(-)-patchouli alcohol synthase VjPTS as well as gene and application thereof
Patent Information
- Application Number
- CN202511474877.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-15
- Publication Date
- 2026-01-09
AI Technical Summary
The lack of efficient and environmentally friendly patchouli alcohol synthase in existing technologies leads to low plant extraction efficiency, high chemical synthesis costs and low purity, making it difficult to achieve sustainable production of patchouli alcohol.
The (–)-patchouli synthase VjPTS gene was cloned from the honeysuckle plant *Cymbidium goeringii*, and ligated into the expression vector pCDFDuet1. The recombinant plasmid was constructed and expressed in *Escherichia coli*, catalyzing the cyclization of farnesyl pyrophosphate (FPP) to generate (–)-patchouli alcohol.
The synthesis of patchouli alcohol with high enzyme activity and low by-products has been achieved. The production cycle is short, it has industrial application value, the cost is controllable, and it is green and environmentally friendly.
Smart Images

Figure CN121294414A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular biology, and in particular to a (–)-patchouli synthase VjPTS, its gene, and its applications. Background Technology
[0002] Terpenes, polymerized from C5 isoprene units, are the most numerous and structurally diverse class of natural products. Based on the number of isoprene units they contain, terpenes can be classified into monoterpenes, sesquiterpenes, diterpenes, triterpenes, and polyterpenes. Sesquiterpenes, in particular, possess complex structures and diverse functions, finding wide application in medicine, agriculture, and food. For example, artemisinin, a sesquiterpene lactone extracted from Artemisia annua, exhibits significant antimalarial activity. With the development of synthetic biology, increasing research is focused on producing high-value-added terpenes through biosynthesis, aiming for their sustainable utilization and efficient production.
[0003] Patchoulol is a tricyclic natural sesquiterpene compound with a variety of significant pharmacological activities, including anti-influenza virus activity, anti-inflammation, antioxidant activity, antitumor activity, immunomodulation, and neuroprotection, thus showing promising applications in pharmaceutical development. Patchoulol exhibits strong anti-inflammatory effects, reducing inflammatory responses by inhibiting the production of inflammatory mediators such as NO and PGE2 and downregulating the expression of inflammatory pathway-related factors such as NF-κB. Furthermore, patchouli alcohol demonstrates antiviral activity, showing inhibitory effects against influenza virus, dengue virus, and the novel coronavirus in multiple in vitro studies. Its antitumor potential is also attracting increasing attention; studies have found that it can induce tumor cell apoptosis, block the cell cycle, and interfere with tumor-related signaling pathways. In addition to its pharmacological activities, patchouli alcohol possesses a unique and lasting fragrance, primarily derived from the levorotatory isomer (–)-patchoulol, and has been widely used in cosmetics, perfumes, and various daily care products. Patchouli alcohol is mainly obtained from plant extraction or chemical synthesis. However, plant extraction suffers from problems such as insufficient raw material supply, low extraction efficiency, difficult separation, and high cost. Chemical synthesis often requires multiple reaction steps, faces issues such as low product purity, and potentially environmentally unfriendly catalysts. Currently, the only patchouli alcohol synthases available for biosynthesis are PcPTS (GenBank: AAS86323.1) and PcPTS var.1 (GenBank: AHL24448.1) derived from patchouli. Summary of the Invention
[0004] The purpose of this invention is to address the lack of patchouli alcohol synthases in existing technologies for biosynthesis by providing a (-)-patchouli alcohol synthase VjPTS, its gene, and its applications. The patchouli alcohol synthase VjPTS provided by this invention catalyzes the cyclization of farnesyl pyrophosphate (FPP) to patchouli alcohol, exhibiting high enzyme activity, being environmentally friendly, producing fewer byproducts, and having controllable costs, thus possessing industrial application value.
[0005] The first aspect of the present invention provides (–)-patchouli synthase VjPTS, the amino acid sequence of which is shown in SEQ ID NO:1.
[0006] A second aspect of the present invention provides a (–)-patchouli synthase VjPTS gene, the nucleotide sequence of which is shown in SEQ ID NO:2.
[0007] This invention utilizes the plant *Corydalis yanhusuo* (of the Caprifoliaceae family) Valeriana jatamansi Starting from [previous invention], a terpene synthase encoding gene VjPTS, which synthesizes (–)-patchouli, was cloned and functionally identified. This gene was then ligated into the expression vector pCDFDuet1 to construct a recombinant plasmid capable of expression in *E. coli*. After prokaryotic expression, this plasmid catalyzes the production of (–)-patchouli from FPP. Transforming the recombinant plasmid into *E. coli* to construct engineered cells enabled the heterologous synthesis of the compound (–)-patchouli in *E. coli*. The genetically engineered cells constructed in this invention are safe, stable, and have a short production cycle, demonstrating their significant value in application development.
[0008] A third aspect of the present invention provides a recombinant expression vector containing the above-mentioned (–)-patchouli synthase VjPTS gene.
[0009] A fourth aspect of the present invention provides a transformant that expresses (–)-patchouli synthase VjPTS as described above, or contains the (–)-patchouli synthase VjPTS gene as described above, or contains the recombinant expression vector as described above; the transformant is not an animal or plant species.
[0010] Furthermore, the transformant is a eukaryotic cell or a prokaryotic cell. Even further, the eukaryotic cell is selected from Pichia pastoris and Saccharomyces cerevisiae; the prokaryotic cell is selected from Bacillus subtilis and Escherichia coli.
[0011] The fifth aspect of the present invention provides the above-described (–)-patchouli synthase VjPTS, and / or the above-described (–)-patchouli synthase VjPTS gene, and / or the above-described recombinant expression vector, and / or the above-described transformant in the preparation of (–)-patchouli alcohol.
[0012] A sixth aspect of the present invention provides a method for preparing (–)-patchouli synthase VjPTS, the method comprising: culturing the above-described transformant to obtain the (–)-patchouli synthase VjPTS from the culture.
[0013] Furthermore, in the transformed organism, the nucleotide encoding the (–)-patchouli synthase VjPTS is synthesized in vitro or obtained by mutation of the original nucleotide.
[0014] A seventh aspect of the present invention provides a method for preparing (–)-patchouli alcohol, the method comprising generating (–)-patchouli alcohol by cyclization of farnesyl pyrophosphate (FPP) catalyzed by (–)-patchouli alcohol synthase VjPTS; wherein the (–)-patchouli alcohol synthase VjPTS is used in a form selected from pure enzyme, crude enzyme solution, fermentation broth containing the (–)-patchouli alcohol synthase VjPTS, enzyme powder, and immobilized enzyme.
[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. The (–)-patchouli synthase VjPTS provided by this invention catalyzes the cyclization of farnesyl pyrophosphate to (–)-patchouli alcohol, which has high enzyme activity, is environmentally friendly, produces fewer byproducts, has controllable cost, and has industrial application value.
[0016] 2. This invention starts with the plant *Cymbidium goeringii* (Lonicera japonica), a member of the Caprifoliaceae family. A gene encoding the terpene synthase VjPTS, which synthesizes (–)-patchouli, was cloned and functionally identified. This gene was then ligated into the expression vector pCDFDuet1 to construct a recombinant plasmid capable of expression in *Escherichia coli*. Prokaryotic expression of this plasmid catalyzes the production of (–)-patchouli from FPP. Transforming the recombinant plasmid into *E. coli* to construct engineered cells enabled the heterologous synthesis of the compound (–)-patchouli in *E. coli*. The genetically engineered cells constructed in this invention are safe, stable, and have a short production cycle, demonstrating significant value in application development. Attached Figure Description
[0017] Figure 1 The equation for the enzyme chemical reaction catalyzed by VjPTS is shown.
[0018] Figure 2 This is the plasmid map of pCDFDuet1-VjPTS.
[0019] Figure 3 The image shows the SDS-polyacrylamide gel electrophoresis results of the VjPTS protein.
[0020] Figure 4 GC-MS analysis of VjPTS catalyzing the formation of (–)-patchouliol from FPP in vivo and in vitro. Detailed Implementation
[0021] The present invention will now be described in further detail with reference to specific embodiments. However, this should not be construed as limiting the scope of the present invention to the following embodiments; all technologies implemented based on the content of the present invention fall within the scope of the present invention.
[0022] Example 1 This embodiment is the first to identify an enzyme from *Cymbidium goeringii* that can catalyze the cyclization of farnesyl pyrophosphate (FPP) to (–)-patchouli alcohol, as shown in the reaction formula. Figure 1 As shown. The specific research process is as follows: (–)-patchouli synthase VjPTS Acquisition and bioinformatics analysis of coding gene cDNA sequences: Take appropriate amounts of spiderwort root and rhizome tissues, grind them in liquid nitrogen, and extract total RNA using the Novizan FastPure® Universal Plant Total RNA Isolation Kit according to the manufacturer's instructions. Then, use ThermoScientific... NanoDrop RNA concentration and quality were determined using a spectrophotometer, and RNA quality was assessed by agarose gel electrophoresis. cDNA was synthesized using total RNA as a template via the Novozymes HiScript III 1st Strand cDNA Synthesis Kit, following the product instructions.
[0023] Design specific primers, with the specific primer sequences as follows: VjPTS-F:5'-atgttaagcactgagagtcaagtttttc-3'(SEQ IDNO:3). VjPTS-R:5'-tcatatgattatgggattcacgaacaac-3'(SEQ IDNO:4). The primers mentioned above were synthesized by Beijing Qingke Biotechnology Co., Ltd. (Kunming Branch). PCR amplification was performed using specific primer pairs VjPTS-F and VjPTS-R as primers, yielding... VjPTS Full-length cDNA sequence of the gene (SEQ ID NO:2).
[0024] (–)-patchouli synthase VjPTS The open reading frame (ORF) of the encoding gene is 1662 bp (SEQ ID NO: 2), encoding 553 amino acids (SEQ ID NO: 1), with a molecular weight of 64.9 kDa. The amino acid sequence encoded by this patchouli alcohol synthase VjPTS gene contains typical conserved motifs DDXXD and (N,D)Dxx(S,T)xxxE. (–)-patchouli alcohol synthase VjPTSThe encoding gene was searched for BLASTN homology in NCBI, and the gene was analyzed and compared at the nucleotide level. The results showed that it is related to Valerian (Vallisneria natans), a plant in the Caprifoliaceae family. Valeriana officinalis The highest similarity (64.38%) was found between (-)-drimenol synthase (VoDMS) and JQ437841.
[0025] Example 2 Construction of the expression vector for the (–)-patchouli synthase VjPTS encoding gene: Take an appropriate amount of spider lily root and rhizome tissue, and extract total RNA using the Novizan FastPure® Universal Plant TotalRNA Isolation Kit according to the instructions. Then, use the Novizan HiScript Ⅲ 1st StrandcDNA Synthesis Kit to synthesize cDNA using the total RNA as a template, following the instructions in the product manual.
[0026] The primer sequences are designed as follows: BamH I-VjPTS-F:5'-catcaccacagccaggatccaatgttaagcactgagagtcaagtttttc-3'(SEQ ID NO:5). Hind Ⅲ-VjPTS-R:5'-cattatgcggccgcaagctttcatatgattatgggattcacgaacaac-3'(SEQ IDNO:6). The primers mentioned above were synthesized by Beijing Qingke Biotechnology Co., Ltd. (Kunming Branch). BamH I-VjPTS-F and Hind Using primers III-VjPTS-R, PCR amplification was performed using the high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase. The PCR system was 50 μL, and the reaction mixture consisted of: 25 μL 2×Phanta Max Master Mix, 2 μL cDNA, 2 μL Primer F (10 μM), 2 μL Primer R (10 μM), and deionized water to a final volume of 50 μL. The PCR program was as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 sec, 58 °C annealing for 15 sec, 72 °C extension for 2 min, for a total of 35 cycles, followed by a final extension at 72 °C for 5 min. After the program, band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified. The pCDFDuet1 expression vector was subjected to restriction endonuclease... BamH I and Hind The enzyme was digested with enzyme III, reacted at 37 °C for 2 h, and the band size was detected by 1% agarose gel electrophoresis. The product was then recovered and purified. The recovered PCR product was ligated into the vector pCDFDuet1, which is (–)-patchouli alcohol synthase. VjPTS The encoding gene cDNA was ligated into the pCDFDuet1 expression vector containing a His tag at the N-terminus, transformed into *E. coli* DH5α competent cells, and plated on LB agar plates supplemented with 50 μg / mL streptomycin for selection. The cells were incubated overnight at 37°C until single colonies appeared. Single colonies were picked for PCR and enzyme digestion verification. Positive clones were selected for DNA sequencing verification. The plasmid map of pCDFDuet1-VjPTS is shown below. Figure 2 As shown.
[0027] Example 3 (1) Heterologous expression of (–)-patchouli synthase VjPTS in Escherichia coli: The constructed recombinant pCDFDuet1- VjPTS The plasmid was transformed into competent cells of FPP-expressing strain BL21(DE3)-pXL13 / 17 and plated on LB agar plates containing 100 μg / L ampicillin, 50 μg / L kanamycin, and 50 μg / L streptomycin. Single colonies were picked and cultured, and the plasmid was extracted for verification. Verified single colonies were inoculated into 5 mL of TB medium containing the same concentrations of antibiotics and incubated overnight at 37 °C with shaking. Then, the plasmid was inoculated at a 1:100 ratio into 50 mL of TB liquid medium and incubated at 37 °C with shaking until OD (dose retardation). 600 The value was approximately 0.6. 0.2 mM IPTG was added, and the mixture was incubated at 16 ℃ with shaking for 5 days. The fermentation broth was mixed with an equal volume of n-hexane, vortexed, and centrifuged at 4000 rpm for 20 min. The upper n-hexane phase was collected and concentrated by vacuum evaporation. The concentrated sample was dissolved in 1 mL of n-hexane, centrifuged at 12000 rpm for 10 min, and 100 μL of the liquid was transferred to a HPLC vial for GC-MS analysis. The results showed (EIC...) m / z 222), VjPTS fermentation produces (–)-patchouli alcohol, with a retention time of 11.80 min and a titer of 11.7 ± 2.1 mg / L under analytical conditions. Figure 4 As shown.
[0028] (2) Structural identification of (–)-patchouli alcohol: The integrated *E. coli* strain was fermented in 10 L of water, and the fermentation broth was extracted three times with an equal volume of ethyl acetate. The ethyl acetate fraction was concentrated using a rotary evaporator and then purified by silica gel column chromatography. Using petroleum ether / acetone (100 / 1) as the mobile phase, the eluent containing (–)-patchouli alcohol was collected after GC-MS analysis and concentrated under reduced pressure. 4.0 mg of the concentrated sample was dissolved in 400 μL of CDCl3 for NMR data acquisition, and 1.0 mg of the sample was dissolved in 1 mL of methanol for optical rotation analysis.
[0029] The NMR and optical rotation data are as follows: = -89( c 0.1, MeOH). 1 H NMR (600 MHz, CDCl3) δ H 1.97 (m, 1H), 1.87 (m, 1H), 1.83 (m, 1H), 1.72 (dd, J = 13.2, 6.1 Hz, 1H),1.52-1.46 (m, 3H), 1.46 (m, 1H), 1.38 (m, 1H), 1.31-1.24 (m, 2H), 1.20 (m,1H), 1.08 (s, 3H), 1.07 (s, 3H), 1.04 (m, 1H), 0.85 (s, 3H), 0.80 (d, J = 6.7Hz, 3H). 13 C NMR (150 MHz, CDCl3) δ C 75.7 (C-1), 43.7 (C-5), 40.1 (C-11), 39.1(C-7), 37.6 (C-10), 32.7 (C-2), 28.9 (C-9), 28.6 (C-3), 28.1 (C-4), 26.8 (C-14), 24.6 (C-8), 24.3 (C-6), 24.3 (C-15), 20.7 (C-13), 18.6 (C-12). The product was identified as (–)-patchouli alcohol by nuclear magnetic resonance spectroscopy.
[0030] Example 4 (1) Protein-induced expression of (–)-patchouli synthase VjPTS: The pCDFDuet1- constructed in Example 2 VjPTSThe plasmid was transformed into *E. coli* expression strain BL21(DE3), plated on LB agar plates containing streptomycin, and single colonies were picked and cultured. The plasmid was extracted for verification, and positive clones were screened. Each verified single colony was inoculated into 5 mL of LB liquid medium containing 50 μg / L streptomycin and incubated overnight at 37 °C with shaking. Then, the inoculum was diluted 1:100 and inoculated into 250 mL of LB liquid medium and incubated at 37 °C with shaking until OD (occurrence limit) was reached. 600 The pH value was approximately 0.6. 0.4 mM IPTG was added, and the mixture was incubated at 16 ℃ with shaking for 18-22 h. After centrifugation, the supernatant was discarded, and the precipitate was resuspended in a protein purification buffer. After sonication, the protein was purified using a nickel column to obtain VjPTS protein. The obtained protein was detected by 10% SDS-polyacrylamide gel electrophoresis. Figure 3 As shown.
[0031] (2) In vitro enzyme activity assay and product analysis of (–)-patchouli synthase VjPTS: The in vitro enzymatic reaction system catalyzed by VjPTS was as follows: 50 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 1 mM DTT, 100 μM FPP, 100 μg VjPTS protein, total volume 500 μL. After covering with 150 μL of n-hexane, the mixture was incubated at 35°C for 2 h, vortexed, and centrifuged at 12000 rpm for 10 min. The supernatant n-hexane was then used for GC-MS analysis. Detection results (EIC) m / z 222) shows that VjPTS catalyzes the formation of (–)-patchouliol, with a retention time of 11.80 min under analytical conditions, such as... Figure 4 As shown.
[0032] GC-MS analysis chromatographic conditions: HP-5MS quartz capillary (30 m × 0.25 mm × 0.25 μm), temperature program as follows: initial temperature set at 120 ℃, held for 2 min, increased to 210 ℃ at a rate of 10 ℃ / min, then increased to 280 ℃ at a rate of 30 ℃ / min, held for 5 min. Interface temperature was 250 ℃, detector temperature was 250 ℃. Carrier gas was helium, flow rate 1.0 mL / min; injection volume was 1 μL.
[0033] GC-MS analysis conditions: EI source, electron energy 70 eV, ion source temperature 230 ℃, interface temperature 280 ℃, mass range 50-450 amu.
[0034] This invention utilizes the plant *Corydalis yanhusuo* (of the Caprifoliaceae family) Valeriana jatamansi Starting from this point, a terpene synthase for synthesizing (–)-patchouli alcohol was cloned and functionally identified. VjPTSThe encoding gene was ligated to the expression vector pCDFDuet1 to construct a recombinant plasmid capable of expression in *E. coli*. After prokaryotic expression, this plasmid catalyzes the production of (–)-patchouliol from FPP. Transforming the recombinant plasmid into *E. coli* to construct engineered cells enabled the heterologous synthesis of the compound (–)-patchouliol in *E. coli*. The genetically engineered cells constructed in this invention are safe, stable, and have a short production cycle, demonstrating their significant value in application development.
[0035] Specifically: (–)-patchouli synthase VjPTS, the amino acid sequence of which is shown in SEQ ID NO:1.
[0036] SEQIDNO:Met Leu Ser Thr Glu Ser Gln Val Phe Arg Pro LeuAla Asn Phe Glu Pro Ser Leu Trp Gly Asn Phe Thr Ser Phe Ser Val Asp TyrLeu Thr Lys Les Thr Asn Vals Ar Glu Glu Glu Glu Hi Phe Leu Asp Ala Ser Lys Leu Lys Ile Pro Glu Lys Ile Asn Phe Ile Asn ThrLeu Glu Arg Leu Gly Val Ser Tyr His Met Glu Arg Glu Ile Glu Asp Gln Leu HisGln Met Phe Asp Ala His Ser Thl Phe Gln Le Asp Le Asp Arg Phe Phe Ile Tyr Phe Arg Ile Leu Arg Gln His Gly Tyr Asn Ile Ser AspVal Phe Lys Lys Leu Lys Asp Ser Asn Gly Lys Phe Lys Glu Glu Leu Lys Asp AspVal Ile Gly Ile Leu Ser Leu Tyr Glu Ala Thr His Val Thr P Thr Asp Gly Asp Gly Lys Ala Gln Leu Glu Ser Met Ser Thr AlaSer Leu Ser Pro Phe Leu Gly Met Gln Val Thr His Ala Leu Ile Gln Ser Leu HisLys Gly Ile Pro Arg Ile Glu Ser Arg Asn Tyr Ile Ser Val Tyr Glu Glu Asp ProAsn Lys Asp Le Lys P Asp Leu Leu Leu Glen MetLeu His Lys Gln Glu Leu Cys Asp AlaSer Arg Trp Trp Asn Glu Met Glu Phe GluThr Lys Leu Ser Tyr Ala Arg Asp Arg Val Glu Gly Tyr Leu Trp Thr Leu SerAla Tyr Glu Pro Lys Tyr Ser Leu Ala Arg Arg Ile Leu Ile Lys Leu Met Ileu Val Asp Ser Glu Asp Le Tyr Thr Asp Glu Leu GlnLeu Phe Thr Asp Ala Val Glu Arg Leu Asp Glu Gly Ser Ile Asn Gln Leu Pro AspTyr Met Lys Ile Leu Tyr Lys Ala Leu Leu Asp Phe Glu Glu Thr Glu Asp IleLeu Cys Lys His Tyn Gly Ile Lys Val Ile Lys Val Gly Asn Gly Glu Ile Val Asn Cys Tyr Asn Thr Glu Tyr Lys Trp Phe Asn Lys Arg TyrVal Pro Asp Phe Glu Glu Tyr Met Gln Lys Ala Val Thr Ser Gly Asn LeuLeu Ile Thr Trp Ser Phe Gln Gly Met Asp Hi Val Val P Ala P Lys Lys Glus Lys Ser Ser Asn Lys Val Leu Arg Leu ValAsp Asp Val Met Ser His Glu Glu Glu Asp Glu Arg Gly His Val Ala Thr Gly LeuGlu Cys Tyr Gln Lys Thr Tyr Gly Asn Arg Lys Glu Ile Ile Pro Glu Phe TyrLys Arg Val Tle P Asp Lys Glu Asp AlaLys Pro Asp LysLeu Pro Leu Glu Ile Leu Met Arg Val Ile Asn Leu Thr Arg Ile Gly Asp Val ValTyr Lys Tyr Asp Asp Gly Tyr Thr His Pro Thr Lys Ala Leu Lys Asp His Ile IleSer Leu Phe Val Asn Pro Ile Ile.
[0037] The (–)-patchouli synthase VjPTS gene has the nucleotide sequence shown in SEQ ID NO:2.
[0038] SEQ ID NO:2 nucleotide sequence: atgttaagca ctgagagtca agtttttcgt ccgttggcaa atttgagcc aagtttatggggaaatcttt tcacctcatt ttctgtggat tatctgacta agaaaacaaa tacagaagaa catgaaggattattagaaaa agtgagactg atgtttttag atgcattccaa attgagacatacaattcaattcaatta gaaaggttag gtgtatcata tcatatggag agagagattg aagatcagct tcatcagatgtttgatgctc attctaaatt tcaagatgat attcaacggt ttgatttgtt cactttggga atttacttcaggattctcag acaacatggt tataatatct ctagcgatgt tttcaagaag ttgaaaaaaaaaaaaaaaaaaa atgatgtaat tggcattcta agcttgtatg aagctacaca tgtaagaacccacggtgacg atattctaga tgaagctttc atctatacaa aagctcaact agaatctatg tccaccgcaagtttaagccc gtttcttggt atgcaagtta cgcatgcttt gattcagct ctccaccagtacgacgacgac tatctgttta tgaagaagat ccaaacaaaa atgatctatt attgaggttctcaaagattg atttcaatct gctgcaaatg cttcacaagc aagagttgtg tgatgcctca aggtggtggaatgaaatgga gtttgagacg aaactatctt atgcgagaga tcgagtggtacctacctacctactactacgactacgaat aatactcttt ggctcgaaga atattaatca aattaatgat attggtatctcttacggatg atacgtatgatgcatatggt acgttagatg aacttcaact ctttacggat gcagtagaaaggttggatga gggttccatc aatcagcttc ctgattacat gaagattctc tataaggctc tgctagattttttcgaggaa acagaagata tattatgcaa acatggaata attaatggtt ctcatcgcgt gaattatgggaaatatgtgt ataaagagat tgtgaattgc tacaataccg agtacaaatg gttcaacaaa agatacgtgccggattttga agaatatatg cagaaagcag tagtgacttc aggtaacaat ttgcttataa cgtggtcttttcaaggaatg gatcaagtcg caagtatcaa agcgttcgag tgggttaaaa atcatccgaa aatggtagtctcgtcgaata aagtcctacg acttgttgac gacgtaatga gccacgagga agaagatgaa aggggacatgttgcaacagg ccttgaatgc tatcagaaaa catatggtgg aaatagaaaa gagatcattc cagaattttataagaggatt gatgatgctt ggaaggatgt aaatgaggaa tttttgaaac ccgataaatt accgctagaaatactaatgc gtgttattaa cctcacgaga attggcgacg ttgtttacaa gtatgacgac gggtatactcatccaacgaa agcattaaag gatcacatca tatcgttgtt cgtgaatccc ataatcatat ga.
[0039] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A (—)-patchoulol synthase VjPTS, characterized in that, The amino acid sequence of which is shown as SEQ ID NO:
1.
2. A (—)-patchoulol synthase VjPTS gene, characterized in that, The nucleotide sequence of which is shown as SEQ ID NO:
2.
3. A recombinant expression vector containing the (-)-patchoulol synthase VjPTS gene of claim 2.
4. A transformant characterized in that, The transformant expresses the (-)-patchoulol synthase VjPTS of claim 1, or contains the (-)-patchoulol synthase VjPTS gene of claim 2, or contains the recombinant expression vector of claim 3; the transformant is not an animal species or a plant species.
5. The transformant of claim 4, wherein, The transformant is a eukaryotic cell or a prokaryotic cell.
6. The transformant of claim 5, wherein, The eukaryotic cell is selected from Pichia pastoris and Saccharomyces cerevisiae; The prokaryotic cell is selected from Bacillus subtilis and Escherichia coli.
7. Use of the (-)-patchoulol synthase VjPTS of claim 1, and / or the (-)-patchoulol synthase VjPTS gene of claim 2, and / or the recombinant expression vector of claim 3, and / or the transformant of any one of claims 4-6 in the preparation of (-)-patchoulol.
8. A method of preparing a (—)-patchoulol synthase VjPTS, characterized in that, The method comprises culturing the transformant of any one of claims 4-6, and obtaining the (-)-patchoulol synthase VjPTS from the culture.
9. The method of claim 8, wherein, In the transformant, the nucleotide encoding the (-)-patchoulol synthase VjPTS is obtained by in vitro synthesis or mutation on a prokaryotic nucleotide.
10. A process for the preparation of (-)-patchouli alcohol, characterized in that, The method comprises cyclization of farnesyl pyrophosphate to generate (-)-patchoulol by the (-)-patchoulol synthase VjPTS; The (-)-patchoulol synthase VjPTS is used in a form selected from pure enzyme, crude enzyme solution, fermentation broth containing the (-)-patchoulol synthase VjPTS, enzyme powder and immobilized enzyme.