Soybean pod explosion resistance character gene locus qPD08-1 and application thereof

By utilizing the soybean pod-breaking resistance gene locus qPD08-1 and its application, and employing CAPS molecular markers and specific primer combinations, we achieved efficient detection and identification of soybean pod-breaking resistance, solving the yield reduction problem caused by soybean pod-breaking and improving breeding selection efficiency and soybean yield.

CN121249969AActive Publication Date: 2026-01-02INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511832493.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-08
Publication Date
2026-01-02
Estimated Expiration
2045-12-08

AI Technical Summary

Technical Problem

Soybean pods are prone to bursting, leading to reduced yields. Existing technologies are unable to effectively solve this problem, affecting both soybean production and quality.

Method used

This study provides the soybean pod-resistant trait locus qPD08-1 and its applications. Through CAPS molecular markers and a combination of dedicated primers, it enables efficient detection and identification of soybean pod-resistant traits, and uses restriction enzyme digestion to distinguish genotypes.

Benefits of technology

This technology enables efficient screening and identification of soybean pod-breaking resistance traits, shortens the breeding process, improves breeding selection efficiency, broadens the sources of superior breeding parents, and reduces seed loss due to scattering.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121249969A_ABST
    Figure CN121249969A_ABST
Patent Text Reader

Abstract

The invention relates to a soybean pod explosion resistance character locus qPD08-1 and application thereof, and belongs to the technical field of plant molecular biology. The soybean anti-podding character gene locus qPD08-1 disclosed by the invention is positioned between No.8 chromosome 35983663 and 36106921bp of a soybean Glyma. Wm82. A2. V1 reference genome, and the total length of physical intervals of the soybean anti-podding character gene locus qPD08-1 is 123.258 kb. The molecular marker detection method disclosed by the invention can be used for soybean anti-shrub pod germplasm resource identification, anti-shrub pod gene screening and function research, anti-shrub pod molecular marker-assisted selection breeding, natural resources and the like, has the characteristics of convenience in detection, stable amplification product and high specificity, is beneficial to widening excellent breeding parent sources, and has a wide application prospect. The soybean breeding selection efficiency is improved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant molecular biology, in particular to a soybean anti-shattering trait locus qPD08-1 and application thereof. BACKGROUND

[0002] Soybean Glycine max is an important economic crop originally from China, and is also an important plant protein source. At present, the soybean yield in China is difficult to increase by increasing the planting area, and the domestic soybean can only meet the demand for food, and the soybean for feeding relies heavily on imports, far from meeting the domestic consumption, so increasing the soybean yield per unit is an important means to increase the soybean yield in China.

[0003] The soybean anti-shattering trait is considered to be one of the first traits selected in the domestication of soybean. The seeds of leguminous plants are contained in pods composed of carpels, and the process of carpel splitting along the joint at the mature stage is called shattering or pod dehiscence. The shattering trait is closely related to the yield of soybean. In wild soybean, pod dehiscence is a necessary condition for the propagation of offspring, while in cultivated soybean, pod dehiscence leads to the scattering of seeds and difficulty in harvesting, which is one of the important reasons for the reduction of soybean yield. It has been reported that the yield loss of some easy-shattering varieties can reach 50% to 100% when harvested in dry weather; another study found that the yield loss of soybean varieties with easy-shattering and moderate-shattering can reach up to 175 to 186 kg / hm 2 , and the loss of domestic Huanghuaihai main varieties due to shattering can also reach 112.5 kg / hm 2 . Early harvesting of soybean can lead to a decrease in the weight of 100 seeds, oil content and protein content, while late harvesting can result in yield reduction due to shattering. In addition, the seeds that fall off due to shattering can have a dormancy period of up to 10 years in the soil, and can grow into weeds under suitable environmental conditions, affecting the growth of the current crop. SUMMARY

[0004] The present application provides a soybean anti-shattering trait locus qPD08-1 and application thereof, to solve the problem of yield reduction caused by easy-shattering of soybean in the prior art.

[0005] In order to achieve the above-mentioned application purpose, the present application provides the following technical solutions: The present application provides a soybean anti-shattering trait locus qPD08-1 and application thereof in the selection of soybean anti-shattering traits, wherein the soybean anti-shattering trait locus qPD08-1 corresponds to the physical interval of 35983663-36106921 bp on chromosome 8 of the Wm82.a2.v1 reference genome, and the total length of the physical interval is 123.258 kb. Glyma

[0006] ​The present invention also provides a CAPS molecular marker, wherein the physical location of the CAPS molecular marker is located at the soybean pod-breaking resistance trait locus. qPD08-1 Within the physical space, soybeans Glyma The reference genome for .Wm82.a2.v1 is located at 35988687 bp on chromosome 8; The soybean pod-resistant trait locus qPD08-1 The physical interval corresponds to chromosome 8, between 35983663 and 36106921 bp of the soybean Glyma.Wm82.a2.v1 reference genome, with a total physical interval length of 123.258 kb.

[0007] This invention also provides a soybean pod-resistant trait locus. qPD08-1 Or a dedicated primer combination constructed from CAPS molecular markers, including PD08-1 CAPS-F primers, PD08-1 CAPS-R primers and PD08-1 CAPS-R1 primers; The PD08-1 The nucleotide sequence of the CAPS-F primer is shown in SEQ ID NO.33; The PD08-1 The nucleotide sequence of the CAPS-R primer is shown in SEQ ID NO.34; The PD08-1 The nucleotide sequence of the CAPS-R1 primer is shown in SEQ ID NO.35.

[0008] Preferably, if the band amplified by the special primer combination yields a 217bp band after restriction enzyme digestion, the genotype of the soybean to be tested is defined as the pod-breaking genotype (R); if the bands obtained after restriction enzyme digestion are 118bp and 99bp, the genotype of the soybean to be tested is defined as the pod-breaking genotype (S).

[0009] Preferably, the restriction enzyme is Hph I.

[0010] The present invention also provides a gene detection kit, comprising: PD08-1 CAPS-F primers, PD08-1 CAPS-R primers and PD08-1 CAPS-R1 primers; The PD08-1 The nucleotide sequence of the CAPS-F primer is shown in SEQ ID NO.33; The PD08-1 The nucleotide sequence of the CAPS-R primer is shown in SEQ ID NO.34; The PD08-1The nucleotide sequence of the CAPS-R1 primer is shown as SEQ ID NO. 35.

[0011] The application also provides application of the CAPS molecular marker, the special primer combination or the gene detection kit in selection of a soybean anti-burst pod trait.

[0012] The application has the following technical effects and advantages: The molecular marker detection method provided by the application can be used in soybean anti-burst pod germplasm resource identification, anti-burst pod gene screening and function research, anti-burst pod molecular marker assisted selection breeding and natural resources, and has the characteristics of convenient detection, stable amplification product and high specificity. The molecular marker can efficiently predict the soybean anti-burst pod phenotype, is conducive to screening of soybean varieties with an anti-burst pod genotype, assists in soybean anti-burst pod identification and molecular breeding, further shortens a breeding process, and helps to broaden an excellent breeding parent source and improve soybean breeding selection efficiency. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 For qPD08-1 Interval fine mapping; Figure 2 CDS sequence electrophoresis result of the soybean anti-burst pod gene GmPD08-1 Figure 3 Gene editing result of the soybean anti-burst pod gene GmPD08-1 , wherein A is gene sequencing of a homozygous editing strain, B is amino acid prediction of the homozygous editing strain, C is anti-burst pod trait identification of the homozygous editing strain, and D is anti-burst pod rate analysis of the homozygous editing strain; Figure 4 Gene sequencing analysis result of the soybean anti-burst pod gene GmPD08-1 Figure 5 Non-denaturing polyacrylamide gel detection result of the molecular marker PD08-1 CAPS Figure 6 Enzyme digestion electrophoresis result of a heterozygous line separation population Figure 7 Significance analysis of the anti-burst pod marker PD08-1 CAPS in identification of a natural variety resource population. DETAILED DESCRIPTION

[0014] The technical solutions provided by the application will be described in detail below in combination with examples, but they should not be understood as limitations on the protection scope of the application.

[0015] Example 1: Soybean anti-burst pod population planting and phenotype identification ​​The experimental site was located in the soybean experimental field of the Heihe Branch of the Heilongjiang Academy of Agricultural Sciences. Soybean parents, recombinant inbred line (RIL) populations, and residual heterozygous line (RHL) populations were randomly arranged into plots. The ridge length was 2m, the ridge spacing was 66.7cm, and the plant spacing was 5cm. Manual sowing was combined with deep fertilization, including the application of 37.5kg / hm² of urea. 2 225 kg / hm² of diammonium phosphate 2 Potassium fertilizer 37.5 kg / hm 2 Unified field management was implemented. Five days after the soybean plants reached full maturity, 30 pod samples were taken from the upper part of the soybean plants and stored in a 4℃ refrigerator, taking care to avoid pod bursting during sampling. Each pod sample was placed in a heat-resistant wide-mouth glass beaker, covered with a fine wire mesh to prevent pods from scattering during bursting, and baked in a 60℃ oven for 13 hours. The number of bursting pods was counted and the bursting rate was calculated. The formula for calculating the pod breakage rate is: pod breakage rate = (number of broken pods / total number of pods) × 100%.

[0016] Example 2: Location and Cloning of Soybean Pod-Resistant Genes Using the method described in Example 1, a RIL population was constructed with the pod-resistant variety Heihe 43 as the female parent and the easily pod-breaking variety Heihe 18 as the male parent. A high-density genetic map was constructed using SLAF-seq simplified genome sequencing, and three stable QTLs for the pod-breaking trait were located, namely... qPD01, qPD05-1, qPD08-1 Building upon this, a population containing 102 RILs was further constructed using the single-particle transfer method, and then... qPD08-1 Three residual heterozygous individuals were screened from the SSR markers 08-1348 and 08-1427 at both ends of the interval, and 48 exchanger individuals were successfully screened by expanding RHL. Using 13 pairs of interval polymorphic SSR markers for in-depth identification (as shown in Table 1), 17 different types of exchanger individuals were identified. Based on phenotype, the location range of the interval was narrowed from the initial 2.921 Mb to 123.258 kb, located between SSR markers 08-1363 and 08-1371. This interval contains two genes, namely... GmPD08-1 (Glyma.08G273500) and GmPD08-2 (Glyma.08G273600), the interval is located in GmPD08- 1 Upstream, GmPD08-2 Downstream, GmPD08-1 For strong candidate genes, such as Figure 1 As shown.

[0017] Table 1. Interval Polymorphism SSR Markers Using the soybean reference genome GlymaPrimers designed based on Wm82.a2.v1 for amplifying soybean anti-burst pod gene GmPD08-1 GmPD08-1 -CDSF / R, as shown in Table 2; PCR amplification was performed using cDNA of parent anti-burst pod variety Hehe 43 and easy-burst pod variety Hehe 18 as templates, and the amplification system was calculated based on 20 μL, including KOD On TM PCR Master Mix 10 μL, GmPD08-1 -CDSF primer (10 μmol / L) 0.5 μL, GmPD08-1 -CDSR primer (10 μmol / L) 0.5 μL, cDNA (50 ng / μL) 2 μL, and the rest was sterile water; the PCR program was set as: 98 ℃ pre-denaturation for 3 min→ (95 ℃ denaturation for 10 s→ 55 ℃ annealing for 5 s→ 68 ℃ extension for 10 s) × 34 cycles→ 68 ℃ extension for 3 min, to obtain the CDS sequence of soybean anti-burst pod gene GmPD08-1 , as shown in SEQ ID NO. 36; detection was performed by 1% agarose gel electrophoresis, and the results are shown in Figure 2 .

[0018] Table 2 Sequences of primers SEQ ID NO. 36: ​ Example 3: Functional verification of soybean pod-resistant gene Build includes GmPD08-1 The gene-editing vector containing the target sequences of the gene contains two target sites, gRNA1 and gRNA2. The gene-editing vector was transformed into the soybean cotyledon node-mediated genetic transformation method using Agrobacterium tumefaciens, resulting in the pod-breaking resistant soybean variety Williams 82. Positive transgenic soybean plants were identified at the DNA level. Stable homozygous edited T1 soybean transgenic plants were harvested. The pod-breaking rate of homozygous edited T1 soybean transgenic plants and control mature soybeans was measured according to the method described in Example 1. The results are as follows: Figure 3 As shown; The nucleotide sequence of gRNA1 is shown in SEQ ID NO.37.

[0019] SEQ ID NO.37: AGGACAGAGCAATGCCTCGA The nucleotide sequence of gRNA2 is shown in SEQ ID NO.38.

[0020] SEQ ID NO.38: CCAGTCACCTGAAAGGGATC The results showed that, compared with the control, the homozygous edited T1 soybean transgenic plants had an increased pod-breaking rate, proving that soybeans... GmPD08-1 Genes can effectively improve the soybean's resistance to pod shattering.

[0021] Example 4: Molecular markers of soybean pod-resistant genes PD08-1 Development and Evaluation of CAPS Genomic DNA was extracted from the blast-resistant soybean variety Heihe 43 and the blast-prone soybean variety Heihe 18 using the CTAB method. The mass and concentration of each genomic DNA sample were determined by 1% agarose gel electrophoresis and spectrophotometry. The DNA samples were diluted to a concentration of 50 ng / µL and stored at -20℃ for later use. Based on the parental resequencing results, in soybean... GmPD08-1 A SNP variant was found at -6760 bp upstream of the ATG start codon (e.g. Figure 4 (As shown), located in the soybean reference genome Glyma The SNP at position 35988687 on chromosome 8 of the .Wm82.a2.v1 gene is T, while the SNP at position C is T for Heihe 43 and C for Heihe 18. This SNP variant site was developed as a CAPS molecular marker, and the target fragment was amplified using nested PCR. PD08-1 CAPS-F / R was used as the primer for the first round of PCR amplification. PD08-1CAPS-F / R1 as the primer of the second round of PCR amplification, and the sequences of the primers are shown in Table 2. The first round of PCR amplification system was set as: genomic DNA 2 µL, 2 × Taq Master Mix 10 µL, PD08-1 CAPS-F 0.5 µL, PD08-1 CAPS-R 0.5 µL, ddH2O 7 µL; the first round of PCR amplification program was: 94 °C pre-denaturation for 3 min → (98 °C denaturation for 15 s → 56 °C annealing for 15 s → 72 °C extension for 45 s) × 25 cycles → 72 °C extension for 5 min, to obtain the first round of PCR product and perform the second round of PCR amplification, and the second round of PCR amplification system was set as: the first round of PCR product 0.5 µL, 2 × Taq Master Mix 10 µL, PD08-1 CAPS-F 0.5 µL, PD08-1 CAPS-R1 0.5 µL, ddH2O 8.5 µL; the second round of PCR amplification program was: 94 °C pre-denaturation for 3 min → (98 °C denaturation for 15 s → 56 °C annealing for 15 s → 72 °C extension for 15 s) × 34 cycles → 72 °C extension for 5 min, to obtain the second round of amplification product, wherein the second round of amplification product of Heihe 43 is shown as SEQ ID NO. 39, and the second round of amplification product of Heihe 18 is shown as SEQ ID NO. 40.

[0022] SEQ ID NO. 39: CATCTAACTGCTCCAAGTGAAGATTCTCTGCAGCTATTATGCTCAGAATAACTCTGATGGTAGTCATCTTTACAACTGGAGAGAAGATCTCTGTGAAATCAATTCCTTGTTTCTGCTGAAACCCTTTTACCACAAGTCTCGCCTTGTATCTTCTTCTACCGTTAGATTCTTCCTTTAGCCTATAGACCCACCTATTCTGTAACGCTTTCTTTCCTTC SEQ ID NO. 40: CATCTAACTGCTCCAAGTGAAGATTCTCTGCAGCTATTATGCTCAGAATAACTCTGATGGTAGTCATCTTTACAACTGGAGAGAAGATCTCTGTGAAATCAATTCCTTGTTTCTGCTGAAACCCTTTCACCACAAGTCTCGCCTTGTATCTTCTTCTACCGTTAGATTCTTCCTTTAGCCTATAGACCCACCTATTCTGTAACGCTTTCTTTCCTTC The second round of amplification products were digested by restriction enzyme Hph I after 60 min of enzyme digestion at 37°C, and the results are shown in Figure 5 Figure 2.

[0023] The results show that the easy-bolt soybean material can be recognized by Hph I, and two fragments of 118 bp and 99 bp can be obtained by complete enzyme digestion.

[0024] Example 5: Anti-bolt marker PD08-1 CAPS genotype identification in a heterozygous line segregation population Using the method described in Example 4, 38 single plants of a residual heterozygous line segregation population were detected, and according to different band types, the distribution of bolt phenotype of the segregation single plants was determined, and the results are shown in Figure 6 and Table 3.

[0025] Table 3: Number statistics of phenotype and genotype of a heterozygous line segregation population The results show that after the second round of PCR products of each single plant were digested by Hph I, the final product length of Heihe 43 with anti-bolt genotype (R) is 217 bp, the final product length of Heihe 18 with bolt genotype (S) is increased by 118 bp and 99 bp fragments, and the enzyme digestion fragments of single plants with heterozygous genotype (H) are lighter than those of Heihe 18. In the residual heterozygous line segregation population, there are 16 single plants with anti-bolt genotype (R), and the bands are all 217 bp; there are 8 single plants with bolt genotype (S), and the bands are 217 bp / 118 bp / 99 bp; there are 14 single plants with heterozygous genotype (H), and the bands are 217 bp / 118 bp / 99 bp.

[0026] Example 6: Soybean anti-bolt marker PD08-1 CAPS genotype identification in a natural variety resource population The genotypes of 69 natural resource varieties were detected using the method described in Example 4. Based on different band patterns, the genotypes of different varieties with resistance to pod bursting were determined. The results are as follows: Figure 7 As shown in Table 4.

[0027] Table 4. Genotypic Statistics of Natural Populations The results showed that 9 varieties shared the same pod-breaking genotype as Heihe 43; 60 varieties shared the same pod-breaking genotype as Heihe 18. The pod-breaking rate phenotypes of the two groups were compared using a T-test. P =0.0006 is a highly significant difference. Varieties with a pod-breaking rate of <26% are pod-breaking resistant. Six of the nine natural resources with pod-breaking resistant genotypes were found to be pod-breaking resistant, and the detection efficiency for pod-breaking resistant varieties reached 66.7%.

[0028] As can be seen from the above embodiments, the present invention provides a soybean pod-breaking resistance trait locus. qPD08-1 Its applications. The molecular marker detection method of the present invention can be used for identification of soybean blast-resistant pod germplasm resources, screening and functional research of blast-resistant pod genes, molecular marker-assisted selection breeding of blast-resistant pods, and natural resources. It has the characteristics of convenient detection, stable amplification products, and high specificity, which helps to broaden the sources of superior breeding parents and improve the efficiency of soybean breeding selection.

[0029] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Soybean pod-breaking resistance trait locus qPD08-1 Its application in the selection of soybean pod-resistant traits is characterized by... The soybean pod-resistant trait locus qPD08-1 Physical range corresponding to soybeans Glyma. The Wm82.a2.v1 reference genome contains a physical interval of 123.258 kb between chromosome 8, bp 35983663 and 36106921.

2. A CAPS molecular marker, characterized in that, The physical location of the CAPS molecular marker is at the soybean pod-blast trait locus. qPD08-1 Within the physical space, soybeans Glyma. The reference genome of Wm82.a2.v1 is located at 35988687 bp on chromosome 8; The soybean pod-resistant trait locus qPD08-1 The physical interval corresponds to chromosome 8, between 35983663 and 36106921 bp of the soybean Glyma.Wm82.a2.v1 reference genome, with a total physical interval length of 123.258 kb.

3. Based on soybean pod-resistant trait loci qPD08-1 Or a dedicated primer combination constructed from CAPS molecular markers, characterized in that, include PD08-1 CAPS-F primers, PD08-1 CAPS-R primers and PD08-1 CAPS-R1 primers; The PD08-1 The nucleotide sequence of the CAPS-F primer is shown in SEQ ID NO.33; The PD08-1 The nucleotide sequence of the CAPS-R primer is shown in SEQ ID NO.34; The PD08-1 The nucleotide sequence of the CAPS-R1 primer is shown in SEQ ID NO.

35.

4. The dedicated primer combination according to claim 3, characterized in that, The band amplified by the specific primer combination, after restriction enzyme digestion, yields a 217bp band, and the genotype of the soybean to be tested is defined as the pod-breaking genotype (R); the bands obtained after restriction enzyme digestion are 118bp and 99bp, and the genotype of the soybean to be tested is defined as the pod-breaking genotype (S).

5. The dedicated primer combination according to claim 4, characterized in that, The restriction enzyme is Hph I.

6. A gene detection kit, characterized in that, include PD08-1 CAPS-F primers, PD08-1 CAPS-R primers and PD08-1 CAPS-R1 primers; The PD08-1 The nucleotide sequence of the CAPS-F primer is shown in SEQ ID NO.33; The PD08-1 The nucleotide sequence of the CAPS-R primer is shown in SEQ ID NO.34; The PD08-1 The nucleotide sequence of the CAPS-R1 primer is shown in SEQ ID NO.

35.

7. The application of the CAPS molecular marker of claim 2, the special primer combination of claim 3, or the gene detection kit of claim 6 in the selection of soybean pod-resistant traits.

Citation Information

Patent Citations

  • Soybean anti-shattering main effect QTLqPD08-1 (Quantitative Trait Loci), and positioning method and application thereof

    CN108441575A

  • Application of soybean NAC transcription factor family gene Glyma08g41995

    CN110295175A

  • Soybean pod cracking resistance related molecular marker and application thereof

    CN120060527A