A molecular marker associated with barley powdery mildew resistance and use thereof

Abstract

The application provides a molecular marker related to barley powdery mildew resistance and application thereof, and belongs to the technical field of molecular biology and plant molecular breeding. BPM2 The SNP marker is located on the 6th position of the gene BPM2 The polymorphic site is A / C. A specific amplification primer is designed according to the molecular marker, and genotype identification is carried out through PCR amplification and high-resolution melting curve analysis. The molecular marker and the amplification primer thereof can be used for predicting the barley powdery mildew resistance, breeding the barley germplasm resources resistant to the powdery mildew, and have the advantages of simple operation, high identification accuracy, cost saving and the like, and can obviously shorten the breeding period of the barley resistant to the powdery mildew and save the manpower and material resources.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and plant molecular breeding technology, and in particular relates to a molecular marker related to resistance to barley powdery mildew and its application. Background Technology

[0002] Barley powdery mildew is caused by fungi. Erysiphe graminis f. sp. hordei This fungal disease not only leads to decreased barley yield and deterioration in quality, but may also indirectly threaten food safety and human health. Researching the mechanisms of barley resistance to powdery mildew has significant practical implications: firstly, it reduces yield losses to ensure food security; secondly, it lowers the intensity of chemical pesticide application to alleviate environmental pressure; and thirdly, it allows for the discovery and utilization of disease-resistant gene resources, providing support for barley variety improvement and high-quality industrial development.

[0003] Current research on barley powdery mildew resistance genes mainly focuses on the MLO gene family, while the exploration of other resistance-related genes is not yet systematic enough. Therefore, it is urgent to discover new powdery mildew resistance segments and develop molecular markers for related genes to achieve efficient screening of powdery mildew-resistant barley materials, thereby shortening the breeding cycle. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a molecular marker related to barley powdery mildew resistance and its application.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] This invention provides a molecular marker associated with resistance to barley powdery mildew, wherein the molecular marker contains a SNP locus, and resistance to barley powdery mildew is identified by detecting the genotype of the SNP locus. The SNP locus is located on barley chromosome 4. BPM2 At position 6 of the gene, if the genotype here is AA or AC, the barley is resistant to powdery mildew; if the genotype here is CC, the barley is susceptible to powdery mildew.

[0007] The sequence of the molecular marker for resistance to powdery mildew is shown in SEQ ID NO.1; the sequence of the molecular marker for susceptibility to powdery mildew is shown in SEQ ID NO.2.

[0008] This invention provides a primer for identifying resistance to barley powdery mildew, the primer being used to detect the molecular marker;

[0009] The primers include HvBg02-F and HvBg02-R;

[0010] The nucleotide sequence of HvBg02-F is shown in SEQ ID NO.3;

[0011] The nucleotide sequence of HvBg02-R is shown in SEQ ID NO.4.

[0012] This invention provides a method for identifying barley powdery mildew resistance genotypes, comprising the following steps:

[0013] 1) Extract genomic DNA from the barley to be tested, and use it as a template to perform PCR amplification using the primers HvBg02-F and HvBg02-R to obtain the amplification product;

[0014] 2) Determine the barley genotype based on the melting curve of the amplification products;

[0015] If the melting curve of the amplification product shows a single peak and the melting temperature is 84.0~84.5℃, then the barley to be tested is considered to be... BPM2 The genotype of the gene at locus 6 is AA, which is identified as a homozygous genotype for resistance to powdery mildew.

[0016] If the melting curve of the amplification product shows a single peak and the melting temperature is 85.0~85.5℃, then the barley to be tested is considered safe. BPM2 The genotype of the gene at locus 6 is CC, which is determined to be a homozygous genotype for powdery mildew susceptibility.

[0017] If the melting curve of the amplification product is bimodal, and the melting temperature of the main peak is 84.5~85.0℃, then the barley to be tested is determined to be... BPM2 The genotype at locus 6 is AC, which is identified as a heterozygous genotype resistant to powdery mildew.

[0018] This invention provides the application of the aforementioned molecular marker in identifying genotypes susceptible to barley powdery mildew.

[0019] This invention provides the application of the aforementioned molecular marker in identifying susceptibility to barley powdery mildew.

[0020] This invention provides the application of the aforementioned molecular markers in the identification and screening of barley germplasm resources resistant to powdery mildew.

[0021] This invention provides the application of the aforementioned molecular markers in marker-assisted breeding of barley powdery mildew resistant varieties.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] This invention provides a molecular marker associated with barley powdery mildew resistance and its application, by recognizing... BPM2The invention utilizes SNP markers of genes, designs specific amplification primers for these SNPs, and identifies genotypes through PCR amplification and high-resolution melting analysis (HRM). The molecular markers provided by this invention exhibit significant differences in annealing temperature among their amplification products, allowing for haplotype determination of the barley material under test via HRM analysis. This method is low-cost, requires no enzyme digestion or gel electrophoresis, and offers a convenient and rapid detection procedure. It can shorten the breeding cycle for powdery mildew-resistant barley, reduce breeding costs, and offers advantages such as simple operation, high identification accuracy, and cost savings. Furthermore, using the molecular markers provided by this invention for assisted breeding can achieve [further details needed]. BPM2 Accurate, simple, and efficient genotyping, along with non-destructive testing in the early stages of barley growth, makes it suitable for large-scale commercial breeding. BPM2 Extensive screening of genotypes and analysis of barley germplasm resources BPM2 Allele identification. Attached Figure Description

[0024] Figure 1 To compare the powdery mildew resistant parent Feng7 with the powdery mildew susceptible parent Vlamingh BPM2 Sequence alignment diagrams between genes and sequence diagrams of primers for specific molecular markers;

[0025] Figure 2 HRM curves for powdery mildew resistant variety Feng7, powdery mildew susceptible variety Vlamingh, and high-yield high-quality barley variety Hua30; where F represents Feng7, V represents Vlamingh, and H represents Hua30.

[0026] Figure 3 HRM curves for heterozygous F2 individuals constructed from the powdery mildew resistant parent Feng7 and the powdery mildew susceptible parent Vlamingh, and the two parents; where A represents individuals with the same genotype as the powdery mildew susceptible parent Vlamingh, B represents individuals with the same genotype as the powdery mildew resistant parent Feng7, and Z represents heterozygosity.

[0027] Figure 4 Sequencing results for homozygous and heterozygous individuals in barley parents and F2 population; where A represents individuals from powdery mildew-susceptible parents or F2 populations, B represents individuals from powdery mildew-resistant parents or F2 populations, and Z represents heterozygous individuals. Detailed Implementation

[0028] This invention provides a molecular marker associated with resistance to barley powdery mildew, wherein the molecular marker contains a SNP locus, and resistance to barley powdery mildew is identified by detecting the genotype of the SNP locus. The SNP locus is located on barley chromosome 4. BPM2At position 6 of the gene, if the genotype here is AA or AC, the barley is resistant to powdery mildew; if the genotype here is CC, the barley is susceptible to powdery mildew.

[0029] The sequence of the molecular marker for resistance to powdery mildew is shown in SEQ ID NO.1; the sequence of the molecular marker for susceptibility to powdery mildew is shown in SEQ ID NO.2.

[0030] SEQ ID NO.1:

[0031] CGCCC A AGGTCCTGGTCCTCGGAAAGCAAAGCAACACGGCA;

[0032] SEQ ID NO.2:

[0033] CGCCC C AGGTCCTGGTCCTCGGAAAGCAAAGCAACACGGCA;

[0034] The underlined positions are SNP sites.

[0035] This invention provides a primer for identifying resistance to barley powdery mildew, the primer being used to detect the molecular marker;

[0036] The primers include HvBg02-F and HvBg02-R;

[0037] The nucleotide sequence of HvBg02-F is shown in SEQ ID NO.3;

[0038] SEQ ID NO.3: CGAACTGAAAGAAGACGGAGAC;

[0039] The nucleotide sequence of HvBg02-R is shown in SEQ ID NO.4;

[0040] SEQ ID NO. 4: GGCTAATAATCCTGCCGTGTTG.

[0041] This invention provides a method for identifying barley powdery mildew resistance genotypes, comprising the following steps:

[0042] 1) Extract genomic DNA from the barley to be tested, and use it as a template to perform PCR amplification using the primers HvBg02-F and HvBg02-R to obtain the amplification product;

[0043] 2) Determine the barley genotype based on the melting curve of the amplification products;

[0044] If the melting curve of the amplification product shows a single peak and the melting temperature is 84.0~84.5℃, then the barley to be tested is considered to be... BPM2 The genotype of the gene at locus 6 is AA, which is identified as a homozygous genotype for resistance to powdery mildew.

[0045] If the melting curve of the amplification product shows a single peak and the melting temperature is 85.0~85.5℃, then the barley to be tested is considered safe. BPM2 The genotype of the gene at locus 6 is CC, which is determined to be a homozygous genotype for powdery mildew susceptibility.

[0046] If the melting curve of the amplification product is bimodal, and the melting temperature of the main peak is 84.5~85.0℃, then the barley to be tested is determined to be... BPM2 The genotype at locus 6 is AC, which is identified as a heterozygous genotype resistant to powdery mildew.

[0047] In this invention, genomic DNA is extracted from the barley to be tested and used as a template for PCR amplification using the primers HvBg02-F and HvBg02-R to obtain the amplification product; the preferred PCR amplification reaction system is as follows:

[0048] The reaction buffer for 2×HRM qPCR Master Mix is ​​preferably 8~12 µL, more preferably 9~11 µL, and even more preferably 10 µL;

[0049] The preferred volume of primer HvBg02-F is 0.5~1 µL, more preferably 0.7~0.9 µL, and even more preferably 0.8 µL; the preferred concentration is 8~12 µM, more preferably 9~11 µM, and even more preferably 10 µM.

[0050] The preferred volume of primer HvBg02-R is 0.5~1 µL, more preferably 0.7~0.9 µL, and even more preferably 0.8 µL; the preferred concentration is 8~12 µM, more preferably 9~11 µM, and even more preferably 10 µM.

[0051] The DNA template is preferably 0.5~1.5 µL, more preferably 0.8~1.2 µL, and even more preferably 1 µL;

[0052] The preferred volume of ultrapure water used is 5~10 µL, more preferably 6.5~8.5 µL, and even more preferably 7.4 µL.

[0053] In this invention, the preferred PCR reaction procedure is: 95°C pre-denaturation for 5 minutes; 95°C denaturation for 15 seconds, 56°C annealing for 15 seconds, 72°C extension for 60 seconds, for a total of 40 cycles.

[0054] In this invention, the melting curve is preferably obtained using the HRM reaction program, which consists of denaturation at 95°C for 1 minute, annealing at 40°C for 1 minute, and heating from 65°C to 97°C at a rate of 0.1°C / second, with fluorescence data collected 15 times per second.

[0055] This invention provides the application of the aforementioned molecular marker in identifying genotypes susceptible to barley powdery mildew.

[0056] This invention provides the application of the aforementioned molecular marker in identifying susceptibility to barley powdery mildew.

[0057] This invention provides the application of the aforementioned molecular markers in the identification and screening of barley germplasm resources resistant to powdery mildew.

[0058] This invention provides the application of the aforementioned molecular markers in marker-assisted breeding of barley powdery mildew resistant varieties.

[0059] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0060] Source of materials

[0061] The DNA extraction kit used was the TianGen High-Efficiency Plant Genomic DNA Extraction Kit (Catalog No.: DP350).

[0062] Feng7, a variety of barley, originated from the Dali Prefecture Agricultural Research Institute and is a hybrid of Feng6 and S500.

[0063] Vlamingh is a major barley variety grown in Australia, supplied by the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0064] Hua 30, formerly known as Hua 94-30, is a two-row barley variety bred by the Shanghai Academy of Agricultural Sciences and the Jiaxing Academy of Agricultural Sciences using anther culture technology on the F3 hybrid material of 82164 and Xiumai 1.

[0065] Example 1

[0066] Development of SNP molecular markers for barley powdery mildew resistance

[0067] BSA analysis was performed on the F2 generation of a hybrid population consisting of the powdery mildew-resistant parent Feng7 and the powdery mildew-susceptible parent Vlamingh. After data quality control, variant detection, and association analysis, the powdery mildew resistance region was located on chromosome 4, specifically the segment 623165594-623744888. Local and online sequence alignment analysis was performed using software such as DNAMAN and the NCBI database to obtain several SNP loci. PCR primers were designed for these loci, and their reliability was determined by gel electrophoresis and HRM experiments. The available primers were then used to determine linkage relationships in the F2 segregating population phenotype, and loci reflecting powdery mildew resistance were screened. BPM2 A gene contains a SNP locus where the powdery mildew resistance allele is A or heterozygous, and the powdery mildew susceptibility allele is C (e.g., ...). Figure 1 Molecular markers developed for this specific nucleic acid sequence can be used to identify haplotypes in this region.

[0068] Example 2

[0069] The primers for PCR-HRM analysis were designed based on the molecular markers developed in Example 1. The primer design principle is as follows:

[0070] Primers were designed on both sides of the SNP to ensure the amplification product length was between 100-200 bp, with the difference between the infective and resistant parents only at the target SNP site. A fluorescent nucleic acid dye was added to the PCR amplification system. This dye fluoresces when the DNA is double-stranded and loses fluorescence when the DNA is single-stranded. After PCR amplification, the dye is distributed throughout the double-stranded DNA of the amplified product. For HRM analysis, the PCR product was slowly heated while recording the fluorescence value, resulting in a curve showing fluorescence values ​​from high to low. The derivative of this curve is the melting curve. The homozygous melting curve exhibits a single peak, and the x-axis of the highest point on the curve represents the melting temperature (T). m (Value). Since the amplification products differ by only one SNP, when the SNP is A, the base pair has two hydrogen bonds, T m The value is low; when the SNP is C, the base pair has 3 hydrogen bonds, T m The value is relatively high; when the site is heterozygous, T m The value lies between the two homozygous types and a secondary peak is present. For the haplotype in this invention, if the melting curve of the amplified product is a single peak, the melting temperature (T) is... m If the melting temperature (T0.0) is 84.0-84.5℃, then the barley to be tested is determined to be a homozygous haplotype resistant to disease; if the melting curve of the amplified product is a single peak, the melting temperature (T0.0) is 84.0-84.5℃. m If the melting temperature (T0.0) is 85.0-85.5℃, then the barley to be tested is determined to be a homozygous haplotype susceptible to disease; if the melting curve of the amplified product is bimodal, and the melting temperature of the main peak (T0.0) is 85.0-85.5℃, then the barley to be tested is determined to be homozygous haplotype susceptible to disease; if the melting curve of mIf the temperature (value) is 84.5~85.0℃, the barley to be tested is determined to be heterozygous. Primers are shown in Table 1.

[0071] Table 1. Specific molecular marker primer sequences and related parameters

[0072]

[0073] Example 3

[0074] Establishment of a molecular marker detection method for SNPs in barley powdery mildew resistance regions

[0075] Based on the detection primers for the molecular markers designed in Example 2, a PCR reaction procedure and reaction system were designed:

[0076] PCR reaction system (20 µL): 10 µL of 2×YALEPIC® UF HRM qPCR MasterMix reaction buffer, primers HvBg02-F and HvBg02-R both used at a concentration of 10 µM, with a volume of 0.8 µL for each primer, 1 µL of DNA template, and ultrapure water to make up the remaining volume. The instrument used for PCR and HRM was a Dongsheng Gene Amplification System (model: ETC811).

[0077] The PCR reaction conditions were: 95℃ pre-denaturation for 5 minutes; 95℃ denaturation for 15 seconds, 56℃ annealing for 15 seconds, and 72℃ extension for 60 seconds, for a total of 40 cycles.

[0078] The HRM analysis parameters were: pre-denaturation at 95℃ for 60 seconds; annealing at 40℃ for 1 minute; heating from 65℃ to 97℃ at a rate of 0.1℃ / second, with fluorescence data collected 15 times per second.

[0079] Example 4

[0080] Application of SNP molecular markers of barley powdery mildew resistance segment in detecting barley germplasm resources

[0081] (4.1) Barley varieties

[0082] The powdery mildew resistant variety Feng7 (F), the powdery mildew susceptible variety Vlamingh (V), and the high-quality and high-yielding barley variety Hua30 (H).

[0083] (4.2) Extraction of barley genomic DNA and primer synthesis

[0084] Genomic DNA was extracted from the above barley materials using the CTAB method or a plant genomic DNA extraction kit, and the primer sequences shown in Table 1 were synthesized.

[0085] (4.3) PCR amplification

[0086] The PCR reaction system and procedure are as described in Example 3.

[0087] (4.4) HRM Analysis

[0088] The HRM analysis parameters are as described in Example 3.

[0089] (4.5) Results Analysis

[0090] HRM results are as follows Figure 2 As shown, the curves for Flower 30 and Vlamingh were classified together, and neither was resistant to powdery mildew. To verify the accuracy of the HRM detection results, the three parental materials were sequenced and compared. The results showed that the molecular marker detection results were consistent with the sequencing results, such as... Figure 4 This demonstrates that the primers provided by this invention can accurately identify barley powdery mildew resistance, enabling accurate and efficient screening of barley varieties.

[0091] Example 5

[0092] Barley powdery mildew resistance gene BPM2 Detection of single-gene segregation in the BCF population

[0093] (5.1) Barley materials

[0094] The F2 population was constructed by combining the powdery mildew-resistant parent Feng7 with the powdery mildew-susceptible parent Vlamingh and the two parents.

[0095] (5.2) Extraction and PCR detection of barley genomic DNA

[0096] The primers, reaction procedures, and systems for barley genomic DNA extraction, PCR amplification, and HRM analysis are as described in Example 3.

[0097] (5.3) Results Analysis

[0098] Partial HRM typing results of 50 F2 populations constructed from the powdery mildew-resistant parent Feng7, the powdery mildew-susceptible parent Vlamingh, and the two parents are as follows: Figure 3 As shown, the dissolution temperature (T) m If the melting temperature (T0.0) is 84.0-84.5℃, then the barley to be tested is determined to be a homozygous haplotype resistant to disease; if the melting curve of the amplified product is a single peak, the melting temperature (T0.0) is 84.0-84.5℃. m If the melting temperature (T0.0) is 85.0-85.5℃, then the barley to be tested is determined to be a homozygous haplotype susceptible to disease; if the melting curve of the amplified product is bimodal, and the melting temperature of the main peak (T0.0) is 85.0-85.5℃, then the barley to be tested is determined to be homozygous haplotype susceptible to disease; if the melting curve of mIf the value falls between the two values, the tested barley is determined to be heterozygous, exhibiting a phenotype of resistance to powdery mildew. Results showed that in a study of 50 F2 individuals, A represented individuals with the same genotype as the powdery mildew-resistant Feng7, B represented individuals with the same genotype as the powdery mildew-susceptible parent Vlamingh, and Z represented heterozygotes. The segregation ratio of the three different genotypes was A:B:Z = 13:11:26. This marker can distinguish between two different homozygous and heterozygous genotypes, enabling the identification of genes in powdery mildew-resistant regions. BPM2 Efficient and accurate genotyping can be used for screening and identifying barley resources, as well as for molecular genetic breeding of barley to resist powdery mildew. Compared with the SNP sites and related detection methods in the previous patent CN118834992A, the SNP sites and primers in this application have the advantages of large differences in melting temperature and high base differences at the test sites.

[0099] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A molecular marker associated with resistance to barley powdery mildew, characterized in that, The molecular marker contains SNP loci, and resistance to barley powdery mildew is identified by detecting the genotype of the SNP locus. The SNP locus is located on barley chromosome 4. BPM2 At position 6 of the gene, if the genotype here is AA or AC, the barley is resistant to powdery mildew; if the genotype here is CC, the barley is susceptible to powdery mildew. The sequence of the molecular marker for resistance to powdery mildew is shown in SEQ ID NO.1; the sequence of the molecular marker for susceptibility to powdery mildew is shown in SEQ ID NO.

2.

2. A primer for identifying resistance to barley powdery mildew, characterized in that, The primers are used to detect the molecular marker of claim 1; The primers include HvBg02-F and HvBg02-R; The nucleotide sequence of HvBg02-F is shown in SEQ ID NO.3; The nucleotide sequence of HvBg02-R is shown in SEQ ID NO.

4.

3. A method for identifying barley powdery mildew resistance genotypes, characterized in that, Includes the following steps: 1) Extract genomic DNA from the barley to be tested, and use it as a template to perform PCR amplification using the primers HvBg02-F and HvBg02-R as described in claim 2 to obtain the amplification product; 2) Determine the barley genotype based on the melting curve of the amplification products; If the melting curve of the amplification product shows a single peak and the melting temperature is 84.0~84.5℃, then the barley to be tested is considered to be... BPM2 The genotype of the gene at locus 6 is AA, which is identified as a homozygous genotype for resistance to powdery mildew. If the melting curve of the amplification product shows a single peak and the melting temperature is 85.0~85.5℃, then the barley to be tested is considered safe. BPM2 The genotype of the gene at locus 6 is CC, which is determined to be a homozygous genotype for powdery mildew susceptibility. If the melting curve of the amplification product is bimodal, and the melting temperature of the main peak is 84.5~85.0℃, then the barley to be tested is determined to be... BPM2 The genotype at locus 6 is AC, which is identified as a heterozygous genotype resistant to powdery mildew.

4. The application of the method described in claim 3 in identifying susceptibility to barley powdery mildew.

5. The application of the method described in claim 3 in the identification and screening of barley germplasm resources resistant to powdery mildew.

6. The application of the method described in claim 3 in molecular marker-assisted breeding of barley varieties resistant to powdery mildew.

Images