CRISPRi (clustered regularly interspaced short palindromic repeats i) system, recombinant strain containing CRISPRi system, construction method and application of recombinant strain, and gibberellin production method
By constructing the CRISPRi system, which includes a non-cleavage-active dCas9 mutant protein and sgRNA, and combining it with an induction regulatory component, precise gene regulation of *Fujikura fujikura* was achieved, solving the problem of limited gibberellin production from *Fujikura fujikura*, significantly increasing gibberellin yield and adapting it to industrial production.
Patent Information
- Application Number
- CN202511267989.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-05
- Publication Date
- 2026-01-09
AI Technical Summary
In the existing technology, the production of Gibberellin (GA3) from Fumigranobacterium tumefaciens is limited in output and lacks a high-efficiency CRISPRi system adapted to Fumigranobacter tumefaciens, which cannot meet the needs of industrial production.
A CRISPRi system is provided, comprising a non-cleavage-active dCas9 mutant protein, sgRNA, and an inducible regulatory component. This system achieves precise and efficient gene regulation by targeting and inhibiting the expression of specific genes and combining the inducible regulatory component. Recombinant strains are constructed and an inducer is added during fermentation to control the expression of the dCas9 mutant protein.
It significantly increases gibberellin yield by more than 35%, ensures strain stability and growth, has strong regulatory specificity, and is suitable for industrial production needs.
Smart Images

Figure CN121294488A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genetic engineering, in particular to a CRISPRi system, a recombinant strain containing the CRISPRi system, a construction method and application thereof, and a gibberellin production method. BACKGROUND
[0002] Gibberellin acid (GA3) is a kind of natural plant growth hormone of tetracyclic diterpenes, which is listed together with auxin, cytokinin and other hormones as the five major hormones of plants, and has important regulatory effects on promoting stem elongation, inducing flowering, breaking seed dormancy, etc. It is widely used in agriculture, forestry and food brewing fields, and has a strong market demand.
[0003] At present, the industrial production of GA3 relies on microbial fermentation method, among which Fusarium fujikuroi has the natural ability to synthesize GA3 efficiently and becomes the only industrial production strain. In recent years, CRISPRi (CRISPR interference) technology has attracted widespread attention as a precise transcription regulation tool. Unlike traditional CRISPR systems, CRISPRi uses a dCas9 protein to bind to the transcription initiation region of the target gene under the guidance of sgRNA, blocks the binding of RNA polymerase, and thus inhibits gene expression without changing the genomic sequence. By using an inducible promoter to regulate the expression of dCas9, the temporal and spatial specific regulation of genes can be achieved, that is, the expression of necessary genes is retained in the early growth stage of the strain to maintain cell survival, and the synthesis of target products is carried out in the production stage.
[0004] However, at present, the application of CRISPRi technology in Fusarium fujikuroi is still in its infancy, and there is a lack of mature induction and regulation system, which has poor specificity and cannot meet the demand for high-yield strains of GA3 in industrial production. Therefore, it is of great theoretical and application value to establish a high-efficiency CRISPRi system suitable for Fusarium fujikuroi and realize precise and reversible regulation in order to improve the synthesis efficiency of GA3. SUMMARY
[0005] The purpose of the present application is to overcome the problems of limited production of gibberellin (GA3) by Fusarium fujikuroi and lack of high-efficiency CRISPRi system suitable for Fusarium fujikuroi in the prior art, and to provide a CRISPRi system, a recombinant strain containing the CRISPRi system, a construction method and application thereof, and a gibberellin production method. The CRISPRi system can precisely and efficiently regulate the gene expression of Fusarium fujikuroi, significantly improve the yield of gibberellin, has little effect on the growth of the strain, is reversible and specific, and has the advantages of being suitable for Fusarium fujikuroi.
[0006] In order to achieve the above-mentioned purpose, the present application provides a CRISPRi system in one aspect, the CRISPRi system comprising a coding gene of a dCas9 mutant protein without cleavage activity, an sgRNA and an induction regulation component; The induction regulation component is used for regulating the expression of the dCas9 mutant protein coding gene; the sgRNA guides the dCas9 mutant protein to bind to a target gene, thereby inhibiting the expression of the target gene; the dCas9 mutant protein is obtained by mutation on the basis of a Cas9 protein, and the mutation sites are D10A and H840A of the dCas9 protein; the target gene comprises at least one of a gene encoding squalene synthase, a gene encoding fatty acid synthase, a gene encoding carotenoid, a gene encoding acoranol, a gene encoding bika mycotoxin, a gene encoding fumonisin, a gene encoding fumonisin, a gene encoding fumonisin, a gene encoding aperhexidine F, a gene encoding monodactyl fungus and a gene encoding white fungus.
[0007] The second aspect of the present application provides a recombinant strain containing the CRISPRi system as described above.
[0008] The third aspect of the present application provides a method for constructing a recombinant strain, the method comprising: introducing the CRISPRi system as described above into a starting strain.
[0009] The fourth aspect of the present application provides the use of the CRISPRi system as described above, the recombinant strain as described above and the recombinant strain constructed by the method as described above in improving the yield of fusarinic acid.
[0010] The fifth aspect of the present application provides a method for producing fusarinic acid, the method comprising: fermenting the recombinant strain as described above and / or the recombinant strain constructed by the method as described above for 48-72 h, and then adding an inducing agent for culture.
[0011] Through the above technical solution, the present application precisely targets the squalene synthase gene through the sgRNA, guides the dCas9 mutant protein to inhibit the expression thereof, so that the yield of fusarinic acid is increased by more than 35% compared with the original strain; the D10A and H840A double mutation eliminates the cleavage activity of the dCas9 mutant protein, only retains the binding ability, avoids the risk of genome mutation, and the influence rate on non-target genes is less than 10%, so as to ensure the normal growth of the strain; the induction regulation component can control the expression of the gene encoding the dCas9 mutant protein according to the fermentation stage, retains the target gene function to meet the demand of the strain in the early growth stage, activates the regulation in the later period to improve the synthesis efficiency of the product, so that the biomass and product efficiency are significantly improved.
[0012] The CRISPRi system provided by the application is introduced into a host cell G. fujikuroi by a plasmid, is simple to construct, has high stability of components, is suitable for industrial production, and can be extended in application by replacing sgRNA, and has good industrial prospects. BRIEF DESCRIPTION OF DRAWINGS
[0013] Figure 1 is a CRISPRi (pAT-dCas9) plasmid map in Example 1; Figure 2 is a GA3 production graph of inhibition of the squalene pathway in Example 2; Figure 3 is a graph of the relative expression level change of squalene synthase in Example 2; Figure 4 is a GA3 production graph of inhibition of the fatty acid pathway in Example 3; Figure 5 is a GA3 production graph of inhibition of ten bypass gene cluster pathways in Example 4. DETAILED DESCRIPTION
[0014] The endpoints of the ranges and any values disclosed herein are not limited to the precise values recited as the exact dimensions are not critical to the application. Any numeric range recited is intended to include all values from the lower value to the upper value, inclusive of both values, and to also disclose all values individually. For numerical ranges recited as having endpoints, the endpoints are included in the ranges. The disclosure is also directed to individual values that fall within the disclosed ranges.
[0015] The first aspect of the application provides a CRISPRi system, comprising a coding gene of a dCas9 mutant protein without cutting activity, sgRNA and an inducible regulation component; The inducible regulation component is used to regulate the expression of the dCas9 mutant protein coding gene; the sgRNA guides the dCas9 mutant protein to bind to a target gene, thereby inhibiting the expression of the target gene; the dCas9 mutant protein is obtained by mutation on the basis of a Cas9 protein, and the mutation sites are D10A and H840A of the dCas9 protein; the target gene includes at least one of a gene encoding squalene synthase, a gene encoding fatty acid synthase, a gene encoding carotenoid, a gene encoding acoranol, a gene encoding bika mycotoxin, a gene encoding fumonisin, a gene encoding fusaric acid, a gene encoding fusaric acid, a gene encoding fuscocidin, a gene encoding aperhexadine F, a gene encoding monodactyl fungus, and a gene encoding white fungus.
[0016] The gene design of the CRISPRi system provided by the present application significantly improves the synthesis efficiency of gibberellic acid; the dCas9 mutant protein without cleavage activity only retains the binding function, avoids the risk of genome damage, and ensures the safety of regulation and the stability of the strain; the sgRNA can specifically recognize the sequence of the target gene (including the squalene synthase gene), guide the precise binding of the dCas9 protein to the target, reduce the interference to other genes, and ensure the high specificity of regulation; the induction regulation component can control the expression time of the dCas9 mutant protein as needed, realize the dynamic switching of the growth stage and the product synthesis stage of the strain, and balance the reproduction of the strain and the accumulation of the product. The CRISPRi system provided by the present application is constructed by introducing a plasmid into a host cell (Gibberella fujikuroi), which is simple to operate and has high component stability, and has good industrial potential.
[0017] The nucleotide sequence provided by the present application can be obtained by polymerase chain reaction (PCR) amplification method, recombination method, or artificial synthesis method. Once the nucleotide sequence is obtained, the amino acid sequence can be obtained in large quantities by recombination method. In addition, the nucleotide sequence can also be synthesized by a known artificial chemical synthesis method.
[0018] According to the present application, preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding squalene synthase is shown as SEQ ID NO. 1. The sgRNA sequence (nucleotide sequence shown as SEQ ID NO. 1) can accurately match the gene encoding squalene synthase, ensure the efficient target binding and inhibition of the expression of the dCas9 mutant protein, and the present inventors found that the directional distribution efficiency of the precursor substance to the gibberellic acid synthesis pathway can be significantly improved.
[0019] According to the present application, preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding fatty acid synthase is shown as SEQ ID NO. 2 and SEQ ID NO. 3.
[0020] Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding carotenoid is shown as SEQ ID NO. 4.
[0021] Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding aconitic acid is shown as SEQ ID NO. 5.
[0022] Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding bika mycin is shown as SEQ ID NO. 6.
[0023] Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding fumonisin is shown as SEQ ID NO. 7.
[0024] Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding fusaric acid is shown as SEQ ID NO. 8.
[0025] Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding fusarin is shown as SEQ ID NO. 9.
[0026] Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding fusarin is shown as SEQ ID NO. 9.
[0027] Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding fusarin is shown as SEQ ID NO. 9.
[0028] Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding fusarin is shown as SEQ ID NO. 9.
[0029] Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding fusarin is shown as SEQ ID NO. 9.
[0030] The inventors found that compared with single target regulation, expanding the target genes to the above-mentioned multiple genes can significantly improve the gibberellin yield; the exclusive sgRNA sequence (nucleotide sequence shown as SEQ ID NO. 2-13) provided for each target gene is highly matched with the corresponding gene, ensuring the specificity of multi-target regulation; this synergistic regulation mode can significantly improve the gibberellic acid yield compared with single target regulation; at the same time, the multi-target design gives the system flexible regulation combination space, which can select the targeted combination according to the fermentation demand, and improve the adaptability and economy of industrial production.
[0031] According to the present application, preferably, the dCas9 mutant protein with no cleavage activity comprises an amino acid sequence with 80% or more, preferably 95% or more, further preferably 98% or more, most preferably 99% or more identity to the amino acid sequence shown as SEQ ID NO. 13, and has the activity of dCas9 mutant protein; preferably, the amino acid sequence of the dCas9 mutant protein is shown as SEQ ID NO. 14. The dCas9 mutant protein and its encoding gene defined in the present application ensure the stability of the non-cleavage activity and target gene binding ability of the protein by specifying the amino acid sequence identity and preferred sequence, and provide core function guarantee for efficient regulation of the system; the sequence range design with high identity not only retains the conservation of protein function, but also reserves space for possible sequence optimization in genetic engineering operation, and enhances the applicability of the system.
[0032] According to the application, preferably, the inducible regulatory component is a tetracycline inducible regulatory system, which comprises a G. fujikuroi endogenous promoter, a coding gene of a regulatory protein and a regulatory sequence. In addition, the inducible regulatory component used in the application can also be nitrogen inducible (using a nitrogen-responsive promoter), copper ion inducible (using a copper-responsive promoter), carbon source inducible (growth-dependent promoter).
[0033] Preferably, the G. fujikuroi endogenous promoter is PTEF, the nucleotide sequence of which is shown in SEQ ID NO. 15.
[0034] Preferably, the regulatory protein is TetR protein, the nucleotide sequence of the coding gene of which is shown in SEQ ID NO. 16.
[0035] Preferably, the regulatory sequence is tetO gene sequence, the nucleotide sequence of which is shown in SEQ ID NO. 17.
[0036] The inventors have found that the above-mentioned preferred tetracycline inducible regulatory system is suitable for G. fujikuroi, the endogenous PTEF promoter (the nucleotide sequence of which is shown in SEQ ID NO. 15) can ensure efficient expression of the regulatory component in the strain, avoiding the problem of low efficiency of expression of heterologous promoters; the precise interaction of TetR protein and tetO sequence (SEQ ID NO. 16-17) can achieve strict induction control of dCas9 mutant protein expression - almost no expression without inducer, rapid start after adding, and significant timeliness and strictness of regulation; this set of components does not require complex cofactors and can be flexibly regulated by tetracycline inducers, which meets the simple operation requirements of industrial fermentation, and the target gene inhibition efficiency after induction is greatly improved compared with non-induction systems.
[0037] The second aspect of the application provides a recombinant strain containing the CRISPRi system as described above.
[0038] The third aspect of the application provides a method for constructing a recombinant strain, which comprises introducing the CRISPRi system as described above into a starting strain.
[0039] According to the application, preferably, the starting strain is G. fujikuroi. The CRISPRi system provided by the application is highly suitable for G. fujikuroi and can be efficiently compatible with the genetic background of the strain, avoiding the problem of expression disorder of heterologous systems in the host, ensuring that the system stably exerts a regulatory function in G. fujikuroi, and laying a foundation for further efficient improvement of the production of kojic acid.
[0040] The fourth aspect of the present application provides the use of the CRISPRi system as described above, the recombinant strain as described above and the recombinant strain constructed by the method as described above in improving the production of gibberellic acid. The CRISPRi system, the recombinant strain and the recombinant strain constructed by the corresponding method of the present application can precisely regulate the target genes provided by the present application in Gibberella fujikuroi, and provide an efficient and stable technical means and strain resource for industrial production of gibberellic acid.
[0041] The fifth aspect of the present application provides a method for producing gibberellic acid, which comprises culturing the recombinant strain as described above and / or the recombinant strain constructed by the method as described above for 48-72 h and then adding an inducer.
[0042] The inventors have found that the method for producing gibberellic acid is scientifically designed. The recombinant strain is allowed to accumulate sufficient biomass through 48-72 h of fermentation culture, which is consistent with the growth law of the strain. Then, the inducer is added to start the inhibition of the target genes provided by the present application by the CRISPRi system, which not only guarantees the growth of the strain, but also efficiently improves the production of the product. The method is simple to operate and suitable for industrial fermentation process, and can further stably realize the efficient production of gibberellic acid.
[0043] According to the present application, preferably, the conditions for the culture with the inducer comprise: the time is 2-4 days, the temperature is 20-30 DEG C, and specifically can be 20 DEG C, 22 DEG C, 28 DEG C, 30 DEG C, or any value between the above two values. The temperature range is suitable for the optimal growth requirement of Gibberella fujikuroi, and can guarantee the normal metabolism of the strain and the efficient expression of the elements of the CRISPRi system; the rotation speed is 180-250 rpm, and specifically can be 180 rpm, 200 rpm, 220 rpm, 250 rpm, or any value between the above two values. The inventors have found that the rotation speed setting is suitable for the fermentation requirement of the recombinant strain, which can not only guarantee sufficient oxygen supply in the fermentation system to meet the demand of respiratory metabolism and biomass accumulation of the strain, but also avoid mechanical damage of the strain caused by too high rotation speed, thereby improving the controllability and product yield of the production; the concentration of the inducer is 0.8-2 μg / mL, and specifically can be 0.8 μg / mL, 1 μg / mL, 1.5 μg / mL, 2 μg / mL, or any value between the above two values. The inventors have found that the preferred embodiment is suitable for the system regulation requirement, which can effectively start the TetR-tetO regulation system, ensure the efficient expression of the dCas9 mutant protein and inhibit the target genes, and avoid potential inhibition of the strain growth caused by too high concentration, thereby maintaining the metabolic activity of the strain while guaranteeing the regulation efficiency, and further improving the stability and economy of the gibberellic acid synthesis.
[0044] According to the present invention, preferably, the inducer is doxycycline. It exhibits stronger binding specificity to the TetR protein, enabling more precise triggering of the regulatory system. Compared to other tetracycline inducers, it can achieve highly efficient regulation of dCas9 mutant protein expression within a preferred concentration range. Simultaneously, doxycycline demonstrates good stability in the fermentation system, is not easily degraded, and can maintain its induction effect for a longer period, further ensuring the persistence of target gene inhibition and the stability of gibberellic acid synthesis.
[0045] The present invention will be described in detail below through examples. In the following examples, *Fusarium oxysporum* was obtained from Professor Huang He's team at Nanjing Normal University, disclosed in patent CN118813664A, number CCTCC NO. M 20221848; the ClonExpress MultiS One Step Cloning Kit was purchased from Nanjing Novizan Biotechnology Co., Ltd.; PFC332 was purchased from the Addgene website (number 87845); doxycycline was purchased from Maclean's; the reverse transcriptase kit (HiScript IV All-in-One Ultra RT SuperMix for qPCR) was purchased from Nanjing Novizan Biotechnology Co., Ltd.; the remaining raw materials and reagents were all commercially available products.
[0046] Covering medium refers to MYG medium with less agar than ordinary solid medium, used to cover plates. The specific components and contents are as follows: glucose 20 g / L, peptone 3 g / L, yeast extract 3 g / L, dipotassium hydrogen phosphate 1 g / L, magnesium sulfate heptahydrate 0.5 g / L, potassium chloride 0.5 g / L, ferrous sulfate heptahydrate 0.01 g / L, sucrose 171.4 g / L, and agar 20 g / L.
[0047] YPD plate components and contents: glucose 20 g / L, peptone 20 g / L, yeast extract 10 g / L and agar 20 g / L.
[0048] Example 1: Constructing the CRISPRi System The construction of the CRISPRi system includes the following steps: S1. To conduct transcriptional regulation using the CRISPR system, this invention employs a catalytically inactivated version of the Cas9 (dCas9) protein lacking endonuclease activity (its nucleotide sequence is shown in SEQ ID NO. 14). The dCas9 mutant protein contains two point mutations in its RuvC nuclease (D10A) and HNH nuclease (H840A) domains. Using the plasmid pUC-Cas9-HTBNLS-hph-sgRNA as a template (from Professor Huang He's laboratory at Nanjing Normal University, available in the literature doi:10.1021 / acssynbio.8b00478), these two point mutations were introduced through two rounds of circular PCR (CiPCR) to obtain the pFfdCas9-hph-sgRNA plasmid. Details of the CiPCR system are shown in Table 1. Table 1
[0049] In the first round of cyclic polymerase chain reaction (PCR), a pair of primers, dCas9-M1-F and dCas9-M1-R (primer sequences are shown in Table 2), were used to amplify the template pUC-Cas9-HTBNLS, resulting in a point mutation (D10A) in the RuvC nuclease domain, thereby obtaining pFfCas9-M1. Similarly, in the second round of circular polymerase chain reaction (PCR), a pair of primers, dCas9-M2-F and dCas9-M2-R (primer sequences are shown in Table 2), were used to amplify the template pFfCas9-M1 obtained in the previous step, achieving a point mutation (H840A) in the HNH nuclease domain, thereby obtaining the plasmid pFfdCas9-hph-sgRNA. S2. To achieve tetracycline regulation of CRISPRi, the pFfdCas9-hph-sgRNA plasmid was digested with EcoRI to obtain a linearized vector backbone. Using the genome of *Fusarium oxysporum* (CCTCC NO. M 20221848) as a template, primers PTEF-F and PTEF-R (primer sequences are shown in Table 2) were used to amplify the endogenous promoter fragment 1: PTEF from *Fusarium oxysporum*.
[0050] This invention commissioned Genewiz to synthesize the sequence TetR (nucleotide sequence as shown in SEQ ID NO.16), and used primers TetR-F and TetR-R (primer sequences are shown in Table 2) to amplify fragment 2: TetR.
[0051] The linearized vector was ligated using the ClonExpress MultiS One Step Cloning Kit, and fragments 1 and 2 obtained above were ligated (cloning system is shown in Table 3) to obtain plasmid TetR-dCas9-hph-sgRNA.
[0052] Table 3
[0053] Subsequently, the plasmid TetR-dCas9-hph-sgRNA, as described above, was digested using the SnaBⅠ enzyme. The sequence tetO (its nucleotide sequence is shown in SEQ ID NO. 17) was synthesized by Genewiz, and the tetO fragment was amplified using primers tetO-F and tetO-R (primer sequences are shown in Table 2). This tetO fragment was inserted between the promoter PGPD and dCas9 to obtain the plasmid pT-dCas9.
[0054] S3. Finally, the plasmid pT-dCas9 obtained in step S2 was digested with HindIII; and using PFC332 (purchased from addgene website, item number 87845) as a template, the fungal replicon sequence AMA1 was amplified using AMA1-F and AMA1-R primers (primer sequences are shown in Table 2). The vector backbone and fragment AMA1 were assembled using the ClonExpress MultiS One Step Cloning Kit, finally obtaining the plasmid pAT-dCas9 (gene map shown in Table 2). Figure 1 (As shown).
[0055] Example 1: A double mutation of dCas9 protein (D10A and H840A) was achieved through two rounds of circular PCR, constructing a basic plasmid containing non-cleavage-active dCas9. This plasmid was then assembled with the endogenous PTEF promoter from *Fusarium oxysporum*, the TetR protein-coding gene, and the tetO regulatory sequence to form a tetracycline-inducible regulatory component. Finally, the fungal replicon sequence AMA1 was inserted, successfully constructing the CRISPRi system plasmid pAT-dCas9. This plasmid possesses the function of inducibly regulating dCas9 expression and can stably replicate in *Fusarium oxysporum*, laying a core vector foundation for subsequent precise regulation of target genes using CRISPRi technology.
[0056] Example 2 Inhibiting the squalene synthesis pathway using the CRISPRi system to increase gibberellic acid (GA3) yield Squalene competes with gibberellin for the precursor acetyl-CoA; however, its downstream derivative ergosterol is an important component of the cell membrane, therefore it cannot be knocked out, only downregulated. The gene erg9 (FFUJ_04233) encoding squalene synthase in *Fusarium oxysporum* was searched using NCBI. The CRISPRi system obtained in Example 1 was used to inhibit the squalene pathway, including the following steps: S1. Use the website (https: / / crispr.dbcls.jp / ) to design a 20bp target sequence (agcttcgatcgatcatccaa) adjacent to PAM (5'-NGG-3'); the target sequence should be located in the -50 to +300 region of the transcription start site (TSS).
[0057] S2. Digest the pAT-dCas9 plasmid obtained in Example 1 with AgeⅠ enzyme and insert erg9-N20 (erg9-N20-F, erg9-N20-R, primer sequences are shown in Table 2) to obtain plasmid pAT-dCas9-erg9i.
[0058] S3, Transformation Experiment Take 100 μL of *Fujikura scab* protoplasts, add 50 μL of STC solution (18.217 g sorbitol, 0.555 g anhydrous calcium chloride, 0.121 g Tris-base, adjusted to pH 7.5 with HCl; STC solution is a commonly used buffer solution in microbial experiments, its core function is to maintain the stability of protoplasts and assist in the transformation process, widely used in gene editing or cell manipulation experiments of fungi, bacteria, etc.), add 10 μg of the recombinant plasmid pAT-dCas9-erg9i obtained in step S2, mix, and incubate on ice for 20 minutes. Then add 50 μL of 25% PEG6000 solution (containing 1M sorbitol, 10mM Tris-Cl, 50mM CaCl2, pH=7.5), mix, and incubate on ice for 20 minutes. Add 1 mL of PEG6000 solution, mix at room temperature for 5 minutes, then add 2 mL of STC solution, mix well, spread on MYG solid regeneration plates, and culture for 12 minutes. After h, cover with 10 mL of hygromycin-containing plate medium at a concentration of 100 μg / ml and wait 5-7 days for the transformants (Fujikura recombinant strains successfully introduced with recombinant plasmid pAT-dCas9-erg9i) to appear.
[0059] S4 induces expression of dCas9 mutant protein. Transcription of the gene encoding the dCas9 mutant protein is induced by doxycycline, and its transcription is inhibited in the absence of doxycycline in the culture medium. The specific steps include: streaking *Fujikura scab* containing the pAT-dCas9-erg9i replication plasmid obtained in step S2 onto YPD plates containing 100 μg / ml hygromycin, and culturing at 28°C for 4 days. The mycelial blocks are then inoculated into seed culture medium (60 g / L glucose, 5 g / L yeast extract, 0.2 g / L MgSO4·7H2O, and 1.5 g / L KH2PO4), and cultured at 28°C and 220 rpm for 48 h. Finally, the inoculum is transferred at a 10% (v / v) inoculum to fermentation medium (90 g / L glucose, 13.14 g / L defatted soybean meal, 0.1 g / L MgSO4·7H2O, and 1.5 g / L KH2PO4), and cultured for 50 h. This is because ergosterol, a downstream derivative of squalene, is required in the early stages of cell growth. It constitutes an important component of the cell membrane, maintaining cell growth and proliferation. Next, 1 μg / mL doxycycline was added, and the cells were cultured at 28°C and 220 rpm for 3 days. At this time, the dCas9 mutant protein was induced to express, inhibiting the activity of squalene synthase. The fermentation broth was filtered, and the yield of gibberellic acid (GA3) in the fermentation broth was detected using high-performance liquid chromatography. The GA3 yield at this point was as follows: Figure 2 As shown, the yield of GA3 was 33.2% higher than that of the control strain (starting strain of Fumigation fusarium), reaching 1.06 g / L.
[0060] S5, qPCR to measure gene expression levels After inducing dCas9 mutant protein expression as described in step S4, *Fujikura fusarium* cells were recovered by centrifugation at 12000 rpm for 10 minutes. The cell pellet was washed with 1 mL of 0.5M PBS and frozen in liquid nitrogen. The frozen cells were used to prepare total RNA (FastPure® Cell / Tissue Total RNA Isolation Kit, Vozyme). 1 μg of RNA was taken and cDNA was prepared using the HiScript IV All-in-One Ultra RT SuperMix for qPCR (Vozyme) reverse transcriptase kit. The relative expression level of erg9 was then measured using a qPCR kit (Hieff® qPCR SYBR Green Master Mix). The changes in the relative expression level of squalene synthase are shown in the figure below. Figure 3 As shown, the level of erg9 in cells with added doxycycline dropped to almost zero. After washing the cells and placing them back in cells without doxycycline, the original expression level of erg9 could be restored, indicating that the strategy of inhibiting the squalene pathway based on the CRISPRi system is effective and reversible.
[0061] Example 2: By designing an sgRNA targeting the erg9 gene encoding squalene synthase in *Fujikura fujiri*, a recombinant plasmid pAT-dCas9-erg9i was constructed and transformed into *Fujikura fujiri*. After fermentation, doxycycline was added to induce dCas9 expression, successfully achieving specific inhibition of the squalene synthase gene. The results showed that the gibberellic acid (GA3) yield increased by 33.2% compared to the control, reaching 1.06 g / L. qPCR detection showed that the erg9 gene expression level almost dropped to zero after induction, and could be restored after removing the inducer. This confirms that the CRISPRi system can effectively and reversibly inhibit the squalene synthesis pathway, reduce the diversion of the precursor acetyl-CoA to squalene, and thus improve the synthesis efficiency of gibberellic acid (GA3).
[0062] Example 3 Inhibiting fatty acid synthesis pathways using the CRISPRi system to increase gibberellic acid (GA3) production The CRISPRi system obtained in Example 1 was used to inhibit the fatty acid pathway, including the following steps: S1. Search NCBI for the genes FAS1 (KLP10033.1) and FAS2 (FFUJ_04562) encoding fatty acid synthase systems in Fusarium oxysporum.
[0063] S2. Similar to step S2 in Example 2, two sgRNAs were inserted to target FAS1 and FAS2 respectively, resulting in plasmid pAT-dCas9-FASi. The nucleotide sequence of FAS1-N20 is shown in SEQ ID NO. 2, and the nucleotide sequence of FAS2-N20 is shown in SEQ ID NO. 3. The nucleotide sequences of the primers involved, FAS1-N20-F, FAS1-N20-R, FAS2-N20-F, and FAS2-N20-R, are shown in Table 2.
[0064] Table 2
[0065] S3, the transformation experiment, and the dCas9 mutant protein induction experiment were the same as in Example 2. The aim was to allow normal FAS expression and fatty acid synthesis in the early stage of cell growth; and to induce inhibition of FAS expression in the later stage of cell growth to reduce fatty acid synthesis and redirect carbon flow from acetyl-CoA to GA3 biosynthesis. The fermentation broth was filtered, and the yield of gibberellic acid (GA3) in the fermentation broth was then detected by high-performance liquid chromatography. At this point, the GA3 yield was as follows: Figure 4 As shown, the yield of GA3 was 24.7% higher than that of the control (starting strain of Fusarium oxysporum), reaching 0.998 g / L, proving that downregulating the fatty acid synthesis pathway can effectively promote the synthesis of GA3.
[0066] Example 3: Recombinant plasmid pAT-dCas9-FASi was constructed by designing sgRNAs targeting the genes encoding the fatty acid synthase system FAS1 and FAS2 in *Fusarium oxysporum*, and transformed into *Fusarium oxysporum*. Using the same transformation and induction strategy as in Example 2, the expression of FAS1 and FAS2 was induced to be inhibited in the later stages of cell growth. The results showed that the production of gibberellic acid (GA3) increased by 24.7% compared to the control, reaching 0.998 g / L, effectively promoting the synthesis of GA3.
[0067] Example 4 The CRISPRi system was used to suppress ten genes to increase the production of gibberellic acid (GA3).
[0068] Similar to Examples 2 and 3, the genes described in Table 4 were downregulated using CRISPRi. Ten sgRNAs were inserted into the vector of the plasmid pAT-dCas9 obtained in the examples to obtain plasmid pAT-dCas9-GC10i. The target sequences of the target genes are shown in Table 4.
[0069] Table 4
[0070] After 8 days of fermentation, the yield of GA3 was detected by high-performance liquid chromatography, and the results are as follows: Figure 5 As shown, GA3 reached 3.3 g / L, which is 4.1 times that of the control strain (starting strain of Fumigranobacter fusiforme), significantly improving the synthesis efficiency of gibberellic acid GA3 and fully demonstrating the great potential of multi-target synergistic regulation in improving gibberellic acid production.
[0071] Example 5 Gibberellic acid was synthesized using the method described in Example 4, except that the regulated target gene was replaced with the corresponding gene and gene combination (numbered 1-9) in Table 5. The yield of gibberellic acid obtained is shown in Table 5.
[0072] Comparative Example 1 Gibberellic acid was synthesized using the method described in Example 4, except that the target gene was replaced with NiaD (FFUJ_12277), which encodes nitrate reductase (corresponding to number 10 in Table 5). The yield of gibberellic acid obtained is shown in Table 5.
[0073] Comparative Example 2 Gibberellic acid was synthesized using the method described in Example 2, except that the gene encoding the dCas9 protein in the CRISPRi system was replaced with the gene encoding the unmutated protein (corresponding to number 11 in Table 5). The yield of gibberellic acid obtained is shown in Table 5. Comparative Example 3 Gibberellic acid was synthesized using the method described in Example 2, except that the CRISPRi system used did not contain the induction regulation component (corresponding to number 12 in Table 5). The yield of gibberellic acid obtained is shown in Table 5.
[0074] Table 5
[0075] Based on the above experimental setup, it can be clearly observed that precise regulation of the expression of relevant genes using the CRISPRi system significantly improves the synthesis efficiency of gibberellic acid GA3, providing an efficient and feasible strategy for the industrial production of gibberellic acid.
[0076] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.
Claims
1. A CRISPRi system, characterized in that, The CRISPRi system includes the encoding gene of a non-cleaving dCas9 mutant protein, sgRNA, and inducible regulatory components. The induction and regulation component is used to regulate the expression of the gene encoding the dCas9 mutant protein; the sgRNA guides the dCas9 mutant protein to bind to the target gene, thereby inhibiting the expression of the target gene; the dCas9 mutant protein is obtained by mutation based on the Cas9 protein, and the mutation sites are D10A and H840A of the dCas9 protein; the target gene includes at least one of the following: a gene encoding squalene synthase, a gene encoding fatty acid synthase, a gene encoding carotenoids, a gene encoding calciferol, a gene encoding bicalciferine, a gene encoding fumonisin, a gene encoding fusarium oleraceum, a gene encoding fusarium oleraceum, a gene encoding apixidin F, a gene encoding trichosporine, and a gene encoding beauveria bassiana.
2. The CRISPRi system according to claim 1, characterized in that, The nucleotide sequence of the sgRNA corresponding to the gene encoding squalene synthase is shown in SEQ ID NO.
1.
3. The CRISPRi system according to claim 1 or 2, characterized in that, The nucleotide sequences of the sgRNA corresponding to the gene encoding fatty acid synthase are shown in SEQ ID NO. 2 and SEQ ID NO. 3; Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding carotenoids is shown in SEQ ID NO. 4; Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding calsaurol is shown in SEQ ID NO. 5; Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding bicalcitonin is shown in SEQ ID NO.6; Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding fumonisin is shown in SEQ ID NO. 7; Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding fusaric acid is shown in SEQ ID NO. 8; Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding fusarium is shown in SEQ ID NO. 9; Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding falciparin is shown in SEQ ID NO. 10; Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding apixidin F is shown in SEQ ID NO. 11; Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding trichosporin is shown in SEQ ID NO. 12; Preferably, the nucleotide sequence of the sgRNA corresponding to the gene encoding beauveria bassiana is shown in SEQ ID NO.
13.
4. The CRISPRi system according to any one of claims 1-3, characterized in that, The non-cleavage-active dCas9 mutant protein comprises an amino acid sequence that is 80% or more, preferably 95% or more, more preferably 98% or more, and most preferably 99% or more identical to the amino acid sequence shown in SEQ ID NO. 13, and has the activity of dCas9 mutant protein; Preferably, the amino acid sequence of the dCas9 mutant protein is shown in SEQ ID NO.
14.
5. The CRISPRi system according to any one of claims 1-4, characterized in that, The induction and regulation component is a tetracycline-induced regulatory system, which includes an endogenous promoter of Fusarium oxysporum, a gene encoding a regulatory protein, and a regulatory sequence. Preferably, the endogenous promoter of *Fujikura fusarium* is PTEF, and its nucleotide sequence is shown in SEQ ID NO. 15; Preferably, the regulatory protein is the TetR protein, and the nucleotide sequence of the gene encoding the TetR protein is shown in SEQ ID NO. 16; Preferably, the regulatory sequence is the tetO gene sequence, the nucleotide sequence of which is shown in SEQ ID NO.
17.
6. A recombinant bacterial strain, characterized in that, The recombinant strain contains the CRISPRi system as described in any one of claims 1-5.
7. A method for constructing a recombinant bacterial strain, characterized in that, The method includes: introducing the CRISPRi system of any one of claims 1-5 into the starting strain.
8. The method according to claim 7, characterized in that, The starting strain was *Fujikura gibberellinii*.
9. The application of the CRISPRi system according to any one of claims 1-5, the recombinant strain according to claim 6, and the recombinant strain constructed by the method according to claim 7 or 8 in improving gibberellic acid production.
10. A method for producing gibberellic acid, characterized in that, The method includes fermenting the recombinant strain of claim 6 and / or the recombinant strain constructed by the method of claim 7 or 8 for 48-72 h and then adding an inducer for further culture. Preferably, the conditions for culturing with the addition of the inducing agent include: a time of 2-4 days, a temperature of 20-30℃, a rotation speed of 180-250 rpm, and a concentration of the inducing agent of 0.8-2 μg / mL; Preferably, the inducing agent is doxycycline.