Method for evaluating or predicting chlorophyll content of sugarcane

Abstract

The invention provides a method for evaluating or predicting the chlorophyll content of sugarcane, which utilizes a molecular marker obviously associated with the chlorophyll content of sugarcane to accurately distinguish germplasm with high / low chlorophyll content. The method is suitable for sugarcane filial generation screening, core germplasm evaluation and gene localization, and provides a direct target for sugarcane photosynthetic efficiency improvement. The molecular marker is developed based on a GWAS method of Kmer, and the method avoids allele dose estimation deviation caused by traditional sugarcane high-power genetic complexity and can solve the problem that sugarcane correlation analysis is difficult.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of sugarcane breeding, in particular to a method for evaluating or predicting the chlorophyll content of sugarcane. BACKGROUND

[0002] Sugarcane is an important economic and energy crop, and also the highest biomass crop. Plants convert light energy into organic matter through photosynthesis, and chlorophyll is a key pigment in photosynthesis, which can absorb light energy and convert it into chemical energy, thereby driving plant growth and biomass accumulation. The level of chlorophyll content is directly related to the photosynthetic efficiency and final yield of sugarcane. Therefore, breeding sugarcane varieties with high chlorophyll content is an important way to improve yield.

[0003] However, current sugarcane breeding mainly uses hybridization to produce offspring, and mainly relies on phenotypic selection of hybrid offspring. This method has two major limitations: first, it is highly blind, as the chlorophyll content is determined by leaf color and other phenotypes, which are easily affected by the environment; second, it is labor-intensive, as the phenotype can only be evaluated after field planting, resulting in a long breeding cycle.

[0004] Molecular marker-assisted selection breeding can shorten the breeding cycle by detecting genetic markers associated with target traits at an early stage, and has been widely used in crops such as corn and rice. However, due to the high ploidy and complex genetic background of sugarcane, traditional gene mapping methods have difficulty in accurately analyzing allelic dosage effects, resulting in few reports of chlorophyll-related molecular markers, which severely limits the efficient breeding process of sugarcane.

[0005] Genome-wide association analysis (GWAS) is an important method for analyzing important agronomic traits. This method can quickly identify genetic loci associated with important agronomic traits, especially the development of Kmer-based polyploid genome-wide association analysis method (KMERIA, https: / / github.com / Sh1ne111 / KMERIA), which effectively solves the difficulties in genotyping polyploid plants and the incorrect estimation of allelic dosage effects in polyploid species, providing a powerful tool for analyzing the genetic basis of important agronomic traits in sugarcane and developing molecular markers. Based on this method, the present application develops molecular markers associated with chlorophyll synthesis in sugarcane, providing technical support for efficient breeding of sugarcane. SUMMARY

[0006] The purpose of the present application is to overcome the shortcomings of the prior art and provide a method for evaluating or predicting the chlorophyll content of sugarcane.

[0007] The first purpose of the present application is to provide an application of a reagent for detecting the genotype of a sugarcane molecular marker.

[0008] A second object of the present application is to provide a method for evaluating or predicting the chlorophyll content of sugarcane.

[0009] A third object of the present application is to provide a method for evaluating or predicting the chlorophyll content of sugarcane.

[0010] A fourth object of the present application is to provide a primer for detecting or evaluating the chlorophyll content of sugarcane.

[0011] A fifth object of the present application is to provide a kit for detecting or evaluating the chlorophyll content of sugarcane.

[0012] A sixth object of the present application is to provide the use of the primer or the kit.

[0013] A seventh object of the present application is to provide the use of the primer.

[0014] To achieve the above objects, the present application is implemented by the following technical solutions: The use of a reagent for detecting the genotype of a molecular marker of sugarcane, wherein the molecular marker is located at Chr01g1_96193007, and the chlorophyll content of individuals with GG genotype is significantly higher than that of individuals with AG or AA genotype. The use is one or several of the following: Evaluating or predicting the chlorophyll content of sugarcane; Breeding sugarcane with high chlorophyll content; Screening sugarcane lines with high chlorophyll content; Molecular breeding of sugarcane with high chlorophyll content.

[0015] A method for evaluating or predicting the chlorophyll content of sugarcane, wherein the genotype of Chr01g1_96193007 is detected, and the chlorophyll content of individuals with GG genotype is significantly higher than that of individuals with AG or AA genotype.

[0016] Preferably, the sample DNA is subjected to PCR amplification using primers with nucleotide sequences as shown in SEQ ID NO: 1 to 2 to detect the genotype of Chr01g1_96193007.

[0017] A breeding method for sugarcane with high chlorophyll content, wherein sugarcane with GG genotype at Chr01g1_96193007 is selected as the parent for breeding of sugarcane.

[0018] Preferably, the sample DNA is subjected to PCR amplification using primers with nucleotide sequences as shown in SEQ ID NO: 1 to 2 to detect the genotype of Chr01g1_96193007.

[0019] A primer for detecting or evaluating the chlorophyll content of sugarcane, the nucleotide sequence of which is shown as SEQ ID NO: 1 to 2 A kit for detecting or evaluating the chlorophyll content of sugarcane, containing the primer.

[0020] Preferably, it contains PCR reagents.

[0021] The application of the primer or the kit is one or several of the following: Evaluating or predicting the chlorophyll content of sugarcane; Breeding sugarcane with high chlorophyll content; Screening sugarcane lines with high chlorophyll content; Molecular breeding of sugarcane with high chlorophyll content.

[0022] The application of the primer is one or several of the following: Preparing a kit for evaluating or predicting the chlorophyll content of sugarcane; Preparing a kit for breeding sugarcane with high chlorophyll content; Preparing a kit for screening sugarcane lines with high chlorophyll content; Preparing a kit for molecular breeding of sugarcane with high chlorophyll content.

[0023] Compared with the prior art, the present application has the following beneficial effects: The present application provides a method for evaluating or predicting the chlorophyll content of sugarcane, which is based on a molecular marker significantly associated (P<1e-7) with the chlorophyll content of sugarcane, which can be used to accurately distinguish high / low chlorophyll content germplasm; It is suitable for screening of sugarcane hybrid offspring, evaluation of core germplasm and gene positioning, and provides a direct target for improvement of photosynthetic efficiency of sugarcane.

[0024] The molecular marker of the present application is developed based on the Kmer GWAS method, which avoids the allelic dosage estimation bias caused by the traditional sugarcane polyploid genetic complexity, and can solve the problem of sugarcane association analysis. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 Fig. 1 is the frequency distribution and QQ plot of the chlorophyll content of the Guangxi population; A is a frequency distribution histogram, the horizontal axis is the SPAD value, and the vertical axis is the number of germplasm; B is a QQ plot, which shows that the SPAD value of the population is normally distributed, meeting the conditions for GWAS analysis.

[0026] Figure 2 Fig. 2 is the frequency distribution and QQ plot of the chlorophyll content of the Yunnan population; A is a frequency distribution histogram, the horizontal axis is the SPAD value, and the vertical axis is the number of germplasm; B is a QQ plot, which shows that the SPAD value of the population is normally distributed, meeting the conditions for GWAS analysis.

[0027] Figure 3 Manhattan plot for SPAD genome-wide association analysis; horizontal axis is genome position (ordered by chromosome), vertical axis is -log10 (P), red dotted line is the significant threshold line (P = 1e-7), black arrow is the SNP site corresponding to Kmer Chr01g1_96193007. DETAILED DESCRIPTION

[0028] In order to make the purposes, technical solutions and advantages of the present application more clear, the present application is further described in detail below in combination with the drawings and examples. It should be understood that the specific examples described herein are only used to explain the present application and do not limit the present application. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified.

[0029] Example 1 Detection and analysis of chlorophyll content of sugarcane population in multiple environments I. Experimental materials From a sugarcane core germplasm population covering different genetic backgrounds (including domestic and foreign core germplasms), 603 germplasms were selected by random block design sampling as objects for subsequent investigation of chlorophyll content. Each germplasm was planted in Guangxi and Yunnan two planting bases (as a repetition of environment), 15 plants of each germplasm were planted, and the plant management used conventional water and fertilizer management, the plant spacing was 1.2m x 0.5m, and 10 plants were randomly selected from each germplasm as test materials using random block design sampling.

[0030] II. Experimental methods (1) Detection of chlorophyll In August 2024, a chlorophyll meter (SPAD-502 meter) was used to measure the SPAD value (Soil-Plant Analysis Development) of the leaves of 603 germplasms planted in two environments, 10 plants of each germplasm were selected for detection, and the SPAD value of the middle part of the third fully expanded leaf of each plant was measured.

[0031] (2) Data analysis Descriptive statistical analysis was performed on the population SPAD value.

[0032] III. Experimental results The results showed that the population SPAD value ranged from 23.42 to 66.4, the mean was 45.64, and the standard deviation was 5.79, indicating that the population phenotype variation was rich, which conformed to the normal distribution and was suitable for association analysis (see Table 1, Fig. 1, Figure 2 ), which met the requirements of GWAS analysis.

[0033] Table 1. Descriptive statistics of SPAD of population .

[0034] Example 2 Resequencing of sugarcane population materials and whole genome association analysis of chlorophyll content I. Experimental methods 1. Whole genome sequencing and construction of KMER matrix (1) Whole genome resequencing: The 603 germplasms of Example 1 were subjected to whole genome resequencing using the Huada DNBSEQ sequencing platform, with a sequencing strategy of 150 bp double-end sequencing and a sequencing depth of ≥10x. The raw sequencing data was subjected to adapter sequence and low-quality read removal using Trimmomatic software, and the clean reads with Q30≥90% were retained as the quality-controlled clean reads for subsequent analysis.

[0035] (2) Kmer extraction: KMC3 software was used to extract Kmers (short sequence fragments) from the quality-controlled clean reads, with K=31, filtering Kmers with an occurrence frequency of <5 times (to exclude sequencing errors), and retaining Kmers with an occurrence frequency of ≥5% in the population.

[0036] (3) Kmer matrix construction: The occurrence number of each Kmer in each germplasm was counted, and a "germplasm-Kmer" count matrix (rows representing germplasms, columns representing Kmers, and values being the total count of Kmers in the germplasm, 31-mer) was constructed as the genotype data for association analysis.

[0037] 2. Whole genome association analysis based on KMERIA The k-mer whole genome association analysis of polyploid sugarcane was realized using the KMERIA toolkit (https: / / github.com / Sh1ne111 / KMERIA), and the core processes included k-mer matrix standardization, population genetic structure correction, construction of kinship matrix, and screening of significantly associated K-mers with SPAD, with the specific steps as follows: K-mer matrix standardization: The constructed "germplasm-k-mer" count matrix (31-mer) was subjected to format conversion by the kmeriakctm2 module to generate a dosage matrix suitable for association analysis (BIMBAM format), with the parameter --filter-rare 0.05 (filtering k-mers with a population occurrence frequency of <5%) set to retain high-quality k-mers for subsequent analysis.

[0038] Population genetic structure correction: Principal component analysis (PCA) was performed on the normalized k-mer matrix using the kmeria pca module, and the first three principal components (PC1-PC3) were extracted as population stratification covariates to control false positive associations caused by population structure.

[0039] Kinship matrix construction: The kinship matrix between samples was calculated by the kmeria kin module, and the genetic distance between individuals was estimated based on the similarity of k-mer sequences.

[0040] Screening of K-mers significantly associated with SPAD: The MLM model integrated by KMERIA was used, and the k-mer dosage matrix was used as the genotype input and the SPAD value of the population in Example 1 was used as the phenotype data for association. The association analysis was performed by the kmeria assoc module, and the parameter --model mlm --p-threshold 1e-7 was set. The P<1e-7 corrected by Bonferroni was used as the significant association threshold, and finally the K-mers significantly associated with SPAD were obtained, and the positions thereof were used as candidate regions.

[0041] 3. Localization of significantly associated Kmers and analysis of associated site variations Sequence localization: Using BLAST, the significantly associated Kmers were aligned with the constructed high-quality reference genome of sugarcane variety POJ2878 (assembly number: GWHGPWU00000000.1 (https: / / ngdc.cncb.ac.cn / gwh / Assembly / 101648 / show), BioProject number: PRJCA045391, BioSample number: SAMC5813343) to locate the physical position of the significantly associated K-mers, further confirm the candidate regions, and visualize them through Manhattan plots.

[0042] Variation analysis: Using POJ2878 as the reference genome, the standard GATK process was used to identify the genotypes of the candidate regions, providing accurate genotypes for subsequent genotype and phenotype association identification.

[0043] Association site identification: The genotypes of each site in the candidate region were extracted, and the LMM model was used to perform secondary association analysis of the genotypes and corresponding SPAD values to obtain the significantly associated sites with the phenotype variations.

[0044] II. Experimental results Using the Huada DNBSEQ platform for 150 bp double-end sequencing, the various qualities obtained an average data volume of 119 Gb data, an average sequencing depth of 13.47x, and Q30≥92%; after standardization of the k-mer matrix, 1,245,680 Kmers were retained for constructing the count matrix; Figure 3 The Manhattan plot for significantly associated k-mers is shown in FIG. 1. It can be seen that there is a significant peak on the Chr01g1 chromosome.

[0045] The secondary association analysis showed that the genotype of the molecular marker located at Chr01g1_96193007 (i.e., the 96193007th base of the Chr01g1 chromosome) was significantly associated with the chlorophyll content (q value = 0.00157).

[0046] Example 3 Correlation of genotypes of multi-environment populations with SPAD values I. Experimental methods The genotypes of the molecular marker at Chr01g1_96193007 of each sample in Example 2 were extracted using bcftools, and the correlation of genotypes and SPAD values was analyzed for each landrace in the two environments, respectively.

[0047] II. Experimental methods The results are shown in Table 2. For the sample populations in different environments, the chlorophyll content of the GG genotype at Chr01g1:96193007 was significantly higher than that of the AG and AA genotypes of the landraces.

[0048] Table 2 Correlation of chlorophyll content and genotypes of each population

[0049] Note: The significance is the significance between the GG genotype and the AG and AA genotypes, respectively. P < 0.05, P < 0.01.

[0050] Example 4 Correlation of genotypes of F1 populations with SPAD values I. Experimental materials Three sugarcane cross combinations (CP72-1210 x HoCP95-988, CP89-2143 x Guire 2, and HoCP07-617 x HoCP01-517) were used to construct an F1 population with rich phenotypes. The population was planted in the experimental site in Guangxi, and the planting management was the same as in Example 1. 100 sugarcane lines were randomly selected from the F1 population as test samples.

[0051] II. Experimental methods The SPAD values of the above samples were detected according to the method of Example 1, and total DNA of each sample leaf was extracted, ensuring that the concentration of DNA of each sample was greater than 150 μg / μL, and A260 / A280 was between 1.8 and 2.0.

[0052] The primer for amplifying the site of Chr01g1:96193007 was designed as follows based on the reference genome POJ2878: Forward primer F: ACACCGTTTCTGCAGAGCA (SEQ ID NO: 1), Reverse primer R: CTGCTTCCGAGTGTTCCTGT (SEQ ID NO: 2).

[0053] The sample DNA was subjected to PCR amplification, and the amplification system and amplification program are shown in Table 3 and Table 4, respectively.

[0054] Table 3:

[0055] Table 4:

[0056] The amplified products were sequenced, and the genotypes of the molecular markers located at Chr01g1:96193007 of each sample were counted, respectively, and the correlation with the SPAD value was analyzed.

[0057] III. Experimental results The results showed that the amplified products were as follows (SEQ ID NO: 3): ACACCGTTTCTGCAGAGCA TACACAGAGTCGTAGACTAAGGGTGTGTTCAGTTAGTGAAAAGTGAGTAAAAAATTACTGTAGCACCTTTCGTTGTTATTTGACAAAATTTGTCTAACCATAGACTAACTAGGCTCAAAAGATTCGTCTCGACATTTACAGACAAACTATGCNATTAGTTATCTTTTTTACCTACATTTAATGTTCCATACGTCCAAAGATTTGATGTGATGGGTGGAAAAGGAAATATTTTAGGTTTGCATAGGAAGTGAACACACCCTAAGGCTAAGTACTGGTACAGAGT ACAGGAACACTCGGAAGCAG .

[0058] Chr01g1_96193007, which is the 172nd base of the amplified product, has a genotype of A or G. Correlation analysis shows (Table 5) that the site Chr01g1_96193007 is significantly correlated with chlorophyll content, and the chlorophyll content of individuals with GG genotype is significantly higher than that of individuals with AG and AA genotypes.

[0059] Table 5

[0060] Note: The significance is the significance between GG genotype and AG, AA genotype, respectively. P < 0.05, P < 0.01.

Claims

1. Use of a reagent for detecting the genotype of a molecular marker of sugar cane, characterized in that, The molecular marker is located at Chr01g1_96193007, and the chlorophyll content of individuals with GG genotype is significantly higher than that of individuals with AG or AA genotype; The application is one or several of the following: evaluating or predicting the chlorophyll content of sugarcane; breeding sugarcane with high chlorophyll content; screening sugarcane lines with high chlorophyll content; molecular breeding of sugarcane with high chlorophyll content.

2. A method of assessing or predicting the chlorophyll content of sugar cane leaves characterised by, The chlorophyll content of individuals with GG genotype at Chr01g1_96193007 locus is significantly higher than that of individuals with AG or AA genotype.

3. The method of claim 2, wherein, The sample DNA is subjected to PCR amplification using primers with nucleotide sequences as shown in SEQ ID NO: 1 to 2 to detect the genotype of Chr01g1_96193007 locus.

4. A breeding method of sugarcane with high chlorophyll content, characterized in that, Sugarcane with GG genotype at Chr01g1_96193007 locus is selected as parent to breed sugarcane.

5. The breeding method according to claim 4, characterized in that, The sample DNA is subjected to PCR amplification using primers with nucleotide sequences as shown in SEQ ID NO: 1 to 2 to detect the genotype of Chr01g1_96193007 locus.

6. A primer for detecting or evaluating the chlorophyll content of sugarcane leaves, characterized by, The nucleotide sequence is as shown in SEQ ID NO: 1 to 2.

7. A kit for detecting or assessing the chlorophyll content of sugar cane leaves, characterised in that, The primer of claim 6 is contained.

8. The kit of claim 7, wherein PCR reagents are contained.

9. Use of a primer according to claim 6 or a kit according to claim 7, characterized in that, The application is one or several of the following: evaluating or predicting the chlorophyll content of sugarcane; breeding sugarcane with high chlorophyll content; screening sugarcane lines with high chlorophyll content; 10. Use of the primer according to claim 6, characterized in that, molecular breeding of sugarcane with high chlorophyll content. The application is one or several of the following: preparing a kit for evaluating or predicting the chlorophyll content of sugarcane; preparing a kit for breeding sugarcane with high chlorophyll content; preparing a kit for screening sugarcane lines with high chlorophyll content; preparing a kit for molecular breeding of sugarcane with high chlorophyll content.

Images