sample to be tested is amplified by PCR using primer L504-DF / R, and the PCR amplification product is sequenced. When the insertion of SEQ InDel-L504 is detected after the 22248217th base C from the 5' end of chr06, the sample is a long-fruited plant; when there is no insertion of SEQ InDel-L504, the sample is a short-fruited plant. The sequence of L345-F is shown in SEQ ID NO.3; the sequence of L345-DR is shown in SEQ ID NO.7; the sequence of L504-DF is shown in SEQ ID NO.8; the sequence of L504-R is shown in SEQ ID NO.6; the sequence of SEQ InDel-L345 is GGCATCAGTTTCATCCTAATGTTTTA; and the sequence of SEQ InDel-L504 is CTACCATACATCATCAGACACTATAATGTCAACTTTCACCCCACACTC.