SNP (Single Nucleotide Polymorphism) molecular marker related to broad bean early blossoming character and application

Abstract

The invention relates to the technical field of molecular genetic breeding, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker related to a broad bean early blossoming character and application. The SNP molecular marker is located at a first chromosome Chr1L-1358720341 of a broad bean genome, and a base polymorphism site is T / C; the method comprises the following steps: extracting genome DNA (Deoxyribonucleic Acid) of broad beans to be detected, carrying out fluorescent PCR (Polymerase Chain Reaction) detection on SNP (Single Nucleotide Polymorphism) molecular markers by utilizing primers, determining the genotypes of the broad beans, enabling broad bean individuals with the genotype of CC to bloom earlier, and enabling broad bean individuals with the genotype of TT to bloom later; the broad bean early blossoming character related molecular marker is developed and applied to early-maturing variety breeding to identify or assist in identifying the broad bean early-maturing variety, field screening of high-yield early-maturing broad bean breeding materials is facilitated, and the broad bean breeding process is accelerated.

Description

Technical Field

[0001] This invention relates to the field of molecular genetic breeding technology, specifically to an SNP molecular marker related to the early flowering trait of broad beans and its application. Background Technology

[0002] broad bean( Vicia faba L. As an important economic crop in my country, the timing of its flowering directly determines the product's market availability and economic benefits. Early-flowering varieties can significantly shorten the growth cycle, allowing the product to be marketed earlier. Traditional breeding methods have low efficiency in selecting flowering traits, making it urgent to develop a reliable molecular marker-assisted breeding system.

[0003] Currently, research on the molecular regulatory mechanisms of broad bean flowering time is relatively lagging, especially the discovery and identification of molecular markers based on vernalization-related genes.

[0004] Large-scale population resequencing of the genome is costly, and there are currently no relevant reports both domestically and internationally. Therefore, how to develop efficient molecular markers using existing methods has become a key focus of broad bean genetic research. This invention utilizes transcriptome sequencing technology as a foundation, and through data analysis, key gene mining and validation, provides an efficient means to discover vernalization-related genes in broad beans. By comparing the differences in gene expression before and after vernalization treatment in two different broad bean varieties, key genes closely related to the vernalization pathway can be identified. Notably, intronless genes, due to their simple structure and lack of RNA splicing requirements, can rapidly respond to environmental signals and regulate flowering time, making them ideal targets for developing molecular markers. Therefore, this invention is based on transcriptome data of broad beans before and after vernalization. It mines differentially expressed intronless genes related to vernalization and develops KASP molecular markers from these differentially expressed genes for early-maturing broad bean breeding.

[0005] Therefore, transcriptome data mining can quickly respond to environmental signals and vernalization-related intronless genes, and use these genes to develop markers related to early flowering traits, which is of great significance for screening early-maturing broad bean varieties. Summary of the Invention

[0006] To address the shortcomings of the existing technologies, this invention aims to provide a SNP molecular marker related to the early flowering trait of broad beans and its application, providing a new molecular marker for the identification of early flowering traits in broad beans or the cultivation of early-maturing broad bean varieties.

[0007] To solve the above problems, the present invention adopts the following technical solution: In a first aspect, the present invention provides an SNP molecular marker associated with the early flowering trait of broad bean, wherein the SNP molecular marker is located on chromosome 1 of the broad bean genome, Chr1L-1358720341, and the base polymorphism site is T / C.

[0008] Further, the SNP molecular marker is located in an intronless gene VfERF017 .

[0009] Further, the flowering time of the chickpea individual with genotype CC of the SNP molecular marker is earlier than that of the chickpea individual with genotype TT.

[0010] In a second aspect, the present application provides a primer for detecting the SNP molecular marker, comprising a forward primer as shown in SEQ ID NO. 2 and SEQ ID NO. 3 and a reverse primer as shown in SEQ ID NO. 4.

[0011] In a third aspect, the present application provides a kit for detecting the SNP molecular marker, comprising the primer.

[0012] In a fourth aspect, the present application provides a method for identifying the early flowering trait of chickpea, extracting the genomic DNA of the chickpea to be detected, performing fluorescent PCR detection on the SNP molecular marker by using the primer, and determining the genotype. The flowering time of the chickpea individual with genotype CC is earlier, and the flowering time of the chickpea individual with genotype TT is later.

[0013] Further, the program of the fluorescent PCR detection comprises: pre-denaturation at 4 ℃ for 15 min, 1 cycle; denaturation at 94 ℃ for 20 s, annealing at 57 ℃ for 60 s, 10 cycles, wherein the annealing temperature decreases by 0.8 ℃ for each cycle; denaturation at 94 ℃ for 20 s, annealing at 55 ℃ for 60 s, 26 cycles; and extension at 30 ℃ for 60 s.

[0014] Further, the fluorescent signal of the fluorescent PCR detection is blue, and the genotype is CC; and the fluorescent signal is red, and the genotype is TT.

[0015] In a fifth aspect, the present application provides a method for breeding an early-maturing chickpea strain, extracting the genomic DNA of the chickpea to be detected, detecting the genotype of the SNP molecular marker by using the primer, and selecting the chickpea individual with genotype CC for breeding.

[0016] In a sixth aspect, the present application provides the SNP molecular marker for identifying the early flowering trait of chickpea or screening the early-maturing chickpea strain.

[0017] In a seventh aspect, the present application provides the primer or the kit for preparing a reagent for identifying the early flowering trait of chickpea or screening the early-maturing chickpea strain.

[0018] The beneficial effects of the present application are that: the present application takes 117 natural populations of chickpea as the test object, combines the use of transcriptome analysis technology, identifies a SNP site Chr1L-1358720341 located on the intronless gene of chickpea which is significantly related to the early flowering trait of chickpea, designs primers according to the target SNP site, develops a KASP molecular marker related to the early flowering trait of chickpea, and applies it to the early-maturing variety breeding, which can be used to identify or assist in identifying early-maturing chickpea varieties. The KASP molecular marker of the present application can detect multiple samples with high throughput, and the sample genotyping effect is obvious, which is beneficial to the field screening of high-yield early-maturing chickpea breeding materials and accelerates the breeding process of chickpea. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Fig. 1 is a comparison chart of two chickpea varieties of vernalization and non-vernalization phenotypes; wherein A is a comparison chart of Yun Dou 1183 vernalization phenotypes before and after (left is vernalized, right is not vernalized); B is a local enlarged image of A; C is a comparison chart of Hai Qing No. 1 vernalization phenotypes before and after (left is vernalized, right is not vernalized); D is a local enlarged image of C.

[0020] Figure 2 Fig. 2 is a volcano plot of two chickpea varieties of intronless differential genes of transcriptome.

[0021] Fig. 3 is an analysis of two chickpea varieties of intronless differential genes; wherein A is a KEGG enrichment analysis chart of differential genes; B is a GO enrichment analysis chart of differential genes; C is a Wayne chart of differential genes.

[0022] Fig. 4 is VfERF017 a protein network interaction chart of CBFs and vernalization genes; wherein A is an expression heat map of 58 intronless differential genes; B is VfERF017 differential expression RT-PCR analysis; C is VfERF017 protein network analysis; D is VfERF017 LUC experiment verification of interaction with CBF4.

[0023] Figure 5 Fig. 5 is a detection result chart of molecular markers on different genotypes of flowering trait related alleles; A is a detection result chart of molecular markers on 89 representative chickpea germplasm resources; B is a difference analysis chart between genotypes and flowering traits. DETAILED DESCRIPTION

[0024] The present application will be further described in detail below in combination with specific embodiments.

[0025] It should be noted that these embodiments are only used to illustrate the present application, but not to limit the present application, and simple improvements of the present method under the concept of the present application all belong to the scope of protection of the present application.

[0026] Example 1 Transcriptome analysis was used to identify intronless differentially expressed genes significantly associated with vernalization in broad beans. Experimental materials: Two broad bean varieties, Yun Dou 1183 and Hai Qing No. 1, provided by the Institute of Economic Crops, Jiangsu Academy of Agricultural Sciences, were used as experimental materials. The treatments were as follows, and the experiment was conducted in the greenhouse of the Institute of Economic Crops, Jiangsu Academy of Agricultural Sciences. Broad beans of the same variety were divided into two groups. One group was treated with a low temperature of 4℃ for 14 days during the seed germination stage, while the other group was not treated with low temperature and served as a control. Figure 1 To ensure consistent growth in both groups, flowers were harvested from flowering varieties, and leaves from non-flowering varieties were harvested at the same time. Each treatment was replicated three times, and the transcriptomes were analyzed.

[0027] Experimental results: Transcriptome analysis revealed that genes with pvalue < 0.05 and |log2 FC| > 1 were differentially expressed genes without introns. Figure 2 The two varieties share a total of 58 intronless differential genes. Figure 3 C. This study analyzed the biological processes involved by these genes, which are mainly involved in tissue development (3A). GO enrichment analysis showed that these genes are mainly involved in the biosynthesis of flavonoids and flavonols, folic acid synthesis, and arginine and proline metabolism (see [reference needed]). Figure 3 B.

[0028] Example 2 VfERF017 Protein network with vernalization genes CBFs Experimental materials: BLAST plugin in Tbtools, fava bean proteome data, Arabidopsis thaliana proteome data (TAIR11). LUC experimental analysis was performed, and nLUC, cLUC, and nLUC- were analyzed. VfERF017 The carrier and cLUC-CBF are transferred into tobacco leaves. For predicted... VfERF017 The protein network of vernalization gene CBFs was validated.

[0029] Experimental results: Fifty-eight intronless differentially expressed genes were compared with the Arabidopsis protein database (TAIR11) using BLAST and relevant literature was consulted. In Arabidopsis, the gene AT1G46768, which is closely related to vernalization regulation of flowering, was identified. It belongs to the AP2 / ERF transcription factor family. Its homolog in broad bean is Vfaba.Tiffany.R1.1g333280. VfERF017 The changes in FPKM values ​​of other 57 co-occurring intronless differentially expressed genes before and after vernalization treatment in transcriptome analysis are as follows: Figure 4 As shown in Figure A, the results were verified by RT-PCR experiments. VfERF017 Significant changes in expression before and after spring flowering, such as Figure 4 B. Simultaneously analyzedVfERF017 Participating protein networks, such as Figure 4 As shown in C VfERF017 and CBF1 and CBF4 interact significantly. This was verified by LUC experiments. VfERF017 and The interaction relationships of CBF4, such as Figure 4 D, and VfERF017 and No CBF1 interaction signal was detected.

[0030] Example 3 Development of KASP molecular markers associated with early flowering trait in broad bean Based on the SNP variant information from the above transcriptome analysis, In VfERF017 A variant site exists on the exon (360 bp from the starter). Its sequence in the genome (located at position 42 as shown in SEQ ID NO.1) was used to design primers for the SNP variant site using PrimerBlast from NCBI. These primers include forward primer F1, forward primer F2, and reverse primer R. F1 and F2 contain FAM and HEX fluorescent linker sequences (the bolded parts in the sequences), respectively. The specific sequences are as follows: SEQ ID NO. 1: CGGATCCGGGTCAACCCGATAATAATTTGGTGGAGTCTCCTTCTGAGGGAACTGCATTGTTGTTGCCTATGGAATCGGAATCACTGTCTCCGGCGGTTTCG.

[0031] Label the forward primer F1, SEQ ID NO.2: 5'- GAAGGTGACCAAGTTCATGCTCGATAATAATTTGGTGGAGTCTCCTT - 3'.

[0032] Label the forward primer F2, SEQ ID NO.3: 5'- GAAGGTCGGAGTCAACGGATTCGATAATAATTTGGTGGAGTCTCCTC - 3'.

[0033] The reverse primer R is labeled, SEQ ID NO.4: 5'- GATTCCGATTCCATAGGCAAC-3'.

[0034] Example 4 Application of KASP molecular markers in the identification of alleles related to early flowering traits in broad beans Experimental materials: 89 representative Vicia faba germplasm resources were planted in the greenhouse of the Institute of Economic Crops, Jiangsu Academy of Agricultural Sciences in 2024. Fertilize and water reasonably, and record the flowering period of Vicia faba. The KASP molecular marker effect of 117 materials was verified. The CTAB method was used to extract genomic DNA from leaf tissues of 89 Vicia faba materials. The extracted DNA was used as a template for PCR amplification and fluorescence signal collection and genotyping.

[0035] The amplification system was 10.0 μL reaction system: Vicia faba DNA template 2 μL (20 ng / μL), 2× KASP MasterMix 5 μL (Wuhan Zhongke Biotechnology), primer working solution (F1 : F2 : R = 1 : 1 : 3) 1 μL, and ddH2O 2.0 µL. The specific procedure was as follows: Step 1: pre-denaturation at 4 ℃ for 15 min, 1 cycle; Step 2: 10 cycles of 94 ℃ denaturation for 20 s, 57 ℃ annealing for 60 s, with a decrease of 0.8 ℃ in annealing temperature for each cycle; Step 3: 94 ℃ denaturation for 20 s, annealing temperature set to 55 ℃ for 60 s, 26 cycles; Step 4: 30 ℃ extension for 60 s. The QuantStudio 5 fluorescence quantitative instrument was used for fluorescence signal reading and genotyping of the products.

[0036] Experimental results: 89 Vicia faba materials were amplified and genotyped (Table 1). The fluorescence signal collection results showed that 17 Vicia faba materials were aggregated as blue, with genotype CC; 72 Vicia faba materials were aggregated as red, with genotype TT, and the accuracy of KASP molecular marker for early flowering phenotype variety reached 83.15% (A). Figure 5 A).

[0037] At the same time, the early flowering traits of 89 Vicia faba different genotype materials were analyzed. The spring acceleration flowering rate of genotype CC reached 0.40, which was greater than that of genotype TT 0.30, and the difference was extremely significant (0.001<P<0.01) (B), indicating that the KASP marker meets the requirements for identification of different Vicia faba early flowering genotypes, and can be used for Vicia faba early maturity molecular marker assisted selection breeding. Figure 5 B).

[0038] Table 1 Genotype and phenotype of Vicia faba materials for KASP marker genotyping Number Genotype Name Spring acceleration flowering rate Origin 75 C:C Wan can 2 0.52 Anhui Province 96 C:C CD814 0.22 Jiangsu Province 121 C:C CD146 0.33 Jiangsu Province 18 C:C Qi dou 2 0.35 Anhui Province 51 C:C Jing dou 2 0.44 Yunnan Province 4 C:C E dou 1 0.4 #N / A 28 C:C Qing can 27 0.14 Qinghai Province 78 C:C Feng dou 13 0.68 Yunnan Province Dali Prefecture 91 C:C CD422 0.32 Jiangsu Province 46 C:C Yi dou 11 0.25 Yunnan Province 84 C:C Chu 17 Jian 5 0.42 Yunnan Province 31 C:C Yi dou 5 0.45 Yunnan Province 86 C:C CD414 0.19 Jiangsu Province 94 C:C CD423 0.36 Jiangsu Province 102 C:C CD391 0.42 Jiangsu Province 8 C:C E dou 1103 0.47 #N / A 32 C:C Yi dou 3 0.48 Yunnan Province 42 T:T Yi dou 12 0.07 Yunnan Province 80 T:T CD1035 0.24 Jiangsu Province 105 T:T CD14 0.41 Jiangsu Province 113 T:T CD384 0.24 Jiangsu Province 154 T:T CD1055 0.27 Jiangsu Province 2 T:T E dou 3202 0.17 #N / A 60 T:T Tong can xian 7 0.5 Anhui Province 68 T:T Feng dou 17 0.57 Yunnan Province Dali Prefecture 97 T:T CD847 0.44 Jiangsu Province 106 T:T CD8 0.1 Jiangsu Province 139 T:T CD459 0.14 Yunnan Province 3 T:T Yu can 5 0.42 #N / A 11 T:T P16-16-3 0.37 Anhui Province 19 T:T 08151-1-1-1 0.52 Yunnan Province Dali Prefecture 27 T:T Tong can xian 21 0.22 Anhui Province 35 T:T Chu zao 1 0.58 Yunnan Province 52 T:T Tong can xian 6 0.34 Anhui Province 61 T:T Lin can 9 0.14 Gansu Linxia 69 T:T Feng dou 11 0.59 Yunnan Province Dali Prefecture 77 T:T Feng dou 27 0.05 Yunnan Province Dali Prefecture 82 T:T CD0037 0.4 Jiangsu Province 98 T:T CD937 0.44 Jiangsu Province 132 T:T CD81 0.29 Jiangsu Province 140 T:T Riben da ba pi 0.33 #N / A 20 T:T Yi dou 1 0.24 Yunnan Province 37 T:T Cheng hu 15 0.38 Anhui Province 45 T:T Ji zhang can 5 0.36 Hebei Province Zhangjiakou City 53 T:T Feng dou 26 0.63 Yunnan Province Dali Prefecture 62 T:T Jing dou 8 0.41 Yunnan Province 83 T:T CD928 0.1 Jiangsu Province 99 T:T CD1 0.28 Jiangsu Province 124 T:T CD364 0.45 Jiangsu Province 141 T:T CD710 0.17 Jiangsu Province 5 T:T Lin can 14 0.46 Gansu Linxia 13 T:T Yu can 4 0.38 #N / A 21 T:T Yi dou 6 0.4 Yunnan Province 29 T:T Tong can xian 20 0.49 Anhui Province 38 T:T Chu zao 3 0.16 Yunnan Province 63 T:T Jing dou 5 0.56 Yunnan Province 71 T:T Cheng hu 23 0.65 Anhui Province 79 T:T Cheng hu 26 0.35 Anhui Province 92 T:T CD9 0.11 Jiangsu Province 117 T:T CD469 0.08 Jiangsu Province 125 T:T CD115 0.46 Jiangsu Province 142 T:T CD1104 0.14 Jiangsu Province 150 T:T CD969 0.34 Jiangsu Province 14 T:T Qing can 21 0.28 Qinghai Province 22 T:T Feng dou 18 0.29 Yunnan Province Dali Prefecture 30 T:T Cheng hu 18 0.23 Anhui Province 39 T:T Lin can 10 0.27 Gansu Linxia 47 T:T Li can 3 0.28 Zhejiang Province 64 T:T Feng dou 6 0.58 Yunnan Province Dali Prefecture 85 T:T CD1006 0.42 Jiangsu Province 93 T:T CD123 0.42 Jiangsu Province 135 T:T Zhong jiang chang xiu 0.5 #N / A 159 T:T CD403 0.54 Jiangsu Province 15 T:T Hai qing 1 0.46 #N / A T:T 23 T:T Yi bean No.4 0.33 Yunnan Province 48 T:T Lichan 7 0.51 Zhejiang Province 57 T:T Linchan 8 0.07 Linxia, Gansu 119 T:T CD1120 0.3 Jiangsu Province 16 T:T 1012-1-1-1 0.53 Dali, Yunnan Province 24 T:T Linchan 12 0.55 Linxia, Gansu 49 T:T Zhecand 1 0.35 Zhejiang Province 58 T:T Jingbean 11 0.4 Yunnan Province 66 T:T Tongcand Xian 8 0.51 Anhui Province 74 T:T Chenghu 21 0.42 Anhui Province 87 T:T CD122 0.39 Jiangsu Province 95 T:T CD139 0.32 Jiangsu Province 112 T:T CD844 0.04 Jiangsu Province 120 T:T CD992 0.08 Jiangsu Province 153 T:T CD402 0.2 Jiangsu Province #N / A: indicates not clear Finally, it is to be understood that the above description is intended to be illustrative and not restrictive. Many embodiments of the application will be apparent to those of skill in the art upon reviewing the above description. The scope of the application should, therefore, be determined not with reference to the above description, but instead with reference to the appended claims, along with their full scope of equivalents.

Claims

1. A SNP molecular marker associated with the early flowering trait of broad bean, characterized in that, The SNP molecular marker is located on chromosome 1 of the broad bean genome, Chr1L-1358720341, with a base polymorphism site of T / C.

2. The SNP molecular marker according to claim 1, characterized in that, The flowering time of broad bean individuals with the SNP molecular marker genotype CC is earlier than that of broad bean individuals with the genotype TT.

3. A primer for detecting the SNP molecular marker of claim 1, characterized in that, This includes forward primers as shown in SEQ ID NO.2 and SEQ ID NO.3 and reverse primers as shown in SEQ ID NO.

4.

4. A kit for detecting the SNP molecular marker of claim 1, characterized in that, Includes the primers described in claim 3.

5. A method for identifying the early flowering trait of broad beans, characterized in that, Genomic DNA was extracted from broad beans to be tested, and fluorescent PCR was performed on SNP molecular markers using the primers described in claim 3 to determine their genotypes. Broad bean individuals with genotype CC flowered earlier, while broad bean individuals with genotype TT flowered later.

6. The method according to claim 5, characterized in that, The procedure for fluorescence PCR detection includes: pre-denaturation at 4℃ for 15 min, 1 cycle; denaturation at 94℃ for 20 s, annealing at 57℃ for 60 s, 10 cycles, with the annealing temperature decreasing by 0.8℃ for each cycle; denaturation at 94℃ for 20 s, annealing at 55℃ for 60 s, 26 cycles; and extension at 30℃ for 60 s.

7. The method according to claim 5, characterized in that, If the fluorescence signal detected by the fluorescent PCR is blue, the genotype is CC; if the fluorescence signal is red, the genotype is TT.

8. A method for cultivating early-maturing broad bean varieties, characterized in that, Genomic DNA of broad beans was extracted, and the genotype of the SNP molecular marker was detected using the primers described in claim 3. Broad bean individuals with the genotype CC were selected for breeding.

9. The application of the SNP molecular marker as described in claim 1 or 2 in identifying the early flowering trait of broad beans or screening early-maturing broad bean varieties.

10. The use of the primers of claim 3 or the kit of claim 4 in the preparation of reagents for identifying early flowering traits of broad beans or screening early-maturing broad bean varieties.

Images