SNP molecular marker for identifying upland cotton fiber quality, KASP primer group and application of SNP molecular marker and KASP primer group

By developing five SNP molecular markers related to fiber quality and their KASP primer sets, the instability and marker scarcity problems of fiber quality identification in traditional upland cotton breeding were solved, and efficient and accurate genotyping and quality improvement were achieved.

CN121249947APending Publication Date: 2026-01-02HUAZHONG AGRI UNIV

Patent Information

Application Number
CN202511595170.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-03
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

In existing technologies, traditional field phenotypic identification methods for upland cotton fiber quality are easily affected by environmental and human assessments, resulting in low efficiency and instability. Furthermore, they lack SNP molecular markers with high polymorphism and good stability suitable for breeding, leading to genotyping errors and confusing results.

Method used

Five SNP molecular markers (XW1~XW5) significantly associated with fiber quality and their KASP primer sets were developed. Through genome-wide association analysis and linkage disequilibrium screening, KASP primers with good specificity were designed to accurately identify the fiber quality of upland cotton.

Benefits of technology

It enables efficient and stable genotyping of upland cotton fiber quality, significantly improves fiber length and micronaire value, provides a reliable molecular breeding tool, and supports the improvement of fiber quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121249947A_ABST
    Figure CN121249947A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biology, in particular to an SNP molecular marker for identifying upland cotton fiber quality, a KASP primer group and application of the SNP molecular marker and the KASP primer group. The invention provides five SNP (Single Nucleotide Polymorphism) molecular markers XW1-XW5 which are obviously related to fiber quality, and accurate and stable genotyping can be realized through verification. Wherein the fiber length can be remarkably increased by excellent allelotypes corresponding to the markers XW1, XW2, XW4 and XW5; the excellent allelotype corresponding to the marker XW3 can significantly improve the micronaire value, provides a reliable tool for upland cotton fiber quality identification and molecular breeding, and has important application value.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and particularly relates to a SNP molecular marker for identifying fiber quality of Gossypium hirsutum, a KASP primer set and application thereof. BACKGROUND

[0002] Cotton is one of the most important economic crops in the world and is the main raw material for the textile industry. Among them, Gossypium hirsutum L. occupies a dominant position in global cotton production due to its high yield and wide adaptability. With the development of social economy and the continuous improvement of people's living standards, the market demand for high-quality cotton textiles is increasing. However, the fiber quality of Gossypium hirsutum is usually poor, so the improvement of fiber quality has become one of the core goals in its genetic breeding. In traditional Gossypium hirsutum breeding, the selection of fiber quality mainly relies on field phenotypic identification. This method is significantly affected by environmental conditions, planting years and subjective evaluation of human assessment, and has inherent limitations such as long cycle, low efficiency and poor stability, which seriously restricts the breeding process of high-yield and high-quality cotton varieties.

[0003] The KASP (Kompetitive Allele specific PCR) technology is a method for accurate determination of SNP (single nucleotide polymorphism) sites based on specific matching of primer terminal bases. It has high SNP typing accuracy, low cost and high throughput, and can be used for variety identification, genetic map construction, germplasm genetic diversity analysis, molecular marker assisted breeding and other aspects.

[0004] With the publication of multiple cotton reference genomes, a large number of QTLs (quantitative trait loci) related to fiber quality have been located and reported. However, there are still great challenges in transforming these QTL information into practical breeding tools. The outstanding problem at present is that there are very few SNP molecular markers associated with these QTLs that can be used for breeding. Not all SNP markers are suitable for breeding. Ideal SNP markers for breeding must have high polymorphism, easy identification and good repeatability (Kuangmeng, Wang Yanqin et al., Cotton Science, 2016). In addition, cotton is an allo-tetraploid crop, and its genome is highly complex. Most SNP sites have multiple copies of homologous sequences on A and D subgenomes. This feature is prone to genotyping errors or confusing results. For example, when developing a detection method, KASP primers designed for a SNP site may amplify multiple homologous sites at the same time, making the genotyping results unable to truly reflect the genotype of the target QTL.

[0005] At present, there are few SNP molecular markers for KASP detection developed for the fiber development related genes of upland cotton. Therefore, mining SNP sites and allelic variations associated with fiber development related traits and developing a KASP typing detection system which can specifically recognize target sites, has high stability and good repeatability are problems to be solved by those skilled in the art. SUMMARY

[0006] Therefore, the present application provides a SNP molecular marker for identifying fiber quality of upland cotton, a KASP primer set and application thereof.

[0007] The technical scheme of the present application is as follows:

[0008] In a first aspect, the present application provides application of a reagent for detecting a SNP molecular marker in identifying fiber quality of upland cotton, wherein the SNP molecular marker comprises at least one of XW1, XW2, XW3, XW4 and XW5; the XW1 is located at the 5234605th nucleotide of Ghir_D12 chromosome of upland cotton, and the mutant base is T or A; the excellent genotype of fiber length is TT, and the poor genotype is AA; the XW2 is located at the 8264322th nucleotide of Ghir_D13 chromosome of upland cotton, and the mutant base is C or T; the excellent genotype of fiber length is CC, and the poor genotype is TT; the XW3 is located at the 97669166th nucleotide of Ghir_A06 chromosome of upland cotton, and the mutant base is T or C; the excellent genotype of micronaire value is TT, and the poor genotype is CC; the XW4 is located at the 80709663th nucleotide of Ghir_A04 chromosome of upland cotton, and the mutant base is G or C; the excellent genotype of fiber length is CC, and the poor genotype is GG; the XW5 is located at the 24502404th nucleotide of Ghir_D11 chromosome of upland cotton, and the mutant base is G or T; the excellent genotype of fiber length is GG, and the poor genotype is TT; and the reference genome is TM-1 Ghirsutum_genome_HAU_v1.0 of upland cotton.

[0009] Further, the SNP molecular markers XW1-XW5 and their respective flanking sequences are shown in SEQ ID NO: 1-5, respectively, and the SNP molecular markers XW1-XW5 sites are located at the 22th position in the sequences shown in SEQ ID NO: 1-5, respectively.

[0010] Further, the reagent for detecting the SNP molecular marker comprises one or more of KASP primer sets KASP-1 to KASP-5 as follows: KASP primer set KASP-1 for the XW1, which consists of two forward primers with nucleotide sequences as shown in SEQ ID NO: 6-7 and a reverse primer with nucleotide sequence as shown in SEQ ID NO: 8; KASP primer set KASP-2 for the XW2, which consists of two forward primers with nucleotide sequences as shown in SEQ ID NO: 9-10 and a reverse primer with nucleotide sequence as shown in SEQ ID NO: 11; KASP primer set KASP-3 for the XW3, which consists of two forward primers with nucleotide sequences as shown in SEQ ID NO: 12-13 and a reverse primer with nucleotide sequence as shown in SEQ ID NO: 14; KASP primer set KASP-4 for the XW4, which consists of two forward primers with nucleotide sequences as shown in SEQ ID NO: 15-16 and a reverse primer with nucleotide sequence as shown in SEQ ID NO: 17; and KASP primer set KASP-5 for the XW5, which consists of two forward primers with nucleotide sequences as shown in SEQ ID NO: 18-19 and a reverse primer with nucleotide sequence as shown in SEQ ID NO: 20.

[0011] In a second aspect, the present application provides a KASP primer set for identifying fiber quality of Gossypium hirsutum, which comprises one or more of KASP primer sets KASP-1 to KASP-5.

[0012] In a third aspect, the present application provides a reagent or kit comprising the KASP primer set for identifying fiber quality of Gossypium hirsutum.

[0013] In a fourth aspect, the present application provides use of the reagent or kit in marker assisted selection of fiber quality phenotype of Gossypium hirsutum. In some embodiments, the use is to detect genotypes of SNP molecular markers XW1, XW2, XW4 and XW5 in a population of Gossypium hirsutum to be selected, and select individuals with the most number of advantageous genotypes as parents to breed offspring with improved fiber length. In other embodiments, the use is to detect genotype of SNP molecular marker XW3 in a population of Gossypium hirsutum to be selected, and perform directional screening according to actual breeding objectives: if the breeding objective is to reduce micronaire value, select individuals with genotype CC as parents; if the breeding objective is to improve micronaire value, select individuals with genotype TT as parents.

[0014] In a fifth aspect, the present application further provides a method for identifying fiber quality of Gossypium hirsutum, which comprises detecting genotypes of at least one of the SNP molecular markers XW1-XW5 of the Gossypium hirsutum as defined in claim 1, and determining fiber quality of the Gossypium hirsutum according to the detected genotypes. Further, the KASP primer set for identifying fiber quality of the Gossypium hirsutum is used for KASP detection of the Gossypium hirsutum.

[0015] The present application has at least the following advantages:

[0016] In the present application, 265 Gossypium hirsutum breeding intermediate materials are resequenced, and fiber quality phenotype data of three consecutive years are systematically collected. Through integration of whole genome association analysis, domestication selection analysis and whole genome selection screening, five SNP molecular markers significantly related to fiber quality are identified. Through verification, the SNP molecular markers provided by the present application can realize accurate and stable genotyping of 509 Gossypium hirsutum materials in other breeding populations. Among them, the excellent genotype corresponding to the four markers related to fiber length (XW1, XW2, XW4 and XW5) can significantly improve the fiber length; and the excellent genotype represented by XW3 marker can significantly improve the micronaire value. The molecular markers provided by the present application provide a reliable tool for efficient molecular breeding of Gossypium hirsutum fiber quality, and have important application value. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0018] Figure 1 The association analysis (genotype effect box plot) of the five SNP molecular markers (represented by XW1-XW5) provided by the present application and the fiber quality phenotype, the mean difference between the excellent genotype and the poor genotype population is tested by t test, and * in the figure represents p<0.05, **** represents p<0.0001;

[0019] Figure 2 The KASP genotyping scatter plot of XW1-XW5 provided by the present application;

[0020] Figure 3 The KASP genotyping heat map of XW1-XW5 provided by the present application in 509 Gossypium hirsutum materials;

[0021] Figure 4 The KASP genotyping heat map of XW1-XW5 provided by the present application in 45 Gossypium hirsutum materials;

[0022] Figure 5 KASP genotyping heat map of XW1 in 31 Upland cotton materials;

[0023] Figure 6 Correlation analysis results of fiber length and the number of excellent genotypes of four SNP molecular markers (XW1, XW2, XW4 and XW5) in 509 Upland cotton materials, wherein different letters represent significant differences between groups (one-way ANOVA);

[0024] Figure 7 Correlation analysis results of fiber phenotype and SNP molecular markers XW2, XW3 and XW4 in 509 Upland cotton materials, the mean difference between the population of excellent genotypes and the population of poor genotypes was tested by t-test, and * in the figure indicates p<0.05, and ** indicates p<0.01;

[0025] Figure 8 Correlation analysis results of fiber phenotype and SNP molecular marker XW5 in 45 Upland cotton materials, the mean difference between the population of excellent genotypes and the population of poor genotypes was tested by t-test, and * in the figure indicates p<0.05;

[0026] Figure 9 Correlation analysis results of fiber phenotype and SNP molecular marker XW1 in 31 Upland cotton materials, the mean difference between the population of excellent genotypes and the population of poor genotypes was tested by t-test, and ** in the figure indicates p<0.01;

[0027] Figure 10 KASP genotyping heat map of XW1-XW5 in 19 Upland cotton varieties (a total of 114 strains). DETAILED DESCRIPTION

[0028] In order to make the objects, technical solutions and advantages of the present application clearer, the technical solutions in the present application will be clearly and completely described below. Obviously, the described embodiments are some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application. The specific conditions not mentioned in the embodiments are carried out according to the conventional conditions or the conditions suggested by the manufacturers. The reagents or instruments not mentioned by the manufacturers are all conventional products that can be obtained by market purchase.

[0029] Example 1: SNP related to fiber quality of Upland cotton and development of KASP primer

[0030] 1. Re-sequencing and genetic variation detection

[0031] This example 265 Gossypium hirsutum breeding intermediate materials, the parent derived line group of the backbone parent is constructed, and is bred through continuous multiple generations of selfing and trait screening. The backbone parents include high-quality long-fiber backbone parents such as Belsno, Ai cotton 997, 247-125, J02-58, and early-maturing cotton backbone parents from the variety to be examined and determination of Xinjiang Shihezi Cotton Research Institute. Whole genome resequencing analysis is carried out on 265 Gossypium hirsutum breeding intermediate materials (cultivated in the experimental field of Xinjiang Shihezi Cotton Research Institute in 2018-2020). Fiber quality phenotype data, including fiber length (FL) and micronaire (M), are determined by a fiber quality tester (HFT9000) of Huazhong Agricultural University for three consecutive years. The phenotype data include mean, best linear unbiased prediction (BLUP), and single-year phenotype data. A total of 2,684,989 high-quality SNPs are obtained through genetic variation detection, which are used as the basic data set for subsequent analysis.

[0032] 2. Genome-wide association analysis (GWAS)

[0033] A (P+G+Q) mixed linear model of FaST-LMM (ver 2.07) software is used, and p=10 -6 As a threshold value, SNPs significantly related to fiber quality are filtered, and fiber quality-related QTLs are identified. Genome domestication selection analysis is performed by XP-CLR (ver 1.0) software, and the top 5% of genomic intervals of nucleotide polymorphism (π) and cross-population composite likelihood ratio test (XP-CLR) are screened compared with wild Gossypium hirsutum, which are considered as domestication hotspots. Fiber length-related QTLs are located in the domestication interval, and the GWAS results are supplemented.

[0034] 3. Genome-wide selection model (GS) construction

[0035] Based on the GWAS results, p=10 -4 As a threshold value, SNPs potentially related to fiber quality are filtered, and are used as a data set to construct a GS model. The model predicts the correlation between fiber quality phenotype values and actual phenotypes, which is close to the general genetic force of the trait. Large-effect SNPs in the model are screened, and fiber quality-related QTLs are identified.

[0036] 4. Linkage disequilibrium screening

[0037] For the identified fiber quality-related QTLs, linkage disequilibrium (R 2=1) Screening SNPs. Meanwhile, make sure there is no SNP in 22bp upstream of the SNP and 140bp downstream of the SNP, and extract the genomic sequence in this interval (sequences of two genotypes) as template for subsequent PCR amplification. This step screened 3770 SNPs from 9705 SNPs that met the conditions.

[0038] 5. KASP primer development

[0039] KASP primers were designed in batches by primer3 software (v2.4.0), and the optimal parameter settings were determined after multiple verifications to ensure that the primer Tm value is between 57-60℃ and the TM value between the forward and reverse primers is at most 2℃, and at the same time, the 3' end of the two forward primers (F primer and H primer) matches the SNP. This step screened 488 SNPs from 3770 SNPs.

[0040] The designed primer set was compared to the Gossypium hirsutum TM-1 reference genome Ghirsutum_genome_HAU_v1.0 (which can be obtained from the CottonFGD database at https: / / cottonfgd.net / about / download.html) by BLAST to ensure that the two forward primers and the reverse primer have no additional amplification fragments outside the target PCR product. This step screened 98 SNPs with good specificity from 488 SNPs.

[0041] Verify the correctness of the KASP primer set in the above-mentioned population of 265 upland cotton breeding intermediate materials. This step screened the best 5 SNPs in each QTL and the corresponding primer set for verification, and among the 25 primer sets, 2 primer sets detected fluorescence in the negative control, which may be due to the presence of primer dimers; 2 primer sets did not detect fluorescence. Among the remaining available primer sets, one SNP with the best overall performance and the corresponding primer set were selected as the QTL core SNP and the corresponding KASP primer set for each QTL. As a result, 5 SNP molecular markers significantly associated with fiber quality were identified, as shown in Table 1:

[0042] Table 1 SNP molecular markers significantly associated with fiber quality

[0043] Marker name Chromosome Physical position Variant type Allele type Superior genotype Poor genotype Associated trait XW1 Ghir_D12 5234605 SNP T / A TT AA Fiber length XW2 Ghir_D13 8264322 SNP C / T CC TT Fiber length XW3 Ghir_A06 97669166 SNP T / C TT CC Micronaire value XW4 Ghir_A04 80709663 SNP G / C CC GG Fiber length XW5 Ghir_D11 24502404 SNP G / T GG TT Fiber length

[0044] Note: The reference genome is Gossypium hirsutum TM-1 Ghirsutum_genome_HAU_v1.0.

[0045] The flanking sequences of the above SNP molecular markers are shown in Table 2, and are located at position 22 of the sequences SEQ ID NO:1-4 (underlined, for example, the polymorphic site at the underlined position of the sequence shown in SEQ ID NO:1 is T / A, see Table 1).

[0046] Table 2 Flanking sequences of SNP molecular markers

[0047] Marker name Flanking sequence (5'-3') SEQ ID NO XW1 AGCATTGATTTGCTTACGTCC T TTGTTTTCTTTCTTTATAGATCAACGGAAAGCTCGATCTGTTGGAATTTCATCGAAGCAAAATCACATTATCCAATCATCATTTTGGTATTTTTGGTTACTTTGGTATAAGGTTATAAAT]]> 1 XW2 AAATGGGGCGTTCTTACACAA C AAGTTAGTTAGAGGAGCTGTAATTAAAGCGAACCTTTCGACAAATCTCTAATAATAACCTGTAAGCCCAAGAAAATTGCGAATCTCAAAAACATTCCTAGACTATTTCCACTCAAGCACA]]> 2 XW3 CTGACGAAGTACGCCAAAGGA T TATTATCGCCGTAAGACATTTTATATTTTGTATTCTGCATGACATGGGGGTGGTGTCAAGACATTTACAATTTGAAGAATGTATTTTGTATCTAAACTCAAGACCATGAATCTATGGTTC 3 XW4 AGCACTGAAGATGTTTGAGAC G ATTTTAAGGCAGTATGCTGCGAAGCTGGAATGCCTACTTGTTCGCCAATTTTTCTTTCAAGGTAATCAGAGCAATTTCACAGACATTGGAGGAGATGTCTTTGGCTATAGAGCTTACCTC]]> 4 XW5 AACGAGGAGGGTGATGGCGAT G TGTTAACAGAAAGGCTCGCTCAATTTGCTGCTATGTTCTTTGTTGCTGTAATTTTCAATTTGTTAACATTTTTTTTGTTTGTTACTTATAAAAGGAAGTGGCATGTTGTTCTGGTGAAGT 5

[0048] The primer sets developed for the SNP molecular markers in Table 1 are shown in Table 3:

[0049]

[0050] Correlation analysis of the five SNP molecular markers provided by the present application and the fiber quality phenotype of Gossypium hirsutum

[0051] Among 265 intermediate upland cotton breeding materials, the comparison results of the three-year fiber quality phenotypic averages of superior and inferior genotype populations based on five SNP molecular markers (XW1~XW5) are as follows: Figure 1 As shown in the diagram (genotype effect box plot), the difference between the superior genotype (TT) and the inferior genotype (AA) of the fiber length-related SNP molecular marker XW1 was statistically significant (p<0.05); the differences between the superior and inferior genotypes of the fiber length-related SNP molecular markers XW2, XW4, and XW5 were all highly significant (p<0.0001). The difference between the superior genotype (TT) and the inferior genotype (CC) of the malarial value-related SNP molecular marker XW3 was also highly significant (p<0.0001). The specific genotype correspondences for each marker are shown in Table 1.

[0052] Micronaire value is a key indicator for evaluating the fineness and maturity of cotton fibers, with its optimal value typically falling within the middle range. Therefore, when the micronaire value-related molecular marker XW3 described in this invention is applied to breeding, targeted screening should be conducted based on the actual breeding objectives: if the micronaire value of the breeding population is generally high, the genotype associated with lower values ​​(CC) should be selected; if it is generally low, the genotype associated with higher values ​​(TT) should be selected.

[0053] Example 2: Validation of the screening efficiency of the KASP detection system for the correlation between fiber length and micronaire value in upland cotton.

[0054] 1. Material source and DNA extraction

[0055] In this embodiment, the experimental materials used include three upland cotton populations: the first population is 509 upland cotton breeding intermediate materials provided by Xinjiang Academy of Agricultural and Forestry Sciences; the second population is 45 upland cotton breeding intermediate materials provided by Xinjiang Guoxin Seed Co., Ltd.; and the third population is 31 materials selected from the upland cotton natural population owned by Huazhong Agricultural University. About 100 mg of leaf blades were taken from cotton seedlings and placed in 2.0 mL deep well plates (96 wells) for liquid nitrogen preservation. The genomic DNA was extracted from the cotton leaves using the Plant Genomic DNA Extraction Kit (magnetic bead method) V3 (catalog number 102001000060) of Chengdu Hanchen Guangyi Biological Engineering Co., Ltd. The DNA sample concentration was detected using NANODROP one 2000, diluted to 20-50 ng / μL, and transferred to a 200 μL PCR sample plate.

[0056] 2. Establishment of KASP detection system

[0057] (1) KASP reaction system

[0058] The KASP 1x reaction system is shown in Table 4, and the prepared reagents were placed in the reagent plate. The primers (as shown in Table 3) were synthesized by Shengong Bioengineering (Shanghai) Co., Ltd. using PAGE method.

[0059] Table 4 KASP 1x reaction system

[0060] Component Volume (μL) 2x PACE Master Mix (Standard Rox) 1 F primer (forward) 100 μM 0.0033 H primer (forward) 100 μM 0.0033 R primer (reverse) 100 μM 0.0083 DNA 1 Total amount 2.015

[0061] (2) KASP reaction program:

[0062] The sample plate, reagent plate, and reaction plate were correctly placed on the corresponding positions of the reaction plate preparation instrument Matrix Arrayer 3250, and the 96 sample x 4 site, 384 sample x 1 site pipetting scheme was selected. The device automatically completed the reaction system construction and heat sealed the reaction. The heat-sealed reaction plate was inserted into the water bath basket, and the high-throughput water bath thermal cycler Matrix Cycler2010 was used to run the reaction program as shown in Table 5.

[0063]

[0064] (3) Fluorescence detection and data analysis

[0065] After the water bath is completed, the reaction plate is taken out, and after the reaction plate is cooled to room temperature, it is placed in a high-speed fluorescence scanner Matrix Scanner 2100 to perform fluorescence scanning. The Master data analysis software is opened, the fluorescence data of the reaction plate is synchronized, and the data is typed. The reaction plate preparation instrument Matrix Arrayer 3250, the high-throughput water bath thermal cycler Matrix Cycler 2010, and the high-speed fluorescence scanner Matrix Scanner 2100 are all provided by Chengdu Hanchen Guangyi Biological Engineering Co., Ltd.

[0066] 3. Verification results of typing efficiency

[0067] The KASP scatter plots (genotyping results) of the XW1-XW5 molecular markers in the first population (96 key breeding intermediate materials of 509 upland cotton materials) are as shown in Figure 2 It can be seen that the KASP primer set of the XW1-XW5 molecular markers provided by the application can efficiently realize accurate genotyping identification between different genotypes. The KASP genotyping heat map of the third population (31 upland cotton natural population materials) of the five molecular markers (XW1-XW5) is as shown in Figure 3 The KASP genotyping heat map of the second population (45 upland cotton materials) is as shown in Figure 4 The KASP genotyping heat map of the third population (31 upland cotton natural population materials) is as shown in Figure 5 It can be seen that the KASP primer set provided by the application can accurately identify the genotypes of different upland cotton materials.

[0068] 4. Further verification of the screening effect of the KASP primer set on the fiber length and micronaire value of the upland cotton materials

[0069] (1) Phenotype data collection: The fiber quality phenotypic data of the upland cotton materials, including fiber length (FL) and micronaire value (M), were measured on the fiber quality tester (HFT9000) of Huazhong Agricultural University.

[0070] (2) Based on the genotyping results of the first population (509 upland cotton materials), the fiber quality-related phenotype association analysis was carried out, and the results are as follows:

[0071] According to the number of excellent genotypes (1-4) of the four fiber length-related SNP molecular markers (XW1, XW2, XW4 and XW5), the materials were divided into four groups, and the box plots were drawn to compare the distribution and significant difference of fiber length between different groups. The results are as shown in Figure 6 With the increase of the number of excellent genotypes of the fiber length-related SNP molecular markers, the fiber length is significantly improved, indicating that gathering more excellent genotypes can significantly improve the fiber length.

[0072] Box plots were drawn to compare the difference of fiber length between two groups according to the genotyping of XW2, XW4 molecular markers, and the results were shown in Figure 7 As shown in the figure, the fiber length of the materials carrying excellent genotypes of XW2, XW4 was significantly higher than that of the poor genotype group (p<0.01 and p<0.05), which was consistent with the expectation, indicating that the XW2, XW4 molecular markers and their KASP primer sets could be used for genetic improvement of fiber length.

[0073] Box plots were drawn to compare the difference of micronaire value between two groups according to the genotyping of XW3 molecular marker, and the results were shown in Figure 7 As shown in the figure, the micronaire value of the materials carrying excellent genotypes of XW3 was significantly higher than that of the poor genotype group (p<0.05), which was consistent with the expectation, indicating that the XW3 molecular marker and its KASP primer set could be used for genetic improvement of micronaire value.

[0074] It should be noted that in the first population, due to the specific genotype corresponding to the molecular marker XW1 appeared too low frequency in the population (less than 10 strains), leading to the genotype distribution not meeting the minimum sample size requirements for effective genetic difference analysis; at the same time, the excellent allele effect of molecular marker XW5 may be interfered by the complex genetic background of XW1, XW2 and XW5 itself, making it difficult to accurately evaluate its independent contribution to fiber length. Therefore, this embodiment uses the second population and the third population to verify and analyze XW1 and XW5, respectively.

[0075] (3) Based on the genotyping results of the second population (45 Upland cotton breeding intermediate materials), phenotypic association analysis related to fiber quality was carried out, and the results were as follows:

[0076] Box plots were drawn to compare the difference of fiber length between two groups according to the genotyping of XW5 molecular marker, and the results were shown in Figure 8 As shown in the figure, the fiber length of the materials carrying excellent genotypes of XW5 was significantly higher than that of the poor genotype group (p<0.05), which was consistent with the expectation, indicating that the XW5 molecular marker and its KASP primer set could be used for genetic improvement of fiber length.

[0077] (4) Based on the genotyping results of the third population (31 Upland cotton natural population materials), phenotypic association analysis related to fiber quality was carried out, and the results were as follows:

[0078] Box plots were drawn to compare the difference of fiber length between two groups according to the genotyping of XW1 molecular marker, and the results were shown in Figure 9As shown, the material carrying the excellent genotype of XW1 has a significantly higher fiber length than the group of poor genotypes (p<0.01), which is consistent with the expectation, indicating that the XW1 molecular marker and its KASP primer set can be used for genetic improvement of fiber length. Therefore, the above-mentioned five KASP primer sets and the corresponding molecular marker polymorphism are high, stable, can accurately genotype, and provide efficient molecular tools for the improvement of fiber length and micronaire value of upland cotton.

[0079] Example 3

[0080] Nineteen existing upland cotton varieties (Xintacotton 11, Xintacotton 18, Xintacotton 10, Zao 36, Zao 79, Zheda 19, Zhongshengcotton 16, Huaxin 103, Zhongmian N828, Zhongken M2061, Zhong MB703, Xinshik 37, MCR3P15, Xinchang 437, J206-5, Xintacotton 102, Yuancotton 5 and Gancotton 215) were selected, and 6 strains of each variety were selected. The KASP primer set of the five fiber quality related SNP molecular markers (XW1-XW5) provided by the application (the specific primer information is shown in Table 3) was used, and the KASP detection system consistent with example 2 was used for genotyping detection to obtain the genotype results of each variety at XW1-XW5 markers.

[0081] As shown in the results of Figure 10 As shown in the results, the XW1-XW5 molecular markers and KASP primer sets provided by the application can accurately identify the homozygous state of different varieties at each marker site and the genotype of a single plant at different marker sites. It is known that existing varieties generally carry poor genotypes at the XW4 molecular marker site, so in subsequent fiber quality improvement breeding, introducing the excellent genotype of XW4 can improve fiber length. In summary, the XW1-XW5 marker system can efficiently and accurately genotype, clearly reveal the genotype differences between upland cotton varieties, and effectively improve fiber length or micronaire value by directional introduction of the excellent allele of the corresponding marker, thereby providing a stable and reliable molecular tool for genetic improvement of upland cotton fiber quality.

[0082] The above only describes the preferred embodiments of the application and is not intended to limit the application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the application shall be included in the protection scope of the application.

Claims

1. The application of a reagent for detecting SNP molecular markers in the identification of upland cotton fiber quality, characterized in that, The SNP molecular markers include at least one of XW1, XW2, XW3, XW4, and XW5; The XW1 genotype is located at nucleotide 5234605 on chromosome Ghir_D12 of upland cotton, with a mutated base of T or A; the genotype with excellent fiber length is TT, and the genotype with poor fiber length is AA. The XW2 genotype is located at nucleotide position 8264322 on chromosome Ghir_D13 of upland cotton, with a mutated base of C or T; the genotype with excellent fiber length is CC, and the genotype with poor fiber length is TT. The XW3 is located at nucleotide 97669166 on chromosome Ghir_A06 of upland cotton, with a mutated base of T or C; the excellent genotype for macronization is TT, and the poor genotype is CC. The XW4 genotype is located at nucleotide position 80709663 on chromosome Ghir_A04 of upland cotton, with a mutated base of G or C; the genotype with excellent fiber length is CC, and the genotype with poor fiber length is GG. The XW5 genotype is located at nucleotide position 24502404 on chromosome Ghir_D11 of upland cotton, with a mutated base of G or T; the genotype with excellent fiber length is GG, and the genotype with poor fiber length is TT. The reference genome is upland cotton TM-1 Ghirsutum_genome_HAU_v1.

0.

2. The application according to claim 1, characterized in that, The SNP molecular markers XW1~XW5 and their respective flanking sequences are shown in SEQ ID NO:1~5, and the SNP molecular markers XW1~XW5 are located at position 22 in the sequences shown in SEQ ID NO:1~5.

3. The application according to claim 1, characterized in that, The reagents for detecting SNP molecular markers include one or more of the following KASP primer sets: KASP-1 to KASP-5: (1) KASP primer set KASP-1 for XW1, wherein KASP-1 is composed of two forward primers with nucleotide sequences as shown in SEQ ID NO:6-7 and a reverse primer with nucleotide sequences as shown in SEQ ID NO:8; (2) KASP primer set KASP-2 for XW2, wherein KASP-2 consists of two forward primers with nucleotide sequences as shown in SEQ ID NO:9-10 and a reverse primer with nucleotide sequences as shown in SEQ ID NO:11; (3) KASP primer set KASP-3 for XW3, wherein KASP-3 is composed of two forward primers with nucleotide sequences as shown in SEQ ID NO:12-13 and a reverse primer with nucleotide sequences as shown in SEQ ID NO:14; (4) KASP primer set KASP-4 for XW4, wherein KASP-4 is composed of two forward primers with nucleotide sequences as shown in SEQ ID NO:15-16 and a reverse primer with nucleotide sequences as shown in SEQ ID NO:17; (5) KASP primer set KASP-5 for XW5, wherein KASP-5 is composed of two forward primers with nucleotide sequences as shown in SEQ ID NO:18-19 and a reverse primer with nucleotide sequences as shown in SEQ ID NO:

20.

4. A KASP primer set for identifying the quality of upland cotton fibers, characterized in that, Includes one or more of the KASP primer sets KASP-1 to KASP-5 as described in claim 3.

5. A reagent or kit containing the KASP primer set for identifying the quality of upland cotton fibers as described in claim 4.

6. The application of the reagent or kit described in claim 5 in molecular marker-assisted selection of upland cotton fiber quality phenotypes.

7. The application according to claim 6, characterized in that, The genotypes of the SNP molecular markers XW1, XW2, XW4 and XW5 as described in claim 1 were detected in the candidate upland cotton population, and individuals with the largest number of dominant genotypes were selected as parents to breed offspring with improved fiber length.

8. The application according to claim 6, characterized in that, The genotype of the SNP molecular marker XW3 as described in claim 1 was detected in the candidate upland cotton population; and targeted screening was carried out according to the actual breeding objectives: if the breeding objective is to reduce the equinometry value, individuals with the genotype CC were selected as parents; if the breeding objective is to increase the equinometry value, individuals with the genotype TT were selected as parents.

9. A method for identifying the quality of upland cotton fibers, characterized in that, The genotype of at least one of the SNP molecular markers XW1 to XW5 as described in claim 1 is detected in the upland cotton to be tested, and the fiber quality of the upland cotton to be tested is determined based on the detected genotype.

10. The method according to claim 9, characterized in that, The KASP primer set for identifying the quality of upland cotton fibers as described in claim 4 was used to perform KASP detection on the upland cotton to be tested.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker simultaneously associated with upland cotton fiber length, elongation, micronaire value, strength and boll weight characters and application

    CN115852007A

  • SNP (Single Nucleotide Polymorphism) molecular marker for identifying upland cotton fiber strength character and application of SNP molecular marker

    CN119553005A

Cited By

  • Haploid molecular marker related to cotton fiber strength and application of detection primer of haplotype molecular marker

    CN121951126A

  • A haplotype molecular marker related to cotton fiber strength and application of a detection primer thereof

    CN121951126B