Application of specific target sgRNA for knocking out sirt7 gene and method for constructing anti-streptococcus and low temperature resistant rohu line

By knocking out the SIRT7 gene in tilapia using CRISPR/Cas9 gene editing technology, the problems of tilapia's susceptibility to Streptococcus agalactiae and insufficient cold tolerance have been solved, resulting in new germplasm with stronger antibacterial and cold-resistant capabilities, thus promoting the breeding of superior tilapia varieties.

CN121271875BActive Publication Date: 2026-02-24SHANGHAI OCEAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511863771.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-11
Publication Date
2026-02-24
Estimated Expiration
2045-12-11

AI Technical Summary

Technical Problem

Tilapia are susceptible to Streptococcus agalactiae infection and have insufficient tolerance to low temperatures, which limits their farming scope and economic benefits.

Method used

The SIRT7 gene was knocked out in tilapia using CRISPR/Cas9 gene editing technology. The 160th-161st bases of the SIRT7 gene were knocked out using specific target sgRNA, resulting in heterozygous and homozygous tilapia with SIRT7 gene deletion, which enhanced their resistance to Streptococcus agalactiae and low temperature tolerance.

Benefits of technology

The SIRT7 gene-deleted tilapia exhibited significantly improved resistance to Streptococcus agalactiae and low-temperature tolerance, providing an important model for breeding superior varieties and enhancing the aquaculture value of tilapia.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121271875B_ABST
    Figure CN121271875B_ABST
Patent Text Reader

Abstract

The application belongs to the field of biological science and biotechnology, and particularly relates to application of a specific target sgRNA for knocking out a SIRT7 gene and a method for constructing a streptococcus-resistant and low-temperature-resistant tilapia strain. The SIRT7 gene of the tilapia is knocked out through a CRISP / Cas9 gene editing technology, and the obtained SIRT7 gene deletion tilapia has stronger streptococcus resistance and low-temperature resistance, and the excellent germplasm of the streptococcus-resistant and low-temperature-resistant tilapia is obtained, which provides a new target for the research on the disease resistance and low-temperature resistance of farmed fish.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of bioscience and biotechnology, specifically relating to a method based on CRISPR / Cas9 technology to knock out the SIRT7 gene in tilapia, thereby obtaining superior tilapia germplasm that is resistant to streptococci and cold-resistant. Background Technology

[0002] Sirtuin 7 (SIRT7) is a nucleolar-based NAD+-dependent deacetylase that plays a central role in ribosome formation, cell proliferation, metabolic homeostasis, DNA repair, and aging. SIRT7 regulates chromatin structure and inhibits or activates specific gene expression by deacetyling histone H3 at lysine 18 (H3K18Ac). It can also activate RNA polymerase I-mediated rRNA synthesis, improving protein synthesis efficiency and serving as a crucial factor for rapid cell proliferation. SIRT7 also participates in double-strand break repair and is involved in oxidative and thermal stress responses.

[0003] Tilapia is an important aquaculture species and the largest exporter of freshwater aquaculture species in my country. During tilapia farming, it is highly susceptible to infection by Streptococcus agalactiae, a major cause of significant economic losses in the tilapia aquaculture industry. Therefore, obtaining superior tilapia germplasm resistant to Streptococcus agalactiae is a crucial issue and research direction in the tilapia aquaculture industry. Furthermore, low temperature is the primary threat to tilapia farming, limiting its cultivation range. Therefore, breeding for low-temperature tolerance is also an important direction in tilapia genetic improvement research.

[0004] With the emergence and development of CRISP / Cas9 gene editing technology, it has been gradually applied to the improvement of aquatic species. This invention attempts to use gene editing to rapidly obtain superior tilapia germplasm that is resistant to Streptococcus agalactiae and tolerant to low temperatures. Summary of the Invention

[0005] This study will use CRISP / Cas9 gene editing technology to knock out the SIRT7 gene in tilapia, obtaining heterozygous tilapia lacking the SIRT7 gene. Compared with the wild type, the SIRT7 gene-deficient heterozygous tilapia exhibits stronger resistance to Streptococcus agalactiae and greater tolerance to low temperatures, providing an important model for the breeding of superior tilapia.

[0006] This invention provides a specific target sgRNA for knocking out the SIRT7 gene, containing a nucleotide sequence as shown in SEQ ID No. 5 or a nucleotide sequence as shown in SEQ ID No. 6 obtained by transcription from raw materials, or more specifically, a nucleotide sequence as shown in SEQ ID No. 5 or a nucleotide sequence as shown in SEQ ID No. 6 obtained by transcription from raw materials.

[0007] SEQ ID No. 5:

[0008] GGAGUCUGAGCGGUCAGAGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAGUGGCACCGAGUCGGGCUUUU.

[0009] SEQ ID No. 6:

[0010] GATCACTAATACGACTCACTATAGGGAGTCTGAGCGGTCAGAGGGTTTTAGAGCTAGAAATAGC.

[0011] The sgRNA shown in SEQ ID No. 5 targets the sequence shown in SEQ ID No. 2 in the second exon of the SIRT7 gene, specifically bases 143-162 of the SIRT7 gene sequence shown in SEQ ID No. 1, knocking out nucleotides within and / or near the target sequence. As one implementation, bases 160-161 of the SIRT7 gene sequence shown in SEQ ID No. 1 are knocked out, resulting in a mutation in the SIRT7 gene. Compared to the wild-type SIRT7 gene, the mutated SIRT7 gene has two bases deleted at positions 160-161 of the SIRT7 gene sequence shown in SEQ ID No. 1, representing a base deletion mutation in the second exon of the SIRT7 gene.

[0012] SEQ ID No. 1:

[0013] TCTTCAGACTGGTGAGAGGGG AGAAAACAGATGCACATTTACAGCTAGCAGGCTAGACTAGCTCATGTTTGCTGTGTGCATTGTGAGGCTTACCCGGTTCCTCTGTCTTCCTCCCGCAGGTCGGGCGGGTCCTGAAAAAACC GG AGTCTGAGCGGTCAGAGGAGGAGGCCGCTGCTCTGCTGCTCCACAGAGACACTGTGGAGGAGCTCTGCAAGAGACAAGTCCGCAGAAATGTGCTCAAGAGGAAGCAGGAAGAGGTGAGACTCCGGCCCAGAGAGGCTGGATCTGGCCTGCTAAGATTGGTTTGTCAGCTAGAGGGACAACTTGAGAACAGAAGTGGAAGCAGCAGGTTTCTGGGTTGATTGTGTGAAGACTCAGAGAGGTTG AATGGTAGTCCCTCTTTATGCACA .

[0014] SEQ ID No. 2: GGAGTCTGAGCGGTCAGAGG.

[0015] The SIRT7 gene mutant obtained by knocking out bases 160-161 of the SIRT7 gene sequence shown in SEQ ID No. 1 gives tilapia with this SIRT7 gene mutant both stronger resistance to Streptococcus agalactiae and cold tolerance. Compared with the wild type, the mutant has a significantly higher survival rate when infected or exposed to low temperatures.

[0016] The aforementioned specific target sgRNA for knocking out the SIRT7 gene and the mutated SIRT7 gene can be used to breed tilapia strains resistant to streptococci and tolerant to low temperatures, especially tilapia strains resistant to Streptococcus agalactiae infection. The mutated SIRT7 gene contains the SIRT7 gene sequence shown in SEQ ID No. 1 with two bases deleted from positions 160-161, and more specifically, the SIRT7 gene sequence shown in SEQ ID No. 1 with two bases deleted from positions 160-161.

[0017] This invention provides a method for constructing a streptococcal-resistant and low-temperature-tolerant tilapia strain, comprising the following steps:

[0018] (1) Inject Cas9 protein and sgRNA as shown in SEQ ID No. 5 into tilapia embryos, knock out bases 160-161 of the SIRT7 gene sequence shown in SEQ ID No. 1 of tilapia, and obtain F0 generation heterozygous tilapia with SIRT7 gene mutation; the mass ratio of Cas9 protein to sgRNA is 3-4:1, preferably 3.2:1; the injection amount of sgRNA for each embryo is 0.2-0.4 ng, preferably 0.25 ng.

[0019] (2) F0 generation SIRT7 gene mutation heterozygous tilapia were mated with wild-type tilapia, and F1 generation SIRT7 gene mutation heterozygous tilapia were identified and screened.

[0020] Furthermore, the process includes step (3): hybridizing F1 generation heterozygous tilapia with SIRT7 gene mutation, identifying and screening to obtain F2 generation homozygous tilapia with SIRT7 gene mutation. Further, F1 generation tilapia with the same number and position of deleted SIRT7 gene bases (knockout of bases 160-161 of the SIRT7 gene sequence shown in SEQ ID No. 1) are hybridized to obtain F2 generation homozygous tilapia with SIRT7 gene mutation.

[0021] In steps (1)-(3), PCR amplification and gene sequencing were used to identify and screen F0 generation heterozygous tilapia with SIRT7 gene mutation, F1 generation heterozygous tilapia with SIRT7 gene mutation, and F2 generation homozygous tilapia with SIRT7 gene mutation. In each step, the primer sequences used for PCR amplification are shown in SEQ ID NO. 3 and 4. After PCR amplification and gene sequencing, the tilapia with base deletions were identified as F0 generation heterozygous mutant tilapia, F1 generation heterozygous mutant tilapia, and F2 generation homozygous tilapia with SIRT7 gene mutation, respectively. As one implementation method, the number of deleted bases was two.

[0022] its-ms-SIRT7-F: 5' TCTTCAGACTGGTGAGAGGGG 3' (SEQ ID NO.3).

[0023] its-ms-SIRT7-R: 5' TGTGCATAAAGAGGGACTACCATT 3' (SEQ ID NO.4).

[0024] Furthermore, the streptococcus described in this invention is agalactococcus.

[0025] The beneficial effects of this invention lie in the fact that, for the first time, the SIRT7 deacetylase gene was knocked out in tilapia, and the possibility of obtaining new tilapia germplasm was investigated. The SIRT7 gene in tilapia was knocked out using CRISP / Cas9 gene editing technology, resulting in tilapia lacking the SIRT7 gene. Through experiments with activated Streptococcus agalactiae infection, it was found that, compared to the wild type, the SIRT7 mutant tilapia exhibited stronger antibacterial and low-temperature resistance, especially against Streptococcus agalactiae. This provides an important model for the breeding of superior tilapia, obtaining excellent tilapia germplasm resistant to Streptococcus agalactiae and resistant to low temperatures, and providing a new target for obtaining new disease-resistant and low-temperature-resistant germplasm in farmed fish. Attached Figure Description

[0026] Figure 1 A schematic diagram of primer design for SIRT7 knockout target on SEQ ID No.1 sequence.

[0027] Figure 2 This is a peak diagram of the SEQ ID No. 1 sequence, which shows no editing, as revealed by TA cloning sequencing.

[0028] Figure 3 This is a peak diagram of the SEQ ID No. 1 sequence showing editing (deletion of bases 160-161) as revealed by TA cloning sequencing.

[0029] Figure 4 This is a survival curve of the SIRT7 gene-edited tilapia F1 generation heterozygous mutant when infected with Streptococcus agalactiae.

[0030] Figure 5 This is a survival curve of the SIRT7 gene-edited tilapia F1 generation heterozygous mutant during cooling. Detailed Implementation

[0031] Example 1

[0032] (a) Design of target sites for SIRT7 gene knockout in tilapia, screening of gRNA targets and primers

[0033] First, the tilapia SIRT7 gene sequence (GeneID: 100700228\Ensembl: ENSONIG00000017759) was located on NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov / ). Knockout targets were designed online using Primer Blast on the NCBI website, including upstream and downstream gRNA targets TS-ms-SIRT7 (targetsite sequences). Oligo and SgRNA-scaffolds were biosynthesized. PCR was performed using this template to obtain an in vitro transcription template for the gRNA, followed by in vitro transcription of the T7 promoter.

[0034] The SIRT7 gene sequence fragment (GeneID: 100700228\Ensembl: ENSONIG00000017759, SEQ ID No. 1, containing exon 2) is shown below. Figure 1As shown, the full-length sequence of SEQ ID No. 1 is 410 bp, including a partial sequence of the first exon and the complete sequence of the second exon. The sequences marked in purple are the identified upstream and downstream primer sequences. The target site was designed in the second exon, and the sequence marked in red is the target sequence (SEQ ID No. 2), located at positions 143-162 of the SIRT7 gene sequence. Upstream and downstream gRNA targets TS-ms-SIRT7 (Targetsite sequences) were designed for this gene.

[0035] The SIRT7 gene sequence fragment (SEQ ID No. 1) containing a partial sequence of the first exon and the complete sequence of the second exon is as follows:

[0036] TCTTCAGACTGGTGAGAGGGG AGAAAACAGATGCACATTTACAGCTAGCAGGCTAGACTAGCTCATGTTTGCTGTGTGCATTGTGAGGCTTACCCGGTTCCTCTGTCTTCCTCCCGCAGGTCGGGCGGGTCCTGAAAAAACC GG AGTCTGAGCGGTCAGAGG AGGAGGCCGCTGCTCTGCTGCTCCACAGAGACACTGTGGAGGAGCTCTGCAAGAGACAAGTCCGCAGAAATGTGCTCAAGAGGAAGCAGGAAGAGGTGAGACTCCGGCCCAGAGAGGCTGGATCTGGCCTGCTAAGATTGGTTTGTCAGCTAGAGGGACAACTTGAGAACAGAAGTGGAAGCAGCAGGTTTCTGGGTTGATTGTGTGAAGACTCAGAGAGGTTG AATGGTAGTCCCTCTTTATGCACA .

[0037] The designed target site sequence (SEQ ID NO.2) is as follows, which is a positive target: TS-ms-SIRT7: 5'GGAGTCTGAGCGGTCAGAGG 3'.

[0038] The specific target gRNA for the SIRT7 gene is as follows (SEQ ID No. 5):

[0039] GGAGUCUGAGCGGUCAGAGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAGUGGCACCGAGUCGGGCUUUU.

[0040] Identification primers were designed online using Primer Blast on the NCBI website, with the following selection criteria: (1) the target site was located between the upstream and downstream primers; (2) the length of the upstream and downstream primers was 20-25 bp; (3) the amplified fragment was between 300 bp and 800 bp; and (4) the designed primers had high specificity (i.e., only the desired band could be amplified). The designed identification primers are as follows:

[0041] its-ms-SIRT7-F: 5' TCTTCAGACTGGTGAGAGGGG 3' (SEQ ID NO.3).

[0042] its-ms-SIRT7-R: 5' TGTGCATAAAGAGGGACTACCATT 3' (SEQ ID NO.4).

[0043] The aforementioned primers Oligo and SgRNA-scaffold were then biosynthesized.

[0044] (II) Synthesis and purification of gRNA in vitro transcription template:

[0045] This invention utilizes the T7 promoter for in vitro transcription. Specific operational steps were performed using the T7 in vitro transcription kit from Shanghai Sangon Biotech Co., Ltd., following the manufacturer's instructions. The synthesized Oligo, SgRNA-scaffold, and identification primers were dissolved in sterile ddH2O to a final concentration of 10 µM. A 40 µL mixture consisted of: 3 µL Oligo (10 µM), 3 µL SgRNA-scaffold (10 µM), 20 µL 2x EasyTaq PCR SuperMix (+dye), and water to a final concentration of 40 µL. The PCR reaction was performed at 94 °C for 3 min, followed by 34 cycles of 94 °C for 30 s, 65 °C for 30 s, and 72 °C for 1 min, with a final extension at 72 °C for 5 min. The mixture was then stored at 4 °C for long-term storage. Four tubes (160 µL total) were synthesized and then purified by column chromatography.

[0046] Oligo's sequence, as shown in SEQ ID No. 6, includes the T7 promoter sequence and the target sequence. SEQ ID No. 6: GATCACTAATACGACTCACTATAG GGAGTCTGAGCGGTCAGAGG GTTTTAGAGCTAGAAATAGC.

[0047] The target sequence is GGAGTCTGAGCGGTCAGAGG. The specific steps for purifying gRNA can be found in the instructions for the QIAGEN QIAquick PCR pruning kit: First, add 1 µL of TURBO DNase to the transcription product and incubate at 37°C for 15 min to remove excess untranscribed template DNA. After incubation, add 1 µL of 0.5 MEDTA to terminate the reaction. Then, add 30 µL of LiCl and 30 µL of nuclease-free water, mix thoroughly, and incubate overnight at -80°C. The next day, centrifuge at 12000 rpm for 15 min at 4°C, discard the supernatant, wash with 1 mL of 70% ice-cold ethanol, and finally resuspend the RNA in nuclease-free water.

[0048] The concentration of purified gRNA was determined using NanoDrop (Thermo, USA), and its size and quality were determined by electrophoresis (150V / 25min).

[0049] Example 2: Knocking out the SIRT7 gene in tilapia

[0050] The specific steps of gene knockout are as follows:

[0051] (a) Microinjection

[0052] The injection dosage of the Cas9 protein and gRNA mixture was 800 ng / μL: 250 ng / μL; the injection volume was 1 nL / embryo. The Cas9 protein and target gRNA were placed on ice, mixed and used immediately, and injected into tilapia embryos in the cell stage. The surviving embryos were cultured to obtain SIRT7 gene knockout tilapia.

[0053] Among them, the target TS-ms-SIRT7 is SEQ ID NO.2; the primers used in gene sequencing are its-ms-SIRT7-F and its-ms-SIRT7-R, as shown in SEQ ID NO.3 and 4.

[0054] (II) Identification and screening of F0 heterozygous mutants: Tilapia embryos developed to 2 months of age after microinjection. Tissue was collected from the tail of each fish, and genomic DNA was crudely extracted from each sample using the alkaline cleavage method. The main operation steps are as follows:

[0055] Add 40µL of 50mM NaOH solution to each tube of tilapia tail tissue and incubate at 95℃ for 10min;

[0056] Briefly centrifuge to bring all the liquid to the bottom of the tube, vortex for about 1 minute, and then incubate at 95°C for 10 minutes.

[0057] After a brief centrifugation, place on ice for 1-2 min, add 5 µL Tri-HCl (pH=8.0), vortex, centrifuge at 12000 rpm for 10 min at room temperature, store briefly at 4℃, and store long-term at -20℃.

[0058] The number of missing bases in the F0 generation mutant was determined by PCR amplification using genomic DNA extracted from each tilapia sample as a template, and further methods such as TA cloning, transformation of competent cells and bacterial culture were used to determine the number of missing bases.

[0059] The PCR reaction system (20µL) consisted of: 1µL of its-ms-SIRT7-F (10µM), 1µL of its-ms-SIRT7-R (10µM), 10µL of 2xEasyTaq PCR SuperMix (+dye), 1µL of extracted genomic DNA, and finally water to a final volume of 20µL. The PCR reaction was performed at 94℃ for 3 min, 94℃ for 30 s, 60℃ for 30 s, and 72℃ for 1 min for 34 cycles, followed by a final extension at 72℃ for 5 min. The sample was then stored at 4℃ for long-term preservation.

[0060] The primers used for gene sequencing were its-ms-SIRT7-F: 5' TCTTCAGACTGGTGAGAGGGG 3' (SEQ ID NO. 3) and its-ms-SIRT7-R: 5' TGTGCATAAAGAGGGACTACCATT 3' (SEQ ID NO. 4). The peak plots were viewed using Chrome software, and the sequences were compared with those obtained from the NCBI website's BLAST database.

[0061] The TA cloning and sequencing results of the F0 generation heterozygous mutant showed two sequences, one of which was the wild-type sequence (…). Figure 2 No loss occurred near the target site (see) Figure 2 (Red box area); A sequence missing two bases ( Figure 3 A deletion occurs at bases 160-161 of SEQ ID NO.1 (see...) Figure 3 (Red box area).

[0062] The F0 generation heterozygous mutants were selected for subsequent propagation.

[0063] Example 3: Construction of F1 generation heterozygous tilapia and identification of anti-aggregate streptococcal phenotype

[0064] The F0 generation heterozygotes (deleted bases at positions 160-161 of the SIRT7 gene) obtained after identification in Example 2 were crossed with wild-type tilapia to obtain F1 generation tilapia. When the F1 generation tilapia reached 2 months of age, their tails were clipped, and genomic DNA was extracted. PCR amplification products were used to determine the number of bases deleted in the SIRT7-F1 generation heterozygous mutant through TA cloning, transformation of competent cells, and bacterial culture sequencing. The TA cloning and sequencing results of the F1 generation heterozygous mutant showed two sequences, one of which was the wild-type sequence (…). Figure 2 No loss occurred near the target site (see) Figure 2 (Red box indicates the sequence with two bases missing at the target site) Figure 3 A deletion occurs at bases 160-161 of SEQ ID NO.1 (see...) Figure 3 (Red box area).

[0065] F1 generation heterozygotes with a two-base deletion at positions 160-161 of SEQ ID NO.1 were selected for subsequent phenotypic identification. F1 generation heterozygous tilapia and wild-type tilapia were intraperitoneally injected with 1x10⁸ CFU / ml of activated Streptococcus agalactiae, at a dose of 100 μL. Survival rates over 7 days were statistically plotted for wild-type tilapia (gray) not injected with Streptococcus agalactiae, heterozygous mutant tilapia (green) not injected with Streptococcus agalactiae, wild-type tilapia (blue) intraperitoneally injected with Streptococcus agalactiae, and heterozygous tilapia (red) intraperitoneally injected with Streptococcus agalactiae. The results are shown below. Figure 4 .Depend on Figure 4 As shown in the survival curves, when infected with Streptococcus agalactiae, the survival rate of the SIRT7 heterozygous mutant was significantly higher (red) compared to wild-type tilapia (blue). These experiments demonstrate that the SIRT7 heterozygous mutant tilapia possesses stronger resistance to Streptococcus agalactiae.

[0066] Example 4: Screening of F2 generation mutants

[0067] The selected F1 generation heterozygous mutants (with a two-base deletion at positions 160-161 of SEQ ID NO. 1) were hybridized to obtain F2 generation tilapia. When the F2 generation tilapia reached 2 months of age, their tails were clipped, and genomic DNA was extracted. TA cloning, transformation of competent cells, and bacterial culture were performed to determine the number of bases lost in the F2 generation. A difference of 2 bases between the F2 generation and the wild-type tilapia was considered homozygous (e.g., ...). Figure 3 (As shown). All SIRT7 homozygous mutants lack 2bp.

[0068] The TA cloning sequencing results of the F2 generation homozygous mutant showed a single sequence with two bases missing at the target site. Figure 3A deletion occurs at bases 160-161 of SEQ ID NO.1 (see...) Figure 3 (Red box area).

[0069] Example 5 Identification of Low-Temperature Resistance Phenotype

[0070] The F1 generation heterozygotes with a two-base deletion at positions 160-161 of SEQ ID NO.1 were selected for low-temperature phenotype identification. F1 generation heterozygous tilapia and wild-type tilapia were simultaneously cooled in a low-temperature incubator. On the first day, they were fasted and incubated overnight at 28°C. On the second day, the temperature was lowered by 1°C per hour starting at 9:00 AM and maintained overnight at 18°C ​​until 7:00 PM, continuing for 12 hours. On the third day, the temperature was lowered by 1°C per hour to 8°C at 7:00 AM, and observed for 2.5 hours. After rewarming, the survival rates of wild-type and heterozygous tilapia were statistically analyzed and plotted. The results are shown below. Figure 5 As shown in Figure 5, when the temperature drops to 8 degrees Celsius, the survival rate of the SIRT7 heterozygous mutant is significantly higher (red) compared to wild-type tilapia (blue). These experiments demonstrate that the SIRT7 heterozygous mutant tilapia has stronger resistance to low temperatures.

Claims

1. The application of specific target sgRNA for knocking out the SIRT7 gene in constructing streptococcal-resistant and low-temperature-tolerant tilapia strains, characterized in that, The nucleotide sequence of the specific target sgRNA is the nucleotide sequence shown in SEQ ID No.

5.

2. A method for constructing a streptococcal-resistant and low-temperature-tolerant tilapia strain, characterized in that the steps include... include: (1) Cas9 protein and sgRNA shown in SEQ ID No. 5 were injected into tilapia embryos, and bases 160-161 of the SIRT7 gene sequence shown in SEQ ID No. 1 of tilapia were knocked out to obtain F0 generation heterozygous tilapia with SIRT7 gene mutation; (2) F0 generation SIRT7 gene mutation heterozygous tilapia were mated with wild-type tilapia, and F1 generation SIRT7 gene mutation heterozygous tilapia were identified and screened.

3. The method according to claim 2, characterized in that, It also includes step (3), hybridizing F1 generation SIRT7 gene mutation heterozygous tilapia, identifying and screening to obtain F2 generation SIRT7 gene mutation homozygous tilapia.

4. The method according to claim 3, characterized in that, Tilapia of the F1 generation with the same number and location of missing bases in the SIRT7 gene were hybridized to obtain homozygous F2 generation tilapia with SIRT7 gene mutation.

5. The method according to claim 2 or 3, characterized in that, Heterozygous tilapia with SIRT7 gene mutation in F0 generation, heterozygous tilapia with SIRT7 gene mutation in F1 generation, and homozygous tilapia with SIRT7 gene mutation in F2 generation were identified and screened using PCR amplification and gene sequencing, respectively.

6. The method according to claim 5, characterized in that, The primer sequences used for PCR amplification are shown in SEQ ID NO.3 and 4.

7. The application of the mutated SIRT7 gene in constructing streptococcal-resistant and low-temperature-tolerant tilapia strains, characterized in that... The mutated SIRT7 gene contains the SIRT7 gene sequence shown in SEQ ID No. 1, which is missing two bases at positions 160-161.

Citation Information

Patent Citations

  • Persistent allogenically modified immune cells and methods of use thereof

    CN118234865A

  • RELA gene, protein, amino acid site, mutant protein and application of micropterus salmoides

    CN118667791A