SiRNA of targeted liver xanthine oxidoreductase and application of siRNA in treatment of hyperuricemia and renal insufficiency related to hyperuricemia
By targeting liver XOR with siRNA interference, the side effects and cardiovascular risks of existing hyperuricemia drugs in patients with renal insufficiency have been resolved, achieving the effect of protecting renal function while reducing blood uric acid. In particular, the application of GalNAc-siRNA significantly reduces kidney damage.
Patent Information
- Application Number
- CN202410919521.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-09
- Publication Date
- 2026-01-09
Smart Images

Figure CN121294434A_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of biomedicine, and specifically relates to an siRNA that targets hepatic xanthine oxidoreductase (XOR), and also relates to the application of this siRNA in the treatment of hyperuricemia and the protection of renal function. Background Technology
[0002] Hyperuricemia (HUA), or elevated plasma uric acid concentration, is a common clinical metabolic disorder caused by increased uric acid production and / or insufficient excretion. Long-term hyperuricemia can lead to gout or kidney stones, causing severe kidney damage such as renal mitochondrial dysfunction, cortical oxidative stress, and renal tubular damage. The causes of hyperuricemia fall into three main categories: decreased uric acid excretion, increased uric acid production, and both. Under normal conditions, the body's uric acid pool is 1200 mg, and approximately 700 mg of uric acid is produced daily, of which two-thirds are excreted by the kidneys and one-third by the intestines. The known renal metabolic process of uric acid involves four steps: filtration, reabsorption, secretion, and post-secretion reabsorption. Finally, 6%–10% of the uric acid filtered by the glomeruli is excreted. Diseases, medications, and genetic factors can all lead to decreased renal uric acid excretion function, resulting in hyperuricemia.
[0003] Normal glomerular and tubular function is crucial for ensuring uric acid excretion. Approximately 90% of patients with hyperuricemia and gout may have glomerular filtration and / or tubular secretion dysfunction. From a pathophysiological perspective, uric acid is a double-edged sword. Physiologically normal serum uric acid is an effective antioxidant in the extracellular environment, scavenging up to 60% of free radicals in the body. However, high serum uric acid is an intracellular pro-oxidant, inducing oxidative stress, mitochondrial dysfunction, inflammatory responses, and activation of the renin-angiotensin system (RAS), leading to endothelial dysfunction, vascular smooth muscle cell proliferation, and interstitial inflammatory infiltration, thus triggering and progressing kidney and cardiovascular diseases.
[0004] Currently, there are three main strategies for treating hyperuricemia: reducing uric acid production, promoting uric acid excretion, and converting uric acid into soluble allantoin. XOR inhibitors are popular in the clinical treatment of hyperuricemia, and many drugs targeting XOR, such as febuxostat and allopurinol, have been designed. However, these existing XOR inhibitors used clinically to treat hyperuricemia often face problems such as short half-lives and serious side effects. For example, the active metabolite of allopurinol, hydroxypurinol, is excreted through the kidneys and can accumulate in patients with impaired renal function, increasing the risk of severe allergic reactions and resulting in a mortality rate between 20% and 25%. Therefore, patients with renal insufficiency should be closely monitored for adverse reactions when using allopurinol, and their dosage should be adjusted according to eGFR. While norbuprofen is a dual-channel drug excreted through both the kidneys and feces, and no dose reduction is required when eGFR > 30 ml / min, close monitoring of renal function is necessary in patients with severe renal impairment. It should not be used in patients with severe hepatic damage, as it increases the risk of cardiovascular death. In elderly patients with gout, it increases the risk of heart failure, ischemic heart disease, hypertension, and cardiomyopathy. For these patients with hyperuricemia, lowering serum uric acid is a double-edged sword. While lowering serum uric acid helps control overall hyperuricemia, the process of excretion severely affects renal function. Patients with pre-existing renal insufficiency will further hinder renal excretion of uric acid and exacerbate the development of hyperuricemia.
[0005] Therefore, the selection and development of drugs for the treatment of hyperuricemia is of particular importance and urgency for patients with multiple organ dysfunction, especially renal insufficiency. Summary of the Invention
[0006] To achieve the aforementioned objectives, the applicant conducted repeated and meticulous research, discovering the crucial role of hepatic XOR in inducing hyperuricemia. Furthermore, siRNA targeting the hepatic XOR gene significantly protected the kidneys from inflammation and fibrosis in a mouse model of hyperuricemia. Based on this, the applicant has developed an siRNA targeting the XOR gene. By applying this siRNA to the treatment of hyperuricemia, a novel therapeutic strategy can be provided. This strategy effectively protects kidney function from the impact of uric acid excretion while maintaining serum uric acid balance, thus protecting the kidney function of patients with hyperuricemia.
[0007] Specifically, in a first aspect of this application, an siRNA is provided that targets the liver xanthine oxidoreductase XOR gene, wherein the XOR gene has the nucleotide sequence shown in SEQ ID No:149, the nucleotide sequence of its positive strand contains at least 15 nucleotides, and the target sequence of the siRNA contains at least 15 consecutive nucleotides located in the range of nucleotides 430-4400 of the nucleotide sequence of the XOR gene.
[0008] In another preferred embodiment, the target sequence of the siRNA comprises nucleotides 439-459, 715-735, 1068-1088, 1072-1092, 1353-1373, 1467-1487, 1612-1632, 1624-1644, 1681-1701, 1713-1733, and 17th of the XOR gene. At least 15 consecutive nucleotides within the range of 72-1792, 1775-1795, 1778-1798, 2130-2150, 2131-2151, 2175-2195, 2582-2602, 2916-2936, 3296-3316, 3889-3909, 4298-4318, or 4299-4319.
[0009] In another preferred embodiment, the siRNA also has renal function protective activity.
[0010] In another preferred embodiment, the renal protective activity includes reducing blood urea nitrogen (BUN) and serum creatinine, increasing glomerular filtration rate, and / or slowing down or treating renal fibrosis.
[0011] In another preferred embodiment, the reduction of BUN and serum creatinine includes a reduction of BUN and serum creatinine by at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% from the baseline value before application after administration of the siRNA of the present invention.
[0012] In another preferred embodiment, the positive strand of the siRNA contains at least 15, 17, 19, or 23 nucleotides.
[0013] In another preferred embodiment, the nucleotide sequence of its positive strand differs from its target sequence by 0, 1, or 2 nucleotides.
[0014] In another preferred embodiment, the nucleotide sequence of the antisense strand is completely complementary to the nucleotide sequence of its sense strand, or there are one or two non-complementary nucleotides.
[0015] In another preferred embodiment, the nucleotide sequence of its antisense strand is completely complementary to its target sequence, or one or two nucleotides are not complementary.
[0016] In another preferred embodiment, its positive strand has the nucleotide sequence shown in any of SEQ ID No: 5, 17, 21, 22, 47, 48, 49, 52, 53, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 66, 67, or 69; and
[0017] Its antisense strand has a nucleotide sequence shown in any of SEQ ID No: 75, 87, 91, 92, 117, 118, 119, 122, 123, 125, 126, 127, 129, 130, 131, 132, 133, 134, 135, 136, 137, or 139.
[0018] In another preferred embodiment, the positive strand has a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in any of SEQ ID No: 5, 17, 21, 22, 47, 48, 49, 52, 53, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 66, 67, or 69 and retains the ability to target the XOR gene.
[0019] In another preferred embodiment, the antisense strand has at least 90% homology with the nucleotide sequences shown in any of SEQ ID No: 75, 87, 91, 92, 117, 118, 119, 122, 123, 125, 126, 127, 129, 130, 131, 132, 133, 134, 135, 136, 137, or 139 and retains the ability to target the XOR gene.
[0020] In another preferred embodiment, its sense strand has the nucleotide sequence shown in SEQ ID No: 52; and its antisense strand has the nucleotide sequence shown in SEQ ID No: 122;
[0021] or
[0022] Its sense strand has the nucleotide sequence shown in SEQ ID No:56; and its antisense strand has the nucleotide sequence shown in SEQ ID No:126.
[0023] or
[0024] Its sense strand has the nucleotide sequence shown in SEQ ID No:57; and its antisense strand has the nucleotide sequence shown in SEQ ID No:127;
[0025] or
[0026] Its sense strand has the nucleotide sequence shown in SEQ ID No: 60; and its antisense strand has the nucleotide sequence shown in SEQ ID No: 130;
[0027] or
[0028] Its sense strand has the nucleotide sequence shown in SEQ ID No: 61; and its antisense strand has the nucleotide sequence shown in SEQ ID No: 131.
[0029] or
[0030] Its sense strand has the nucleotide sequence shown in SEQ ID No:62; and its antisense strand has the nucleotide sequence shown in SEQ ID No:132;
[0031] or
[0032] Its sense strand has the nucleotide sequence shown in SEQ ID No:64; and its antisense strand has the nucleotide sequence shown in SEQ ID No:134.
[0033] In another preferred embodiment, the siRNA has a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID No:52 and retains the ability to target the XOR gene; and / or has a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID No:122 and retains the ability to target the XOR gene.
[0034] In another preferred embodiment, the siRNA has a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID No:56 and retains the ability to target the XOR gene; and / or has a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID No:126 and retains the ability to target the XOR gene.
[0035] In another preferred embodiment, the siRNA has a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID No:57 and retains the ability to target the XOR gene; and / or has a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID No:127 and retains the ability to target the XOR gene.
[0036] In another preferred embodiment, the siRNA has a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID No:60 and retains the ability to target the XOR gene; and / or has a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID No:130 and retains the ability to target the XOR gene.
[0037] In another preferred embodiment, the siRNA has a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID No:61 and retains the ability to target the XOR gene; and / or has a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID No:131 and retains the ability to target the XOR gene.
[0038] In another preferred embodiment, the siRNA has a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID No:62 and retains the ability to target the XOR gene; and / or has a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID No:132 and retains the ability to target the XOR gene.
[0039] In another preferred embodiment, the siRNA has a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID No:64 and retains the ability to target the XOR gene; and / or has a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID No:134 and retains the ability to target the XOR gene.
[0040] In another preferred embodiment, the siRNA comprises at least one modified nucleotide.
[0041] In another preferred embodiment, all nucleotides of the siRNA contain modifications.
[0042] In some preferred embodiments, the siRNA comprises at least one modified nucleotide. In some more preferred embodiments, all nucleotides of the siRNA are modified.
[0043] In some preferred embodiments, the modification is a 2'-fluoro modification or a 2'-methoxy substitution modification of the 2' position of the ribose of the siRNA.
[0044] In a second aspect of this application, a GalNAc-siRNA is provided, comprising a conjugate formed by coupling an siRNA molecule with an N-acetylgalactosamine GalNAc molecule, wherein the siRNA molecule targets the liver xanthine oxidoreductase XOR gene, wherein the XOR gene has the nucleotide sequence shown in SEQ ID No:149. Preferably, in the GalNAc-siRNA, the siRNA molecule is the siRNA according to the first aspect of this application.
[0045] In some preferred embodiments, the GalNAc molecule is
[0046]
[0047] In some preferred embodiments, the GalNAc molecule is covalently coupled to the 3' end of the positive strand of the siRNA molecule in a trivalent state. In some preferred embodiments, the GalNAc molecule is coupled to the siRNA molecule via a linker arm.
[0048] In a third aspect of this application, a pharmaceutical composition is provided, comprising:
[0049] a) the siRNA described in the first aspect of this application or the GalNAc-siRNA described in the second aspect of this application; and
[0050] b) An optional pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is one or more components selected from the group consisting of: excipients, solvents, diluents, stabilizers, dispersants, buffers, compatibilizers, preservatives, and combinations thereof.
[0051] In a fourth aspect of this application, a formulation is provided comprising siRNA as described in the first aspect of this application, GalNAc-siRNA as described in the second aspect of this application, or a pharmaceutical composition as described in the third aspect of this application.
[0052] In a fifth aspect of this application, a kit is provided comprising siRNA as described in the first aspect of this application, GalNAc-siRNA as described in the second aspect of this application, a pharmaceutical composition as described in the third aspect of this application, or a formulation as described in the fourth aspect of this application.
[0053] In some preferred embodiments, the kit further includes instruments and / or instructions for use for delivering the siRNA according to the first aspect of this application or the GalNAc-siRNA according to the second aspect of this application, the pharmaceutical composition according to the third aspect of this application, or the formulation according to the fourth aspect of this application to the liver of a subject. In some preferred embodiments, the subject is a human, a non-human primate, or other mammal.
[0054] In a sixth aspect of this application, the use of the siRNA described in the first aspect of this application or the GalNAc-siRNA described in the second aspect of this application in the preparation of a medicament for treating hyperuricemia is provided.
[0055] In some preferred embodiments, the hyperuricemia is hyperuricemia affecting humans, non-human primates, or other mammals. In some more preferred embodiments, the hyperuricemia is hyperuricemia affecting humans.
[0056] In another preferred embodiment, the hyperuricemia-related renal insufficiency includes elevated serum creatinine levels, proteinuria, hematuria, and renal fibrosis.
[0057] In another preferred embodiment, the renal insufficiency is mild, moderate, or severe.
[0058] In another preferred embodiment, the hyperuricemia-related renal insufficiency includes a decrease in renal function of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%.
[0059] In another aspect of the invention, a method for treating hyperuricemia or hyperuricemia-related renal insufficiency is provided, comprising administering to a subject the siRNA of the first aspect of the invention, the Galnac-siRNA conjugate of the second aspect of the invention, the pharmaceutical composition of the third aspect of the invention, and / or the kit of the fourth aspect of the invention.
[0060] In another aspect of the present invention, an siRNA of the first aspect of the present invention, a Galnac-siRNA conjugate of the second aspect of the present invention, a pharmaceutical composition of the third aspect of the present invention, and / or a kit of the fourth aspect of the present invention are provided for the treatment of hyperuricemia or hyperuricemia-related renal insufficiency.
[0061] Other aspects and advantages of this application will readily be apparent to those skilled in the art from the detailed description below. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Accordingly, the descriptions in the accompanying drawings and specification of this application are merely exemplary and not restrictive. Attached Figure Description
[0062] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention can be better understood by referring to the exemplary embodiments and accompanying drawings described in detail below. A brief description of the drawings is as follows:
[0063] Figure 1 Q-PCR was used to detect the expression level of XOR mRNA in cells treated with different siRNAs (n=3), and more than a dozen siRNAs that inhibited the expression of XOR mRNA were screened for further study.
[0064] Figure 2 Representative image of GalNAc-siRNAs alleviating kidney damage. Scale bar, 100 μm. (n=3, male).
[0065] Figure 3 . Detection of the therapeutic effect of GalNAc-siRNAs on hyperuricemic mice. (A) Schematic diagram of chemical drug modeling in WT mice. Hyperuricemia was induced in WT mice by intraperitoneal injection of potassium oxycyanate (PO) and gavage administration of hypoxanthine (HX) for 21 consecutive days. Febuxostat group served as positive control, and saline group served as negative control. GalNAc-siRNAs were administered subcutaneously on days 0, 3, 7, and 14. Blood and various tissues were collected from mice on day 21 for experiments. (B) Detection of the relative expression level of XOR mRNA in the liver by Q-PCR. (C) Representative image of XOR protein expression level in the liver by Western blotting. GAPDH was used as an internal reference protein. (D) Quantitative calculation of the relative expression level of XOR protein in (C), expressed as XOR / GAPDH ratio. (E) Detection of plasma uric acid (UA) level on day 21. (n=3, males, ns, no difference, *P<0.05,**P<0.01,***P<0.001,****P<0.0001)
[0066] Figure 4 Identification of humanized Xdh mice. (A) Strategy for constructing humanized Xdh mice. (B) Relative expression levels of human XOR mRNA and mouse XOR mRNA in the livers of heterozygous humanized Xdh mice, homozygous humanized Xdh mice, and WT mice were determined by real-time quantitative PCR. The specific modeling method for inducing hyperuricemia in homozygous humanized Xdh mice is the same as described above. Figure 3 A. (n=3, male)
[0067] Figure 5 GalNAc-siX61 showed good therapeutic effects in a humanized Xdh hyperuricemia mouse model. (A) The relative expression level of humanized XOR mRNA in mouse liver was detected by real-time quantitative PCR. (C) The expression level of humanized XOR protein in the liver of humanized Xdh mice was determined by Western blotting. GAPDH was used as an internal control protein. (D) The relative expression level of XOR protein in (C) was quantitatively analyzed by ImageJ and expressed as XOR / GAPDH. (E) Plasma uric acid (UA) levels were detected on day 21 after modeling. (n=3, male, ns, no difference, **P<0.01, ***P<0.001)
[0068] Figure 6 GalNAc-siX61 highly specifically targets the liver. Representative Western blot images of XOR protein in the liver, kidney, muscle, intestine, white adipose tissue (WAT), brown adipose tissue (BAT), and beige adipose tissue (BeAT). GAPDH was used as an internal control protein.
[0069] Figure 7 Hepatic XOR mRNA expression and uric acid levels in various tissues of Uox KO mice. (A) Real-time quantitative PCR was used to detect XOR mRNA expression in mouse liver. (n=3, ns, not significant, *P<0.05) (B) Uric acid levels in liver, kidney, muscle, intestine, white adipose tissue, brown adipose tissue, and beige adipose tissue homogenates of various mice were detected using the Nanjing Jiancheng uric acid detection kit. (n=3, ns, not significant, *P<0.05, **P<0.01, ***P<0.001)
[0070] Figure 8 GalNAc-siX61 delayed kidney damage in Uox KO mice. (A) Detection of hepatic and renal biochemical indicators in plasma of mice in the WT group, Uox KO blank control group, and Uox KO GalNAc-siX61 group, including alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), and creatinine (n=3, ns, no difference, *P<0.05, **P<0.01, ***P<0.001). (B) Schematic diagram of H&E and Masson staining of kidneys in mice in the WT group, Uox KO blank control group, and Uox KO GalNAc-siX61 group. Full image of kidney stained with H&E, scale bar at 500 μm. Scale bar in other images is 100 μm. Collagen deposition in the kidney is shown in green, and the collagen area percentage is shown in the right figure (n=16, ****P<0.0001). Detailed Implementation
[0071] The following specific embodiments illustrate the implementation of this application. Those skilled in the art can easily understand other advantages and effects of this application from the content disclosed in this specification.
[0072] This application includes the use of siRNA and / or GalNAc-siRNA to treat hyperuricemia, wherein the GalNAc-siRNA comprises a conjugate formed by coupling siRNA molecules with GalNAc molecules, and wherein the siRNA and the siRNA molecules target hepatic XOR. Specifically, the siRNA molecules in the siRNA and GalNAc-siRNA of this application are double-stranded RNA molecules composed of a sense oligonucleotide chain and an antisense oligonucleotide chain, which can interfere with the expression of the XOR gene by hybridizing with XOR mRNA molecules, thereby inhibiting XOR. Compared to febuxostat, the siRNA and GalNAc-siRNA of this application have a longer dosing cycle and can effectively alleviate hyperuricemia-related kidney damage in the long term.
[0073] the term
[0074] XOR / XO / XDH
[0075] As used herein, the terms “xanthine oxidoreductase” and “XOR” are used interchangeably. XOR is an essential enzyme in purine and uric acid metabolism, catalyzing the final two steps of purine catabolism in mammals (e.g., primates, such as *Homo sapiens*) to produce uric acid. Some primates (such as *Homo sapiens*) are more prone to hyperuricemia than other mammals due to the absence of uricase, which converts uric acid into soluble allantoin. Unless otherwise stated, XOR refers to two distinct forms, including XDH and XO. The terms “xanthine dehydrogenase” and “XDH” are used interchangeably and are known genes and proteins. Xanthine dehydrogenase can be converted to xanthine oxidase (XO) through reversible thiol oxidation or irreversible proteolytic modification. XOR is primarily expressed in the intestine and liver, but also in adipose tissue. Two transcriptotypes of the human isotype of this gene have been identified.
[0076] The term XOR includes all mammalian-derived XOR, such as human, monkey, rat, and mouse-derived XOR. Nucleotide and amino acid sequences of human-derived XOR can be found, for example, in Genbank IDs: NM_000379.4 and NP_000370.2; nucleotide and amino acid sequences of monkey-derived XOR can be found, for example, in Genbank IDs: XM_015112049.2, XP_014967535.2, XM_015112050.2, and XP_014967536.2; nucleotide and amino acid sequences of rat-derived XOR can be found, for example, in Genbank IDs: NM_017154.2 and NP_058850.2; and nucleotide and amino acid sequences of mouse-derived XOR can be found, for example, in Genbank IDs: NM_011723.3 and NP_035853.2.
[0077] An exemplary XOR nucleotide sequence of this application is shown in SEQ ID NO:149. However, those skilled in the art should understand that the XOR nucleotide sequence shown in SEQ ID NO:149 is merely an example for the convenience of this specification, and all XOR sequences (including nucleotide and amino acid sequences) exemplified above are also merely examples. The term "XOR" is not limited to the XOR sequences exemplified above, but includes both its wild-type gene and naturally occurring DNA variant sequences, including its single nucleotide polymorphisms.
[0078] target sequence
[0079] As used herein, "target sequence" refers to a continuous portion of the nucleotide sequence of the mRNA molecule formed during XOR gene transcription, including mRNA that is a primary transcription product of RNA processing. The target portion of the sequence is at least long enough to serve as a substrate for siRNA-guided cleavage of the nucleotide sequence portion of the mRNA molecule formed during XOR gene transcription or in its vicinity. In some embodiments, the target sequence is located within the protein-coding region of XOR.
[0080] The target sequence is at least 15 nucleotides long, typically 19 to 36 nucleotides, for example, 19 to 30 nucleotides. In some embodiments, the target sequence can be 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 nucleotides long. Those skilled in the art should understand that all ranges and length values between the ranges and length intervals listed above are also considered part of this application.
[0081] Examples of target sequences for this application include any XOR sequence of at least 15 consecutive nucleotides in length shown in SEQ ID NO:149, typically any XOR sequence of 19 to 36 consecutive nucleotides in length shown in SEQ ID NO:149, preferably any XOR sequence of 19 to 30 consecutive nucleotides in length shown in SEQ ID NO:149. In some preferred embodiments, the target sequence for this application is at least 19 consecutive nucleotides within the range of nucleotides 439 to 1092, 1353 to 1487, 1624 to 1798, 2131 to 2936, or 3296 to 3320 of the XOR sequence shown in SEQ ID NO:149. Specific examples of target sequences for this application include SEQ ID NO:149. The XOR sequence shown in NO:149 consists of the following sequences: 439-459, 715-735, 724-744, 1068-1088, 1072-1092, 1353-1373, 1357-1377, 1467-1487, 1624-1644, 1612-1632, 1681-1701, and 1772-1792. Nucleotides 1775–1795, 1778–1798, 2130–2150, 2131–2151, 2175–2195, 2582–2602, 2590–2610, 2916–2936, 3296–3316, 3300–3320, 4298–4318, or 4299–4319. In another preferred embodiment, the target sequence of the siRNA comprises nucleotides 439-459, 715-735, 1068-1088, 1072-1092, 1353-1373, 1467-1487, 1612-1632, 1624-1644, 1681-1701, 1713-1733, and 17th of the XOR gene. At least 15 consecutive nucleotides within the range of 72-1792, 1775-1795, 1778-1798, 2130-2150, 2131-2151, 2175-2195, 2582-2602, 2916-2936, 3296-3316, 3889-3909, 4298-4318, or 4299-4319.However, those skilled in the art should understand that the target sequences listed above are merely examples of the nucleotide sequences of human-derived XOR shown in SEQ ID NO:149. The target sequences of this application are not limited to these. Any nucleotide sequence of at least 15 consecutive nucleotides properly selected from any nucleotide sequence within the definition of the term "XOR", regardless of its origin from humans or other mammals such as monkeys, rats, or mice, and regardless of whether it is a wild-type gene or contains variations, should be considered as included within the scope of the "target sequences" of this application.
[0082] siRNA / interfering RNA / double-stranded RNA / RNAi / iRNA
[0083] The siRNA (small interfering RNA) described herein is a double-stranded RNA molecule with a length of at least 15 nucleotides, belonging to the interfering RNA (iRNA) category. It primarily exerts its gene expression regulation function at the post-transcriptional level through RNA interference (RNAi) in a specific manner. The mechanism of action of siRNA involves multiple steps. Generally, it is believed that its mechanism includes forming an RNA-induced silencing complex (RISC) with relevant enzymes in vivo. This RISC specifically binds to a target sequence in the target mRNA (in this application, the target sequence in the target mRNA is, for example, any of the target sequences in the XOR sequence shown in SEQ ID NO:149), i.e., a segment homologous to the sense strand of the siRNA sequence and / or complementary to the antisense strand of the siRNA. The RISC cleaves the mRNA at the binding site, leading to mRNA degradation and thereby inhibiting gene expression. Furthermore, siRNA can also act as a primer to synthesize more double-stranded RNA (dsRNA), further amplifying the effect of RNAi and ultimately completely degrading the target mRNA.
[0084] Therefore, siRNA comprises two complementary RNA strands that can hybridize to form a double-stranded structure. One strand of the siRNA is substantially identical to the target sequence, meaning its nucleotide sequence differs from the target sequence by 0, 1, or 2 nucleotides; this strand is called the "sense strand." The other strand of the siRNA is substantially complementary to the target sequence, meaning its nucleotide sequence is completely complementary to the target sequence, or has 1 or 2 non-complementary nucleotides; this strand is called the "antisense strand." Furthermore, the sense and antisense strands are also substantially complementary to each other, meaning the nucleotide sequence of the antisense strand is completely complementary to the nucleotide sequence of its sense strand, or has 1 or 2 non-complementary nucleotides. It should be noted that the siRNA sequence is typically designed to target the gene sequence to be repressed, and is preferably designed so that the sense strand is identical to the target sequence and the antisense strand is completely complementary to the target sequence. However, considering factors such as the stability, specificity, and GC content of the siRNA double strand itself, sometimes one or two nucleotides are modified based on the target sequence to improve the stability and specificity of the siRNA double strand and / or control the GC content of the siRNA within a reasonable range. For example, as a known method to enhance the stability of the siRNA double strand, one or two dU-dU protruding bases can be added to the 3' end of the siRNA sense strand sequence that is identical to the target sequence. According to the above definition, such a siRNA sense strand sequence with a 3' protruding base is still substantially complementary to the antisense strand sequence and the target sequence, and therefore is still included within the scope of this application.
[0085] The length of siRNA is typically 19 to 36 nucleotides, preferably 19 to 30 nucleotides. In some embodiments, the length of siRNA can be 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 nucleotides. Those skilled in the art will understand that all ranges and length values between the ranges and length intervals listed above are also considered part of this application.
[0086] Similarly, the length of the complementary region to the target sequence in the siRNA is typically 19 to 36 nucleotides, preferably 19 to 30 nucleotides. In some embodiments, the length of the complementary region to the target sequence in the siRNA can be 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 nucleotides. Those skilled in the art should understand that all ranges and length values between the ranges and length intervals listed above are also considered part of this application.
[0087] GalNAc
[0088] In this specification, “GalNAc” is an abbreviation for N-acetylgalactosamine, which also includes one or more GalNAc derivatives. GalNAc conjugates containing one or more GalNAc derivatives are described, for example, in US 8,106,022, the entire contents of which are incorporated herein by reference. In this application, GalNAc is used as a ligand to target siRNA to specific cells, and thus conjugates with the siRNA of this application to form GalNAc-siRNA. In some embodiments, GalNAc-siRNA targets the siRNA of this application to liver cells, for example, by acting as a ligand for the desialylate glycoprotein receptor of liver cells (e.g., hepatocytes).
[0089] The methods of conjugating GalNAc molecules to siRNA molecules are well known in the art. For example, GalNAc can be conjugated to any nucleotide of the siRNA of this application via a adapter (e.g., a monovalent adapter, a bivalent or trivalent branched adapter, etc.). In some preferred embodiments, GalNAc is conjugated to the 3' end of the sense strand of the siRNA of this application. In other embodiments, GalNAc is conjugated to the 5' end of the sense strand of the siRNA of this application. In still other embodiments, GalNAc is conjugated to the 3' end of the antisense strand of the siRNA of this application. In still other embodiments, GalNAc is conjugated to the 5' end of the antisense strand of the siRNA of this application. As described above, the conjugation can be covalent, or other conjugation methods known in the art, with covalent conjugation being preferred.
[0090] In some embodiments, GalNAc is coupled to the siRNA of this application via a monovalent adapter. In other embodiments, GalNAc is coupled to the siRNA of this application via a bivalent adapter. In still other embodiments, GalNAc is coupled to the siRNA of this application via a trivalent adapter. In still other embodiments, GalNAc is coupled to the siRNA of this application via a tetravalent adapter.
[0091] In some embodiments, the GalNAc-siRNA of this application comprises a GalNAc (or GalNAc derivative) coupled to the siRNA of this application. In some embodiments, the GalNAc-siRNA of this application comprises multiple (e.g., 2, 3, 4, 5, or 6) GalNAc (or GalNAc derivatives), each GalNAc (or GalNAc derivative) being independently coupled to multiple nucleotides of the siRNA of this application via multiple monovalent linkers.
[0092] In some embodiments, for example, when the two strands of the siRNA of this application are part of a larger molecule and are linked by an unbroken nucleotide chain between the 3' end of one strand and the 5' end of the other strand to form a hairpin loop containing multiple unpaired nucleotides, each unpaired nucleotide within the hairpin loop may independently contain a GalNAc (or a GalNAc derivative) coupled via a monovalent linker. The hairpin loop may also be formed by an extension of one strand of the siRNA duplex.
[0093] In some preferred embodiments, the GalNAc of this application is selected from the group consisting of:
[0094]
[0095]
[0096]
[0097]
[0098]
[0099] The best option
[0100]
[0101] homology
[0102] The term “homology” as used herein has its conventional meaning in the field, referring to the degree of similarity between the nucleotide sequences of two nucleic acid molecules or between the amino acid sequences of two protein molecules, usually expressed as the percentage of identical bases between two nucleic acid molecules or identical amino acids between two protein molecules in the entire sequence.
[0103] Algorithms and programs used to compare the homology between the nucleotide sequences of two nucleic acid molecules or the amino acid sequences of two protein molecules are well known to those skilled in the art, including BLAST, FASTA, etc. For example, using websites https: / / blast.ncbi.nlm.nih.gov / Blast.cgi This allows for easy comparison to obtain homology values.
[0104] Hyperuricemia-related renal insufficiency / Hyperuricemia in patients with renal insufficiency
[0105] Typically, in patients with chronic renal insufficiency (CKD), damage to the renal vascular endothelium leads to tissue ischemia and hypoxia, resulting in increased expression of hypoxanthine and purine oxidase, thus increasing uric acid production. Increased local lactic acid production and elevated blood lactate levels reduce uric acid excretion. Glomerular sclerosis and constriction of afferent arterioles cause a decrease in glomerular filtration rate, further reducing uric acid excretion. Impaired renal tubular function leading to abnormal uric acid reabsorption and secretion can also contribute to elevated blood uric acid levels. The use of diuretics, which reduces blood volume and increases net uric acid reabsorption, is also a significant mechanism contributing to hyperuricemia.
[0106] From a pathophysiological perspective, uric acid is a double-edged sword. Physiologically normal blood uric acid is an effective antioxidant in the extracellular environment, scavenging up to 60% of free radicals in the body. However, high blood uric acid is an intracellular pro-oxidant, leading to endothelial dysfunction, vascular smooth muscle cell proliferation, and interstitial inflammatory infiltration through mechanisms such as inducing cellular oxidative stress, mitochondrial dysfunction, inflammatory responses, and activation of the renin-angiotensin system (RAS), thus triggering the occurrence and progression of CKD and cardiovascular diseases. Besides causing kidney damage due to renal arteriolar and interstitial inflammation caused by uric acid crystal deposition, hyperuricemia can induce oxidative stress and endothelial dysfunction, leading to systemic and glomerular hypertension, increased renal vascular resistance, and reduced renal blood flow. It can also induce endothelial dysfunction by increasing superoxide anion production caused by mitochondrial calcium overload. Activation of the renal arteriosclerosis system (RAS) is accompanied by arteriosclerosis of the afferent arterioles and glomerular hypertrophy, which, over time, further leads to interstitial fibrosis and glomerulosclerosis. Hyperuricemia can also directly affect the renal interstitium through inducing renal tubular epithelial cell transdifferentiation, leading to fibrosis. In the progression of chronic kidney disease (CKD), hyperuricemia accelerates glomerular hypertension and vascular damage, and is an independent risk factor for renal interstitial vascular disease, leading to clinical proteinuria and renal failure associated with worsening glomerulosclerosis and tubulointerstitial disease. Simultaneously, hyperuricemia causes the kidneys to produce urate crystals and stones, leading to the occurrence and development of obstructive nephropathy, ultimately resulting in end-stage renal disease.
[0107] In preferred embodiments, the renal protective activities of the siRNA and GalNAc-siRNA of the present invention include one or more of the following: reducing blood urea nitrogen (BUN) and serum creatinine, increasing glomerular filtration rate (eGFR), and / or slowing down or treating renal fibrosis. Preferably, the reduction of BUN and serum creatinine includes a decrease in BUN and serum creatinine by at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared to baseline values after administration of the siRNA of the present invention. In addition, the renal protective activities of the siRNA and GalNAc-siRNA of the present invention also include one or more of the following: increasing glomerular filtration rate (eGFR), increasing serum creatinine clearance, reducing renal uric acid crystals and stones, reducing RAS system activation, reducing renal vascular sclerosis, reducing glomerular inflammation, reducing renal interstitial fibrosis, and reducing proteinuria. These renal protective effects can occur independently or simultaneously with a decrease in serum uric acid. For example, renal protection can be performed while lowering serum uric acid, or it can be performed even without a decrease in serum uric acid. The protective effect on kidney function can occur independently or simultaneously with gout relief. Invention Details
[0109] Xanthine oxidoreductase (XOR) is a key rate-limiting enzyme in uric acid synthesis. It catalyzes the conversion of hypoxanthine to xanthine, which in turn catalyzes the conversion of xanthine to uric acid.
[0110] In 2018, the first siRNA drug approved by the U.S. Food and Drug Administration (FDA), patisiran, was found to target transthyretin (TTR) messenger RNA in the liver to combat hereditary transthyretin amyloidosis, highlighting the potential of RNAi-based therapies for treating the disease. siRNAs can bind to mRNA at specific sites, regulating its degradation and thus controlling the expression of functional proteins. This process was first described by Andrew Fire and Craig Mello in 1998. Over the past few decades, with advancements in chemical modification, sequence selection, and delivery innovation, siRNA-based drugs have forged a safer and more effective new pipeline. Initially, appropriate chemical modifications, including reducing the activation of endogenous immune responses, increasing resistance to nuclease degradation, and mitigating off-target effects, played a crucial role in the translation of siRNA reagents. Furthermore, the development of novel drug delivery systems is essential for the development of new siRNA drugs. Currently, siRNA delivery primarily focuses on lipid nanoparticles (trade names for siRNA drugs delivered via lipid nanoparticles include patisiran) and N-acetylgalactosamine (GalNAc; trade names for siRNA drugs delivered via GalNAc include givosiran, lumasiran, and inclisiran). In particular, targeting the liver with GalNAc-siRNA is a well-established approach, thanks to the high affinity of GalNAc molecules for the asialalglycoprotein receptor (ASGPR), which is abundant in the liver and has a high circulation rate. Compared to antibodies or small molecule drugs, siRNA offers a shorter discovery cycle and a broader therapeutic range, especially for proteins that cannot be targeted by antibodies or small molecules.
[0111] Currently, there are three main strategies for treating hyperuricemia: reducing uric acid production, promoting uric acid excretion, and converting uric acid into soluble allantoin. XOR inhibitors are popular in the clinical treatment of hyperuricemia, and many drugs targeting XOR, such as febuxostat and allopurinol, have been designed. However, these existing XOR inhibitors used clinically to treat hyperuricemia often face problems such as short half-lives and serious side effects. For example, the active metabolite of allopurinol, hydroxypurinol, is excreted through the kidneys and can accumulate in patients with impaired renal function, increasing the risk of severe allergic reactions and resulting in a mortality rate between 20% and 25%. Therefore, patients with renal insufficiency should be closely monitored for adverse reactions when using allopurinol, and their dosage should be adjusted according to eGFR. While norbuprofen is a dual-channel drug excreted through both the kidneys and feces, and no dose reduction is required when eGFR > 30 ml / min, close monitoring of renal function is necessary in patients with severe renal impairment. It should not be used in patients with severe hepatic damage, as it increases the risk of cardiovascular death. In elderly patients with gout, it increases the risk of heart failure, ischemic heart disease, hypertension, and cardiomyopathy. For these patients with hyperuricemia, lowering serum uric acid is a double-edged sword. While lowering serum uric acid helps control overall hyperuricemia, the process of excretion severely affects renal function. Patients with pre-existing renal insufficiency will further hinder renal excretion of uric acid and exacerbate the development of hyperuricemia.
[0112] The purpose of this application is to achieve better kidney protection while maintaining blood uric acid balance by using GalNAc-siRNA technology to highly specifically target and silence the XOR gene in the liver, thereby improving the contradictory situation of promoting uricosuric excretion and kidney damage in the treatment of hyperuricemia.
[0113] In preferred embodiments, the renal protective activities of the siRNA and GalNAc-siRNA of the present invention include one or more of the following: reducing blood urea nitrogen (BUN) and serum creatinine, increasing glomerular filtration rate (eGFR), and / or slowing down or treating renal fibrosis. Preferably, the reduction in BUN and serum creatinine includes a decrease in BUN and serum creatinine by at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared to baseline values after administration of the siRNA of the present invention. In addition, the renal protective activities of the siRNA and GalNAc-siRNA of the present invention also include one or more of the following: increasing glomerular filtration rate (eGFR > 60 ml / min), increasing serum creatinine clearance, reducing renal uric acid crystals and stones, reducing RAS system activation, reducing renal vascular sclerosis, reducing glomerular inflammation, reducing renal interstitial fibrosis, and reducing proteinuria. These renal protective effects can occur independently or simultaneously with a decrease in serum uric acid. For example, kidney function protection can be achieved while lowering blood uric acid, or it can be achieved even when blood uric acid levels have not decreased. The kidney-protective effect can occur independently or simultaneously with gout relief.
[0114] In a preferred embodiment, the siRNA and GalNAc-siRNA of the present invention can also be used concurrently with other drugs that lower uric acid and / or improve gout, including but not limited to one or more of topiptostat, febuxostat, benzbromarone, and allopurinol.
[0115] To achieve the above objectives, this application first provides an siRNA that targets the XOR gene, thereby interfering with XOR gene expression by hybridizing with XOR mRNA molecules, thus inhibiting XOR expression. Specifically, the siRNA of this application targets a continuous portion of the nucleotide sequence of the mRNA molecule formed during XOR gene transcription, and induces degradation of the mRNA molecule through RNA interference (RNAi), thereby inhibiting XOR gene expression. Therefore, those skilled in the art should understand that any siRNA capable of targeting the XOR gene and inhibiting its expression is included within the scope of this application.
[0116] As an example of the siRNA design method of this application, a suitable continuous nucleotide sequence of appropriate length from the XOR gene nucleotide sequence can be selected as the target sequence. Based on this target sequence, a sense strand that is substantially identical to the continuous nucleotide sequence and an antisense strand that is substantially complementary to the continuous nucleotide sequence are designed, and these two strands are hybridized to form a double strand. This siRNA design method is well known to those skilled in the art and can be completed using various commonly used commercial software such as BLOCK-iT RNAi Designer. However, those skilled in the art should understand that the RNAi efficacy of such designed siRNA against the target gene is difficult to predict, and further experimental studies are needed to ultimately determine the effective siRNA sequence.
[0117] Therefore, after careful and in-depth research, the applicant has identified several siRNA sequences that strongly inhibit the XOR gene. Based on the nucleotide sequence shown in SEQ ID No:149, the target sequences of these siRNAs are located within the range of nucleotides 400 to 3400 of the XOR gene, mainly within the range of nucleotides 439 to 1092, 1353 to 1487, 1624 to 1798, 2131 to 2936, or 3296 to 3320 of the XOR gene. Furthermore, their sense strands are essentially identical to the target sequences, and their antisense strands are essentially complementary to the target sequences.
[0118] As a specific example of the siRNA of this application, examples can be given of siRNAs whose sense strand has the nucleotide sequence shown in SEQ ID No: 5, 17, 21, 22, 47, 48, 49, 52, 53, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 66, 67, or 69, and whose antisense strand has the nucleotide sequence shown in SEQ ID No: 75, 87, 91, 92, 117, 118, 119, 122, 123, 125, 126, 127, 129, 130, 131, 132, 133, 134, 135, 136, 137, or 139. However, those skilled in the art should understand that SEQ ID Nos: 5, 17, 21, 22, 47, 48, 49, 52, 53, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 66, 67, or 69 and SEQ ID Nos: 75, 87, 91, 92, 117, 118, 119, 122, 123, 125, 126, 127, 129, 130, 131, 132, 133, 134, 135, 136, 137, or 139 are merely illustrative nucleotide sequences of the sense and antisense strands of the siRNA of this application. The nucleotide sequences of the sense and antisense strands of the siRNA of this application are not limited to these. As long as the ability to target the XOR gene is preserved, the sense strand of the siRNA of this application also includes sequences with the same SEQ ID Nos. The antisense strand of the siRNA of this application also includes a nucleotide sequence having at least 90% homology with the nucleotide sequences shown in SEQ ID No: 5, 17, 21, 22, 47, 48, 49, 52, 53, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 66, 67, or 69. That is, as long as it does not adversely affect the ability of the siRNA molecule to target the XOR gene, the siRNA of this application may contain one or more arbitrary nucleotide insertions, deletions or substitutions based on the nucleotide sequence shown in any of SEQ ID No: 5, 17, 21, 22, 47, 48, 49, 52, 53, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 66, 67 or 69; or 75, 87, 91, 92, 117, 118, 119, 122, 123, 125, 126, 127, 129, 130, 131, 132, 133, 134, 135, 136, 137 or 139.
[0119] Preferably, the sense strand of the siRNA of this application has a nucleotide sequence shown in any of SEQ ID No: 52, 56, 57, 60, 61, 62, or 64, or has a nucleotide sequence with at least 90% homology to any of the nucleotide sequences shown in SEQ ID No: 52, 56, 57, 60, 61, 62, or 64 and retains the ability to target the XOR gene; and its antisense strand has a nucleotide sequence shown in any of SEQ ID No: 122, 126, 127, 130, 131, 132, or 134, or has a nucleotide sequence with at least 90% homology to any of the nucleotide sequences shown in SEQ ID No: 122, 126, 127, 130, 131, 132, or 134 and retains the ability to target the XOR gene. Preferably, the sense strand of the siRNA of this application has the nucleotide sequence shown in SEQ ID No:52, or has a nucleotide sequence with at least 90% homology to the nucleotide sequence shown in SEQ ID No:52 and retains the ability to target the XOR gene; and its antisense strand has the nucleotide sequence shown in SEQ ID No:122, or has a nucleotide sequence with at least 90% homology to the nucleotide sequence shown in SEQ ID No:122 and retains the ability to target the XOR gene. Preferably, the siRNA has a nucleotide sequence with at least 90% homology to the nucleotide sequence shown in SEQ ID No:56 and retains the ability to target the XOR gene; and / or has a nucleotide sequence with at least 90% homology to the nucleotide sequence shown in SEQ ID No:126 and retains the ability to target the XOR gene. Preferably, the siRNA has a nucleotide sequence with at least 90% homology to the nucleotide sequence shown in SEQ ID No: 57 and retains the ability to target the XOR gene; and / or has a nucleotide sequence with at least 90% homology to the nucleotide sequence shown in SEQ ID No: 127 and retains the ability to target the XOR gene. Preferably, the siRNA has a nucleotide sequence with at least 90% homology to the nucleotide sequence shown in SEQ ID No: 60 and retains the ability to target the XOR gene; and / or has a nucleotide sequence with at least 90% homology to the nucleotide sequence shown in SEQ ID No: 130 and retains the ability to target the XOR gene. Preferably, the siRNA has a nucleotide sequence with at least 90% homology to the nucleotide sequence shown in SEQ ID No: 61 and retains the ability to target the XOR gene; and / or has a nucleotide sequence with at least 90% homology to the nucleotide sequence shown in SEQ ID No: 131 and retains the ability to target the XOR gene.Preferably, the siRNA has a nucleotide sequence with at least 90% homology to the nucleotide sequence shown in SEQ ID No:62 and retains the ability to target the XOR gene; and / or has a nucleotide sequence with at least 90% homology to the nucleotide sequence shown in SEQ ID No:132 and retains the ability to target the XOR gene. Preferably, the siRNA has a nucleotide sequence with at least 90% homology to the nucleotide sequence shown in SEQ ID No:64 and retains the ability to target the XOR gene; and / or has a nucleotide sequence with at least 90% homology to the nucleotide sequence shown in SEQ ID No:134 and retains the ability to target the XOR gene.
[0120] In some embodiments, the siRNA of this application is unmodified, while in some preferred embodiments, the siRNA of this application is modified to enhance its stability or other properties. For example, the siRNA of this application may contain at least one modified nucleotide. In some more preferred embodiments, substantially all nucleotides of the siRNA of this application are modified, meaning that no more than 5, 4, 3, 2, or 1 unmodified nucleotides are present in the siRNA chain. In a further more preferred embodiment, all nucleotides of the siRNA of this application are modified.
[0121] As an example of the modifications used to enhance the stability of siRNA, examples include enhanced stabilization chemistry (ESC), the types and methods of which are well known in the art. Preferably, by modifying the 2' position of the ribose in the siRNA molecule of this application with 2'-fluoride (2'-fluro, abbreviated as 2'F) or 2'-methoxy (2'-O-methyl, abbreviated as 2'-OMe), that is, by replacing the 2'-OH in the ribose of the siRNA molecule of this application with 2'-F or 2'-Ome, the stability of siRNA can be effectively maintained, and the activation of the innate immune system can be reduced. The typical chemical structure of the nucleotide substituted with 2'-F or 2'-Ome is shown in the figure below:
[0122]
[0123] Secondly, this application provides a GalNAc-siRNA comprising a conjugate formed by coupling an siRNA molecule and a GalNAc molecule, wherein the siRNA molecule targets liver XOR. Specifically, the siRNA molecule in the GalNAc-siRNA of this application is the siRNA of this application; therefore, this GalNAc-siRNA can not only be targeted and delivered to the liver, but also interfere with the expression of the XOR gene by hybridizing with XOR mRNA molecules, thereby inhibiting XOR to treat hyperuricemia.
[0124] The siRNA molecule in the GalNAc-siRNA of this application is coupled with a GalNAc (e.g., GalNAc-L96) molecule to form a conjugate, thereby utilizing the high affinity of GalNAc molecules for ASGPR abundant in the liver to deliver the siRNA molecule in a targeted manner. Methods for conjugating siRNA molecules with GalNAc (e.g., GalNAc-L96) molecules are well known in the art. For example, GalNAc molecules can be covalently coupled to the 3' end of the positive strand of the siRNA molecule in a trivalent state using conventional methods in the art. As a covalent coupling method, commonly used adapters in the art can be used for connection; all of these are within the knowledge of those skilled in the art. An exemplary chemical structure of the GalNAc-siRNA synthesized in this application is shown in the following figure:
[0125]
[0126] Furthermore, this application also provides a pharmaceutical composition comprising: a) the siRNA or GalNAc-siRNA described in this application; and b) an optional pharmaceutically acceptable carrier. In some preferred embodiments, the pharmaceutically acceptable carrier is one or more components selected from the group consisting of excipients, solvents, diluents, stabilizers, dispersants, buffers, compatibilizers, preservatives, and combinations thereof.
[0127] This application also provides a formulation comprising the siRNA or GalNAc-siRNA described in this application or the pharmaceutical composition described in this application.
[0128] This application also provides a kit comprising the siRNA or GalNAc-siRNA described in this application, the pharmaceutical composition described in this application, or the formulation described in this application. Preferably, the kit further comprises instruments and / or instructions for use for delivering the siRNA or GalNAc-siRNA described in this application, the pharmaceutical composition described in this application, or the formulation described in this application to the liver of a subject. The subject may be a human, a non-human primate, or other mammal, preferably a human.
[0129] This application also provides the use of the siRNA or GalNAc-siRNA described herein in the preparation of a medicament for treating hyperuricemia. The hyperuricemia can be hyperuricemia affecting humans, non-human primates, or other mammals, preferably hyperuricemia affecting humans.
[0130] This application also provides a method for treating hyperuricemia, the method comprising administering to a subject in need the siRNA or GalNAc-siRNA described in this application, the pharmaceutical composition described in this application, the formulation described in this application, or the kit described in this application. The subject in need may be a human, a non-human primate, or other mammal, preferably a human.
[0131] Example
[0132] Some specific embodiments of this application will now be described in the following examples. However, the scope of this disclosure is certainly not limited to the embodiments described in these examples. Rather, the embodiments are merely embodying the inventive concept of this disclosure.
[0133] The purpose of providing the following embodiments is to fully disclose and describe how to prepare and use this application to those skilled in the art. These embodiments are not intended to limit the scope of the invention as the inventors believe, nor do they represent all or only the experiments conducted. Efforts have been made to ensure the accuracy of the numerical values used (such as quantities, temperatures, etc.), but some experimental errors and deviations should be allowed. Unless otherwise stated, parts are parts by weight, molecular weight is weight-average molecular weight, temperature is degrees Celsius, and pressure is atmospheric pressure or close to atmospheric pressure. Standard abbreviations may be used, such as bp: base pair; kb: kilobase; nM: nanomolar; s or sec: second; min: minute; h or hr: hour; aa: amino acid; nt: nucleotide; im: intramuscular; ip: intraperitoneal; sc: subcutaneous; ivt or IVT: intravitreal; iv or IV: tail vein, intravenous; icv or ICV: intraventricular, etc.
[0134] Unless otherwise stated, all starting materials, reagents and solvents used below are obtained from commercial sources and are used as is.
[0135] Test methods
[0136] 1. siRNA synthesis method
[0137] 1.1 RNA was synthesized using the phosphorous acid method in a DNA / RNA solid-phase carrier synthesizer (e.g., a dr. Oligo 48 or K&A H8 / H6 synthesizer) at a scale of 10 nmol–1 μmol, following a 3' to 5' synthetic direction. Specifically, Universal CPG was loaded into a synthesis column according to the desired synthetic specifications. Using nitrogen / argon as the carrier gas, RNA monomer synthesis and ligation were performed in an acetonitrile environment through repeated steps of deprotection, coupling, capping, and oxidation. First, the monomer linked to the CPG terminal reacted with trichloroacetic acid to remove the 5'-hydroxyl protecting group (DMT), yielding a free 5'-hydroxyl group. The phosphorous acid nucleotide monomer was then mixed with the activator tetrazolium to obtain a nucleoside phosphorous acid activated intermediate, which underwent a condensation reaction with the free 5'-hydroxyl group on the carrier. A few 5'-hydroxyl groups did not participate in the condensation reaction; these were terminated with acetic anhydride and 1-methylimidazole to prevent further reaction. Under the action of oxidizing agent iodine or thiodiamine DDTT, the phosphoramide form is converted into a more stable triphosphate or thiophosphate.
[0138] 1.2 The synthesized column was placed in an ammonolysis apparatus, and concentrated ammonia was added to ensure that the pressure in the ammonolysis apparatus reached above 40 mmHg. Ammonolysis was performed at 70℃ for 2-3 hours. The ammonolyzed support was washed with acetonitrile (200 μL) and eluted with ddH2O (200 μL × 2) to obtain the crude product.
[0139] 1.3 The crude product can be purified by various methods, such as PAGE purification, OPC purification and HPLC purification.
[0140] PAGE purification: Polyacrylamide gel electrophoresis can separate and purify denatured synthetic nucleic acid products. Electrophoresis is usually performed on a 20% PAGE gel containing 7M urea in a Tris-borate buffer solution (50mM Tris, 50mM boric acid, 1mM EDTA, pH 8.3). The PAGE gel is pre-run at 200V for 40 minutes in a TBE environment to remove salts. 2×RNA loading buffer (80% formamide solution) is added to the RNA sample, heated to 90°C for 3 minutes for complete denaturation, rapidly cooled on ice, and then loaded onto the gel for running. The PAGE gel can be visualized under a 254nm UV lamp using a fluorescent TLC plate as a substrate. The target band is cut, the gel is homogenized, and the corresponding volume of TE buffer is added. The gel is then frozen at -80°C for 30 minutes until frozen solid. Rapid thawing is performed in a hot water bath, followed by soaking at 90°C for 5 minutes. Elution is then carried out overnight at room temperature on a rotary shaker. Take the supernatant and add an equal volume of n-butanol to concentrate the sample. Add 3.0M sodium acetate (pH 5.2) and anhydrous ethanol to the concentrated aqueous phase to precipitate the sample and obtain the purified sample.
[0141] The OPC purification column was purchased from Shenzhen DouDian Biotechnology Co., Ltd., and the purification operation was carried out according to the instructions.
[0142] HPLC purification: Oligonucleotide fragments were separated and purified using a C18 reversed-phase column. Mobile phase: Phase A: triethylamine; Phase B: 50% triethylamine + 50% acetonitrile. After collecting the desired fraction, ultrafiltration or desalting purification using a C18 desalting column was performed.
[0143] The purified product was evaporated under vacuum to obtain RNA single-stranded powder.
[0144] 1.4 Annealing of siRNA double strands
[0145] Equal molar amounts of complementary siRNA single strands were mixed, heated to 95°C, and the tube was slowly cooled to room temperature to form a double strand.
[0146] 1.5 siRNA synthesis efficiency detection
[0147] The synthesis efficiency of siRNA was detected using HPLC-MS. The purity of siRNA was calculated by the peak area ratio of each HPLC peak, and the molecular weight of siRNA was analyzed by mass spectrometry to verify its accuracy.
[0148] The synthesis efficiency of siRNA was detected using PAGE. siRNA was separated using a 20% urea-PAGE denaturing gel, and the purity of the siRNA on the PAGE gel was obtained by visualization analysis using a fluorescent TLC plate under a 254 nm UV lamp.
[0149] 2. Galnac-siRNA Synthesis Method
[0150] GalNAc-siRNA was synthesized using a Dr. Oligo 48 synthesizer. 5 mg of GalNAc L96-CPG was weighed and filled into a red synthesis column, which was then sealed to synthesize GalNAc-sense strands. A white synthesis column with a high CPG monomer loading was used to synthesize antisense strands. A suitable synthesis program was selected, the desired nucleotide sequence was imported into the instrument, the synthesis column was installed, and synthesis began. The next day, the synthesis column was unloaded and mounted onto a column holder for ammonolysis. Ammonolysis is used to cleave the ester bonds between the CPG-linked chemical and the initial nucleotide. After ammonolysis, the waste liquid and gases in the ammonolysis instrument were removed, and the column holder was taken out. 200 μL of anhydrous acetonitrile was added to each synthesis column, and the column was centrifuged at 1000 rpm for 1 min at room temperature to elute salts. A clean container was then used, and 200 μL of ddH2O was added to each synthesis column. The column was centrifuged at room temperature for 1 min to elute nucleotides, and then washed twice with water. Add an equal volume of siRNA solubilizer and 5% N,N-dimethylformamide to the eluted nucleotide solution. Assemble the OPC purification apparatus and elute the siRNA in the following order: anhydrous acetonitrile-TEAA-siRNA-TEAA-TCA-TEAA-ddH2O-ddH2O-nucleic acid elution buffer. Measure the concentration of siRNA in the elution buffer. Dry the siRNA solution using a vacuum freeze-drying centrifuge. The next day, collect the siRNA powder sample, dissolve it in physiological saline, and determine the siRNA concentration using Nanodrop. Mix equal amounts of the sense and antisense strands, heat at 94°C for 3 min, and slowly cool to ensure complete binding of the strands. Identify the purity of the siRNA drug using agarose gel electrophoresis and determine the purity using UPLC-TOF / MS.
[0151] The structure of GalNAc L96-CPG is as follows:
[0152]
[0153] Successfully formed synthetic GalNAc-siRNA conjugates
[0154] 3. Extraction and culture of primary mouse hepatocytes
[0155] Several male C57BL / 6J mice aged 8-10 weeks were selected and anesthetized with an intraperitoneal injection of 1% sodium pentobarbital at a ratio of 25g body weight / 200uL to expose the portal vein. An indwelling intravenous catheter was carefully inserted into and fixed into the portal vein. Approximately 20 mL of calcium-free perfusion was slowly injected into the syringe until the liver turned off-white, at which point the calcium-free perfusion was stopped. The liquid in the syringe was replaced with calcium-containing digestive solution, and perfusion continued. Calcium-containing perfusion was continued slowly for approximately 3 minutes. The liver tissue connections were carefully cut, and the liver was slowly removed and placed in a sterile 10cm cell culture dish. Calcium-containing perfusion continued, while simultaneously pressing the liver with a sterile cotton swab to obtain a hepatocyte suspension. The hepatocyte suspension was collected, filtered through a 100µm filter, and any undigested liver tissue was discarded. The suspension was centrifuged at 500 rpm for 6 minutes at room temperature, and the hepatocyte pellet was collected. The hepatocytes were resuspended in pre-cooled sterile PBS solution and centrifuged again at 500 rpm for 5 minutes at room temperature. After washing hepatocytes four times with PBS, the hepatocyte pellet was collected and resuspended in pre-cooled DMEM complete medium. The number and viability of hepatocytes were determined using a cell counter. When the cell viability was greater than 90%, the cells were seeded into 6-well plates.
[0156] 4. Cell culture and transfection
[0157] 4.1 Primary mouse hepatocyte culture and transfection
[0158] Primary mouse hepatocytes were cultured at 37°C in a 5% CO2 environment. Cell status was observed regularly, and the culture medium was replaced with fresh DMEM complete medium containing 10% FBS and 1% PS. After the primary mouse hepatocytes adhered to the culture medium (approximately 1-4 hours), cell transfection could be performed.
[0159] 4.2 HepG2 cell culture and transfection
[0160] The day before the experiment, HepG2 cells were passaged and seeded into 6-well plates. Fresh DMEM complete medium containing 10% FBS and 1% PS was added, and the plates were incubated at 37°C in a 5% CO2 incubator. siRNA transfection was performed when the cells reached 70% confluence.
[0161] 5. Real-time quantitative PCR detection of Xor mRNA expression levels
[0162] RNA was extracted from primary mouse hepatocytes or mouse tissues using TRIzol reagent, and the RNA concentration and absorbance were measured using a Nanodrop instrument. After reverse transcription, real-time quantitative polymerase chain reaction (Q-PCR) was performed.
[0163] Quantification of the target gene DNA was performed, with GAPDH used as an internal reference gene.
[0164] The primers used in the qPCR experiment were:
[0165] Human XOR-Forward primer sequence GAATAGGGTCGG-GAAGGGTT (SEQ ID No: 141),
[0166] The human XOR-Reverse primer sequence is CACAGGAAGGCACAC-GATTT (SEQ ID No: 142).
[0167] The human GAPDH-Forward primer sequence is CATCAC-CATCTTCCAGGAG (SEQ ID No: 143).
[0168] The human GAPDH-Reverse primer sequence is AG-GCTGTTGTCATACTTCTC (SEQ ID No: 144).
[0169] The mouse Xor-Forward primer sequence is ATTT-GGCAGCATCCCCATTG (SEQ ID No: 145).
[0170] The mouse Xor-Reverse primer sequence is GTTT-GGCGTTACTGTCTCCG (SEQ ID No: 146).
[0171] The mouse Gapdh-Forward primer sequence is AG-GTCGGTGTGAACGGATTTG (SEQ ID No: 147).
[0172] The mouse Gapdh-Reverse primer sequence is TGTAGACCATGTAGTTGAGGTCA (SEQ ID No: 148).
[0173] The relative expression level of the target gene = 2 -△△CT =2 -△CT (Experimental group) / 2 -△CT (The average value of the control group).
[0174] 6. Detection of XOR protein expression level by Western blotting assay
[0175] 120 hours after transfection with primary mouse hepatocytes, the cell culture medium was discarded, and the cells were washed three times with pre-cooled PBS, discarding any non-adherent cells and the PBS solution. 1 mL of RIPA protein lysis buffer containing a protease inhibitor was added to the cell culture dish, and the cells were incubated on ice for half an hour to allow for complete lysis. The cells were centrifuged at 12,000 rpm for 30 min at 4°C, and the supernatant was transferred to a clean, sterile 1.5 mL EP tube. The tube was kept on ice or stored at -80°C for long-term storage. For mouse tissue protein extraction, 10 mg of fragmented tissue was accurately weighed and transferred to a clean 1.5 mL EP tube. 1 mL of RIPA protein lysis buffer containing a protease inhibitor and three clean sample grinding beads were added to the tube. The sample was cryogenically ground three times at -20°C, 60 Hz, for 60 seconds to thoroughly disrupt the tissue. The small steel beads were discarded, and the tube was centrifuged at 12,000 rpm for 30 min at 4°C. The sample supernatant was transferred to a brand new 1.5 mL EP tube and kept on ice. Protein concentration was determined by BCA method, PAGE gel was run, and XOR protein antibody and secondary antibody were incubated to show the color intensity of XOR protein bands.
[0176] 7. Construction and drug treatment of a mouse model of hyperuricemia
[0177] Currently, animal models of hyperuricemia mainly include gene knockout models (such as the Uox-KO model) and drug / diet-induced models. Potassium oxonate (PO) is a uricase inhibitor that can inhibit the conversion of uric acid into the more soluble allantoin. Hypoxanthine (HX) is a precursor in uric acid synthesis; increasing hypoxanthine levels can significantly promote uric acid synthesis.
[0178] 1) Animal grouping and modeling
[0179] This study included a blank control group (NC), a hyperuricemia control group (HUA), a febuxostat treatment group, and an siRNA drug treatment group. Except for the blank control group, mice in the other groups were fed 300 mg / kg (body weight) of hypoxanthine daily for 21 consecutive days and received an intraperitoneal injection of 300 mg / kg (body weight) of potassium oxonate to establish a hyperuricemia mouse model. Mice in the blank control group received an equal volume of physiological saline intraperitoneally daily and were also administered an equal volume of 0.5% CMC-Na via gavage.
[0180] 2) Drug treatment
[0181] One hour after establishing the hyperuricemia model, mice in the febuxostat group were administered 5 mg / kg (body weight) of febuxostat by gavage, while mice in the other groups were administered an equal volume of 0.5% CMC-Na by gavage. For siRNA treatment, the GalNAc-siX61 group received subcutaneous injections of 10 mg / kg (body weight) of siRNA on days 0, 3, 7, and 14. The GalNAc-siX60 group followed the same procedure. Except for the GalNAc-siX61 and GalNAc-siX60 groups, the other groups received an equal volume of physiological saline subcutaneously on days 0, 3, 7, and 14. On day 21, mice were sacrificed one hour after administration. Plasma and various organs were collected for analysis of biochemical indicators and pathological conditions.
[0182] 3) Biochemical indicator testing
[0183] Uric acid levels were measured using a uric acid test kit manufactured by Nanjing Jiancheng Biotechnology Co., Ltd. Liver and kidney function indicators, including ALT, AST, BUN, and CRE, were measured using a Beckman Coulter fully automated biochemical analyzer.
[0184] 8. Immunohistochemistry
[0185] After sample collection, mouse tissues were immediately fixed in 4% paraformaldehyde, dehydrated, cleared, and embedded in paraffin. The paraffin blocks were then stored at -20°C and sectioned. Hematoxylin and eosin (H&E) staining and Masson staining were performed, followed by microscopic observation and photography. ImageJ software was used to analyze the area of collagen deposition in the tissues. Each group consisted of at least three mice, and five non-complementary overlapping fields of view were selected from each mouse section to ensure the accuracy and stability of the experimental structures.
[0186] 9. Data Statistical Analysis
[0187] Statistical analysis was performed using GraphPad Prism 8 software. Unpaired t-tests and one-way ANOVA were used to perform statistical analyses on comparisons between two groups and among multiple groups. Statistical results are expressed as mean ± SD. A p-value < 0.05 was considered statistically significant. Significant differences between groups were expressed as: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
[0188] Example 1: Design of siRNA targeting XOR expression
[0189] Designing and screening suitable siRNA sequences is crucial for the success of siRNA knockout experiments. siRNA sequences designed for different regions of mRNA can often achieve different gene silencing effects. Seventy pairs of siRNAs (naked-siX1 to naked-siX70) were designed based on different sites in human and human-mouse homologous XOR mRNAs, and their sequences are shown in Tables 1 and 2. The siRNAs were synthesized using the method described in this paper.
[0190] Table 1
[0191]
[0192]
[0193]
[0194] Table 2
[0195]
[0196]
[0197]
[0198] Example 2: Screening of the inhibitory efficiency of siRNA in in vitro cell lines
[0199] The siRNA obtained in Example 1 was transfected into human HepG2 cell line (purchased from ATCC) and mouse primary hepatocytes (PMHs) for 48 h, respectively. Cells were collected, RNA was extracted, and the expression level of XOR mRNA in cells of different siRNA treatment groups was detected by Q-PCR technology, thereby evaluating the inhibitory effect of different siRNAs on XOR gene expression in primary liver cells.
[0200] Compared with the negative control siRNA treatment group (naked-siNC), some siRNAs with significant inhibitory efficiency against XOR gene expression mRNA were screened out, including naked-siX5, naked-siX17, naked-siX21, naked-siX22, naked-siX47, naked-siX48, naked-siX49, naked-siX52, naked-siX53, naked-siX55, naked-siX56, naked-siX57, naked-siX59, naked-siX61, naked-siX62, naked-siX63, naked-siX64, naked-siX65, naked-siX66, naked-siX67, naked-siX68, and naked-siX69. The XOR mRNA expression levels in cells treated with naked-siX60, naked-siX61, naked-siX67, and naked-siX68 were significantly reduced, and the inhibition rate of XOR mRNA expression was higher (Table 3).
[0201] Table 3
[0202]
[0203]
[0204] Example 3: Design and synthesis of GalNAc-siRNAs for liver-targeted delivery of XOR siRNA
[0205] To specifically target XOR in the liver, the GalNAc delivery system and the GalNAc synthesis method described herein were used. GalNAc-siRNA was synthesized from siX5, 17, 21, 22, 47, 48, 49, 52, 53, 55, 56, 57, 59, 61, 62, 63, 64, 65, 66, 67, and 69. GalNAc-siRNA with a purity >95% was obtained according to the aforementioned method.
[0206] Example 4: GalNAc-siRNAs targeting XOR significantly alleviated kidney damage in hyperuricemic mice.
[0207] Potassium oxycyanate (PO) is a selectively competitive uricase inhibitor that inhibits the catalytic activity of hepatic uricase, blocking the metabolism of uric acid into soluble allantoin. Hypoxanthine (HX) is a precursor to uric acid synthesis, and increasing dietary hypoxanthine levels also promotes hyperuricemia. The combined use of potassium oxycyanate and hypoxanthine is a common method for inducing animal models of hyperuricemia. Since the kidneys are the primary organ for uric acid excretion, in a state of hyperuricemia, large amounts of uric acid accumulate in the kidneys, leading to kidney damage. Hyperuricemia is currently considered an independent risk factor for the development of diabetic nephropathy, acute kidney injury, chronic kidney disease, and end-stage renal disease. Blood urea nitrogen (BUN) and creatinine (CRE) are the end products of protein and nitrogenous organic matter metabolism, respectively. When kidney function is normal, these metabolic wastes are excreted through glomerular filtration. When glomerular filtration function is reduced, BUN and CRE accumulate in the blood. If both blood urea nitrogen and creatinine are elevated, it indicates severe kidney damage. Blood samples are drawn from the inferior vena cava, and the blood components are analyzed using a Beckman Coulter fully automated biochemical analyzer.
[0208] To evaluate the in vivo therapeutic effect of GalNAc-siRNA, a mouse model of hyperuricemia was established by intraperitoneal injection of potassium oxycyanate combined with strong hypoxanthine feeding for 21 consecutive days. Starting from day 0 (the time of the first injection), mice were repeatedly administered saline (control group) at the same dose and route of administration on days 3, 7, and 14. The mice were designated as GalNAc-siX52, GalNAc-siX56, GalNAc-siX57, GalNAc-siX60, GalNAc-siX61, GalNAc-siX62, and GalNAc-siX64. Serum samples were collected on day 21 to measure blood urea nitrogen (BUN) and creatinine (CRE). The results showed that, compared with the control group, serum urea nitrogen and creatinine levels in hyperuricemic mice were significantly reduced after treatment with GalNAc-siX52, GalNAc-siX56, GalNAc-siX57, GalNAc-siX60, GalNAc-siX61, GalNAc-siX62, and GalNAc-siX64 (Table 4). This indicates that the use of these siRNAs can alleviate kidney damage induced by chemical drug modeling. Simultaneously, H&E staining results also showed that after modeling with potassium oxycyanate and hypoxanthine, WT mice exhibited severe kidney damage, accompanied by renal tubular swelling, proximal tubular necrosis and dilation, unclear cell boundaries between adjacent cells in the proximal tubules, and cytoplasmic vacuolation, indicating a high degree of kidney damage in hyperuricemic mice. In contrast, the degree of kidney damage in the treatment group was significantly reduced. Figure 2 ).
[0209] Table 4
[0210] Group Blood urea nitrogen (mmol / L) Creatinine (μmol / L) Comparison 25 80 GalNAc-siX52 12 42 GalNAc-siX56 13 40 GalNAc-siX57 13 43 GalNAc-siX60 13 32 GalNAc-siX61 14 30 GalNAc-siX62 15 45 GalNAc-siX64 16 50
[0211] Example 5: GalNAc-siRNA specifically reduces XOR expression levels in the liver and effectively lowers uric acid levels in the body.
[0212] To further investigate the pathway by which GalNAc-siRNA protects renal function, GalNAc-siX60 or GalNAc-siX61, which exhibit the most significant efficacy, were selected. Febuxostat was used as a positive control, and saline was used as a negative control. Hyperuricemia was induced in mice other than the NC group. One hour after modeling, mice in the febuxostat group were administered 5 mg / kg febuxostat by gavage, while mice in the other groups were administered saline by gavage. On days 0, 3, 7, and 14, the GalNAc-siX60 and GalNAc-siX61 groups were subcutaneously injected with 10 mg / kg GalNAc-siX60 and 10 mg / kg GalNAc-siX61, respectively, while mice in the other groups were subcutaneously injected with an equal volume of saline (e.g., 10 mg / kg GalNAc-siX60 and 10 mg / kg GalNAc-siX61). Figure 3 (As shown in A). Blood and tissue samples were taken from the inferior vena cava one hour after gavage on day 21.
[0213] Tissue samples from experimental mice were analyzed using Q-PCR and Western blotting. The results showed that WT mouse modeling did not induce significant changes in XOR mRNA or protein levels. However, treatment with GalNAc-siX60 or GalNAc-siX61 significantly reduced the expression levels of XOR mRNA and protein in the liver of hyperuricemic mice. Figure 3 (BD). Administration of febuxostat to hyperuricemic mice did not affect XOR mRNA expression levels. This indicates that febuxostat does not affect XOR expression, but rather reduces plasma uric acid levels by inhibiting xanthine oxidase activity, consistent with previous reports. On day 21 of the experiment, blood was collected from the orbital sinus of mice in each group, and plasma uric acid levels were tested using a uric acid assay kit. The results showed that co-treatment with PO and HX significantly increased plasma uric acid levels in mice, while administration of febuxostat, GalNac-siX60, or GalNac-siX61 significantly reduced plasma uric acid levels in hyperuricemic mice. Figure 3 E).
[0214] Example 6: GalNAc-siRNA reduced uric acid levels in the plasma of humanized XDH mice and alleviated kidney damage.
[0215] To investigate the effect of GalNAc-siRNAs on targeting XOR in humans, the human XDH expression cassette was knocked into the exon1 site of the background XDH gene in C57BL / 6J mice via homologous recombination. The schematic diagram of hXDH mouse construction is shown below. Figure 4As shown in Figure A. First, Cas9 mRNA and gRNA were obtained through in vitro transcription. A homologous recombination vector containing a 3.0 kb 5' homologous arm, hXDH, and a 3' homologous arm was constructed using in-fusion cloning. Next, Cas9 mRNA, gRNA, and the homologous recombination vector were injected into fertilized eggs of C57BL / 6J mice to obtain F0 generation mice. F0 generation mice that were hXdh positive were selected and crossed with wild-type mice with a C57BL / 6J background. After PCR screening, humanized XDH mice with stable inheritance were obtained. Humanized XDH mice (…) were prepared. Figure 4 A). RNA was extracted from the livers of humanized XDH heterozygous mice, humanized XDH homozygous mice, and WT mice. Q-PRC experiments were performed using human XOR mRNA-specific primers and mouse Xor mRNA-specific primers, respectively. Figure 4 B). Experimental results showed that humanized XDH homozygous mice (HO) expressed only human XOR mRNA in their livers, WT mice (WT) expressed only mouse Xor mRNA in their livers, and humanized XDH heterozygous mice (HE) expressed both human XOR mRNA and mouse Xor mRNA in their livers. Genotyping of each mouse was subsequently performed, and humanized XDH homozygous mice were used for further experiments.
[0216] Fifteen humanized homozygous XDH mice were randomly divided into five groups: NC group, HUA group, Febuxostat treatment group, GalNAc-siX61 (5 mg / kg) treatment group, and GalNAc-siX61 (10 mg / kg) treatment group. Except for the NC group, all other groups were induced to develop hyperuricemia. Compared with the NC control group, GalNAc-siX61 significantly reduced XOR expression in the liver at both mRNA and protein levels, exhibiting a concentration-dependent effect. Figure 5 AC). Furthermore, subcutaneous administration of GalNAc-siX61 significantly reduced plasma uric acid levels in humanized XDH hyperuricemic mice (AC). Figure 5 D). These results indicate that GalNAc-siRNAs can target XOR mRNA in the human liver, have a certain therapeutic effect on hyperuricemia, and the therapeutic effect is positively correlated with the concentration of GalNAc-siRNAs in the liver.
[0217] Example 7: GalNAc-siRNAs significantly alleviated kidney damage in Uox KO mice.
[0218] Uox is the gene encoding uricase (UOX), which catalyzes the oxidation of uric acid to allantoin in the body. Knockout of the Uox gene in mice severely impairs uric acid breakdown, leading to severe hyperuricemia. Therefore, Uox gene knockout in mice is an important method for generating a model of hyperuricemia mimicking humans. We purchased the Uox KO spontaneous hyperuricemia mouse model from Jicui Pharmaceutical Technology Co., Ltd. This mouse model was created by knocking out exons 2-4 of the Uox gene against a C57BL / 6J background, resulting in a lack of uricase expression, high uric acid accumulation in vivo, and inducing hyperuricemia in mice. GalNAc-siX61 was injected subcutaneously into the Uox KO mice at a dose of 10 mg / kg on days 0, 3, 7, 14, 21, and 35. A WT group and a Uox KO blank control group were also established, receiving the same amount of physiological saline subcutaneously at the same dosing frequency. Tissue samples were harvested from each group on day 45.
[0219] Western blotting was used to investigate the expression of XOR protein in different organs of the GalNAc-siX61-treated group. The results showed that XOR protein is widely present in various tissues and organs, but only XOR protein in the liver can be knocked down by GalNAc-siX61. XOR protein expression in the kidney, muscle, white adipose tissue, brown adipose tissue, and beige adipose tissue was not affected. Figure 6 This fully demonstrates that GalNAc-siX61 can specifically act on the liver to silence proteins.
[0220] Uric acid levels in tissue homogenates from WT and Uox KO mice were detected and compared. It was found that uric acid levels in the liver and brown adipose tissue were significantly elevated in Uox KO mice. GalNAc-siRNA targeting XOR specifically reduced uric acid levels in the liver, and GalNAc-siRNA also reduced uric acid accumulation in the kidneys. Figure 7 This indicates that the liver is the main organ that produces uric acid in the body, and that targeting the liver with XOR can reduce the body's uric acid levels.
[0221] On day 45 of the experiment, after mice were completely anesthetized with sodium pentobarbital, blood was collected via the abdominal aorta, and plasma was obtained after centrifugation. Subsequently, various liver and kidney damage indicators in the mouse plasma were analyzed using a Beckman Coulter analyzer. The results showed that, compared with WT mice, Uox KO mice had significantly increased levels of creatinine and blood urea nitrogen in their plasma, suggesting that knocking out the Uox gene in C57BL / 6J background mice may cause severe kidney damage. Figure 8A). H&E staining of the kidneys of mice in each group revealed severe hydronephrosis in Uox KO mice accompanied by significant inflammatory cell infiltration. Subcutaneous administration of GalNAc-siX61 to Uox KO mice significantly reduced hydronephrosis and renal cell inflammation. Renal fibrosis is characterized by excessive accumulation of extracellular matrix, manifested as activation of intrinsic fibroblasts in the kidney and gradual tissue hardening. Renal fibrosis is a common outcome of various chronic kidney diseases and an important indicator for assessing renal function. Masson staining of kidney sections from each group of mice revealed that, compared with the WT group, the kidneys of Uox KO control mice exhibited very severe fibrosis with extensive collagen deposition. Subcutaneous administration of GalNAc-siX61 to Uox KO mice significantly delayed the progression of renal fibrosis in Uox KO mice. Figure 8 B).
[0222] By incorporating via reference
[0223] The full disclosure of each patent and scientific document cited in this application is incorporated herein by reference for all purposes.
[0224] equivalent
[0225] This application may be implemented in other specific forms without departing from its essential characteristics. Therefore, the foregoing embodiments are considered illustrative and not limiting of this application. The scope of this application is defined by the appended claims rather than by the foregoing description, and is intended to include all changes falling within the meaning and scope of equivalents of the claims.
Claims
1. A siRNA that targets the liver xanthine oxidoreductase XOR gene, wherein the XOR gene has the nucleotide sequence shown in SEQ ID No: 149, characterized in that, The nucleotide sequence of its positive strand contains at least 15 nucleotides, and the target sequence of the siRNA contains at least 15 consecutive nucleotides located in the range of nucleotides 430-4400 of the nucleotide sequence of the XOR gene.
2. The siRNA as described in claim 1, wherein the target sequence of the siRNA comprises nucleotides 439-459, 715-735, 1068-1088, 1072-1092, 1353-1373, 1467-1487, 1612-1632, 1624-1644, 1681-1701, and 1713-1733 of the XOR gene. At least 15 consecutive nucleotides within the range of nucleotides 1772-1792, 1775-1795, 1778-1798, 2130-2150, 2131-2151, 2175-2195, 2582-2602, 2916-2936, 3296-3316, 3889-3909, 4298-4318, or 4299-4319.
3. The siRNA as described in claim 1 or 2, wherein the nucleotide sequence of its positive strand differs from its target sequence by 0, 1, or 2 nucleotides.
4. The siRNA as described in any one of claims 1-3, wherein the nucleotide sequence of its antisense strand is completely complementary to the nucleotide sequence of its sense strand, or one or two nucleotides are not complementary.
5. The siRNA as described in claim 4, wherein the nucleotide sequence of its antisense strand is completely complementary to its target sequence, or has one or two non-complementary nucleotides.
6. The siRNA according to any one of claims 1-5, wherein the sense strand has the nucleotide sequence shown in any one of SEQ ID No: 5, 17, 21, 22, 47, 48, 49, 52, 53, 55, 56, 57, 59, 60, 61, 62, 63, 64, 65, 66, 67, or 69; and Its antisense strand has a nucleotide sequence shown in any of SEQ ID No: 75, 87, 91, 92, 117, 118, 119, 122, 123, 125, 126, 127, 129, 130, 131, 132, 133, 134, 135, 136, 137, or 139.
7. The siRNA according to any one of claims 1-6, wherein the sense strand has the nucleotide sequence shown in SEQ ID No:52; and the antisense strand has the nucleotide sequence shown in SEQ ID No:122; or Its sense strand has the nucleotide sequence shown in SEQ ID No:56; and its antisense strand has the nucleotide sequence shown in SEQ ID No:
126. or Its sense strand has the nucleotide sequence shown in SEQ ID No:57; and its antisense strand has the nucleotide sequence shown in SEQ ID No:127; or Its sense strand has the nucleotide sequence shown in SEQ ID No: 60; and its antisense strand has the nucleotide sequence shown in SEQ ID No: 130; or Its sense strand has the nucleotide sequence shown in SEQ ID No: 61; and its antisense strand has the nucleotide sequence shown in SEQ ID No:
131. or Its sense strand has the nucleotide sequence shown in SEQ ID No:62; and its antisense strand has the nucleotide sequence shown in SEQ ID No:132; or Its sense strand has the nucleotide sequence shown in SEQ ID No:64; and its antisense strand has the nucleotide sequence shown in SEQ ID No:
134.
8. A GalNAc-siRNA comprising a conjugate formed by coupling an siRNA molecule with an N-acetylgalactosamine GalNAc molecule, wherein the siRNA molecule is the siRNA as described in any one of claims 1-7.
9. A pharmaceutical composition comprising: a) the siRNA according to any one of claims 1 to 7, or the GalNAc-siRNA according to claim 8; and b) An optional pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is one or more components selected from the group consisting of: excipients, solvents, diluents, stabilizers, dispersants, buffers, compatibilizers, preservatives, and combinations thereof.
10. A kit comprising the siRNA of any one of claims 1 to 7, or the GalNAc-siRNA of claim 8, or the pharmaceutical composition of claim 9, and optionally an instrument and / or instructions for use for delivering the siRNA, the GalNAc-siRNA, the pharmaceutical composition, or the formulation to the liver of a subject.
11. The use of the siRNA of any one of claims 1 to 7 or the GalNAc-siRNA of claim 8 in the preparation of a medicament for treating hyperuricemia or hyperuricemia-related renal insufficiency.
Citation Information
Patent Citations
Carbohydrate conjugates as delivery agents for oligonucleotides
US8106022B2